ID: 912325405

View in Genome Browser
Species Human (GRCh38)
Location 1:108754385-108754407
Sequence TTTAGAGCTTTTTACATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 391}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912325405_912325407 19 Left 912325405 1:108754385-108754407 CCCTCAATGTAAAAAGCTCTAAA 0: 1
1: 0
2: 1
3: 34
4: 391
Right 912325407 1:108754427-108754449 AGCCTTGATTTTTCTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912325405 Original CRISPR TTTAGAGCTTTTTACATTGA GGG (reversed) Intronic
901164913 1:7212997-7213019 TTTAGCCCTTTATACATTGAAGG + Intronic
901262106 1:7880084-7880106 TTTAGAATTTTTTATACTGATGG - Intergenic
906014375 1:42561406-42561428 TTTAGAGTTTTTAACATGAAGGG - Intronic
907661049 1:56392718-56392740 TTTAGTGCTTTTTATTCTGAAGG - Intergenic
907695383 1:56721568-56721590 TTTAGAACTTTGTAAATAGAAGG - Intronic
908447231 1:64211176-64211198 TTTAGATCTTTCTTCATTTATGG + Intronic
909130914 1:71736063-71736085 TTTTGAGCTTTCTACACTGAGGG - Intronic
909490529 1:76221185-76221207 TCTAATGTTTTTTACATTGAGGG - Intronic
909703853 1:78557229-78557251 TTGAGAGCTTTTTATCATGAAGG - Intergenic
909862593 1:80627663-80627685 TTGAGAGCTTTTAACATGCAGGG + Intergenic
910362855 1:86431836-86431858 TTTAAAGCATTTTATCTTGATGG - Intronic
911501779 1:98695036-98695058 TTTAGAGCTTAATACATTCTGGG - Intronic
912090250 1:106064202-106064224 TTTACAGCTTTATATAGTGAGGG + Intergenic
912133012 1:106624964-106624986 TTTAGAGTTTTTAACATGAAGGG + Intergenic
912325405 1:108754385-108754407 TTTAGAGCTTTTTACATTGAGGG - Intronic
912884851 1:113460222-113460244 TTGAGAGTTTTTTACATTAAGGG - Intronic
912988768 1:114461727-114461749 CTTATAGCTTTTTAAGTTGATGG - Intronic
913132902 1:115858643-115858665 ATTTAAGCTGTTTACATTGAAGG + Intergenic
914463511 1:147906648-147906670 TTAATAGCTTTACACATTGAGGG - Intergenic
917167770 1:172132548-172132570 TTTAGTGATTTTTACATCTAGGG - Intronic
917356062 1:174127656-174127678 TTAAGAGCTTTTAACATGAAGGG + Intergenic
918792176 1:188842793-188842815 TTTGAAGCTTTTTAAATTGAAGG + Intergenic
918964077 1:191318594-191318616 TTTAGAATTTCTTACATAGAAGG - Intergenic
919044753 1:192436835-192436857 TATTGAGCTTTTAACCTTGACGG + Intergenic
919447879 1:197732209-197732231 TTAAGAAATTTTTACATTTATGG + Intronic
919543524 1:198881339-198881361 TTTTGAGATTTTTACACAGATGG - Intergenic
919599353 1:199603466-199603488 TTTAGAGTTTTTAACATGAAGGG - Intergenic
919986551 1:202679750-202679772 TTTGGAGTTTTTTCCATTGAAGG - Intronic
922308789 1:224368458-224368480 TTTAAACCTTTTTAAATAGAAGG - Intronic
922627410 1:227062797-227062819 TTTAGCACTTTTTACATGGGTGG - Intronic
922971445 1:229744180-229744202 TTGAGGGCTTTTTACATGAAGGG + Intergenic
923428792 1:233899532-233899554 TTGAGAGCTTTTATCATGGAAGG + Intergenic
924127784 1:240873625-240873647 TCTAGAGCTTTATAAATTAAAGG - Intronic
924412746 1:243823229-243823251 TTGAGAGTTTTTAACATTAAGGG - Intronic
1063184397 10:3637553-3637575 TTTATAGCATTTTACCTTTATGG + Intergenic
1065363678 10:24913890-24913912 TTTGGAGATTTTTAAATTCAGGG + Intronic
1066035540 10:31478696-31478718 TTTAGAAGTTTCTACATGGATGG + Intronic
1066422010 10:35272297-35272319 TTTTTAACTTTTTACATTCAGGG + Intronic
1067814528 10:49463363-49463385 TTTAGAGCATTTTAGATTTCAGG + Intronic
1068782807 10:60939948-60939970 TTTAGTGCTTTATAGATTTATGG + Intronic
1069340907 10:67407369-67407391 TTGAGAGCTTTTTACATGAAAGG - Intronic
1071035114 10:81235495-81235517 TTGAGAGTTTTTAACATGGAGGG + Intergenic
1072847169 10:98844344-98844366 TTTAGAGGTTCTTACATTTTGGG + Intronic
1073716968 10:106118576-106118598 TTGAGAGTTTTTAACATAGAGGG - Intergenic
1075333830 10:121595162-121595184 TTTAGAGATTTTTGTATTAAAGG - Intronic
1077238356 11:1496030-1496052 GTTAGTGCTTTTTACATTCTAGG - Intronic
1080490638 11:32760258-32760280 TTAAGACCTTTTTACATTACAGG - Exonic
1080888534 11:36388612-36388634 TTTAATCCTTTTTACATAGATGG + Intronic
1081410623 11:42753577-42753599 TTGAGAGCTTTTAACATGAAGGG + Intergenic
1081454601 11:43208898-43208920 TTTAGAGTTTTTAACATGAAGGG + Intergenic
1081683428 11:45024838-45024860 TTTGTAGCATTTCACATTGAGGG + Intergenic
1082804760 11:57440738-57440760 TTAAAAGCTTTTTACAGGGATGG + Intergenic
1082995720 11:59253480-59253502 CTTAGAGATTTTTAAATGGAAGG - Intergenic
1085813099 11:79704239-79704261 TTGAGAGCTTTTAACATAAAGGG - Intergenic
1085879242 11:80445973-80445995 TTTAAGGCTATTTACAATGAAGG - Intergenic
1086414335 11:86573821-86573843 TTGAGAGCTTTTAACATAAAAGG + Intronic
1086490016 11:87349776-87349798 TTTAGAGATTTTGACCTTCAGGG - Intergenic
1086568799 11:88259271-88259293 TTGAGAGCTTTTTAACATGAAGG + Intergenic
1087833669 11:102847615-102847637 CTTAGAGCTTATTCCATTGTTGG + Intergenic
1088218251 11:107537836-107537858 TTTAGATTTCTTTACACTGATGG + Intronic
1088498050 11:110452360-110452382 TGGAGAGCTTTTTACATAGCCGG - Intronic
1088869547 11:113879250-113879272 TTTAGAGCTTTACAATTTGACGG - Intergenic
1090752002 11:129754743-129754765 TTGAGAGTTTTTAGCATTGAAGG - Intergenic
1091770250 12:3146759-3146781 TCTATAGCTTTTTGCATTGCTGG - Intronic
1095761003 12:45836033-45836055 TTTAGGGCTTTTTAACCTGAGGG - Intronic
1096031506 12:48419926-48419948 TTTTGAGCTCTTTACCTGGAAGG - Intergenic
1096711019 12:53456065-53456087 CTAAGAGCTTTTTAAATTCAAGG + Intronic
1097010966 12:55953255-55953277 TTGAGACCTTTTGTCATTGAGGG - Intronic
1097333187 12:58354662-58354684 TTTAAAACTTTTCACATTAACGG - Intergenic
1099809270 12:87560120-87560142 TTTAGAGTTTTTAACATGAAGGG - Intergenic
1100069083 12:90688737-90688759 TTGAGGGCTTTATAAATTGAAGG + Intergenic
1101519320 12:105467032-105467054 TTGAGTTCTTTTTACATTCAAGG - Intergenic
1102402595 12:112643025-112643047 TTTAGAGCTATTGACATTTTGGG - Intronic
1103845616 12:123900243-123900265 TATATAGTTTTTTACATTTAGGG - Intronic
1104829799 12:131742356-131742378 TTGAAAGCTTTTTACTTTGAGGG + Intronic
1105701401 13:22938036-22938058 TTTGGAGCTTTTTCCGTTGGTGG + Intergenic
1106387137 13:29298751-29298773 TTTAGAGTTATTTACATTAAAGG - Intronic
1106521442 13:30501181-30501203 TTCCTAGCTTTTTATATTGATGG - Intronic
1107572723 13:41680247-41680269 TTTAGAGATTTTAACAATTAGGG - Intronic
1108914933 13:55596184-55596206 TTTGGAGCTATGTACATTCAAGG + Intergenic
1110138340 13:72097065-72097087 ATTAGGTCTTTTTACATAGATGG + Intergenic
1110611740 13:77495854-77495876 TTTAAATCTTTTAACTTTGAAGG + Intergenic
1110812315 13:79824373-79824395 TTTAGAGTTTTTAACATAAAGGG + Intergenic
1111104325 13:83626093-83626115 TTTCAACCTTTTTAAATTGATGG - Intergenic
1111311806 13:86498961-86498983 TATATATCTTTTTACATTGTTGG - Intergenic
1111789884 13:92841013-92841035 TTTAGGGCTTTCTACATATAAGG + Intronic
1112557699 13:100483880-100483902 TTTAATGCTGTTTCCATTGATGG + Intronic
1112982192 13:105399118-105399140 TTTAGAAATCTTTACAGTGAAGG - Intergenic
1113270614 13:108669488-108669510 TTAAGAGCTTTTTTTAATGATGG + Intronic
1113349580 13:109515257-109515279 TTTTGAATTTTTTAAATTGATGG + Intergenic
1113397271 13:109960179-109960201 TTGAGAGTTTTTTACATGAAGGG + Intergenic
1114067926 14:19081329-19081351 TTTGGAGTTTTTTACATAAAGGG - Intergenic
1114771787 14:25435506-25435528 TTTAGAGTTTTTAACATGAAGGG + Intergenic
1115063121 14:29218752-29218774 TTTAAAGCTTTTAAAATGGATGG - Intergenic
1115511499 14:34141795-34141817 TTTAGCCCATTTTACATTGAAGG - Intronic
1117751396 14:58927637-58927659 TTGAGAGCTTTTAACATGAAAGG - Intergenic
1117883484 14:60335006-60335028 TTTAAAGCATTTTACATGGAAGG - Intergenic
1117964400 14:61191752-61191774 TTTAGAGCCTTTGGCTTTGATGG + Intronic
1119188684 14:72663783-72663805 TTTTGAGCTTTTTTCCTTGCTGG - Intronic
1121996219 14:98605539-98605561 TTTATAGATTTTTGCATAGAAGG + Intergenic
1123984033 15:25628822-25628844 TTGAGAGTTTTTAACATTAAGGG + Intergenic
1124369765 15:29097527-29097549 GTTATTACTTTTTACATTGACGG + Intronic
1124850476 15:33333496-33333518 TTGAGAGCTTTTAACATGAAAGG - Intronic
1125846871 15:42863960-42863982 TTTAGGATTTTTTACTTTGAAGG - Intronic
1127180909 15:56416403-56416425 TTTAGAGTTTTTAACATAAAGGG + Intronic
1127201242 15:56654159-56654181 TTCAGTGCATTTTACTTTGATGG - Intronic
1127296412 15:57612582-57612604 TTTGGAGCTTGTTGCATTGTAGG + Intronic
1127759127 15:62120828-62120850 TTCAGAGCTTTTCACATTAGTGG - Intergenic
1129623659 15:77174029-77174051 TTTATAGCCTTGTACACTGAAGG + Intronic
1130349232 15:83075933-83075955 TTTACAACTTTATACTTTGAAGG + Intergenic
1131221311 15:90586661-90586683 TGTAGAACTTCTTACATGGAAGG + Intronic
1131445129 15:92492515-92492537 TTTGGAGCTGATTACATTTAAGG + Intronic
1133655896 16:7863434-7863456 TCTAGAAATTTCTACATTGATGG - Intergenic
1135173267 16:20205417-20205439 TATACTGCTTTTCACATTGATGG - Intergenic
1135554357 16:23423821-23423843 TATAAAGCTTTTAACATAGACGG + Intronic
1138671357 16:58617693-58617715 TTTTGAGGTGTTTACATTGAGGG - Intronic
1139049547 16:63107059-63107081 GTAATAGATTTTTACATTGATGG - Intergenic
1139287539 16:65829103-65829125 TTTATCGCTTTTTACATGGAGGG - Intergenic
1140298127 16:73728460-73728482 AATAGAACTTTTTACAATGATGG - Intergenic
1140669737 16:77265935-77265957 TTGAGAGTTTTTAACATTAAGGG + Intronic
1140858457 16:78998452-78998474 TTTAAAGATTTTTTCACTGAGGG + Intronic
1144421895 17:15106464-15106486 TTTAGATCATTTTATATAGAAGG - Intergenic
1145224112 17:21113595-21113617 TTTTGATTATTTTACATTGATGG + Intergenic
1145819894 17:27824210-27824232 TTTAAAACATTTTAAATTGAGGG + Intronic
1148357109 17:46982809-46982831 TTCAGAGCTTGTTACAGTAAGGG + Intronic
1148981989 17:51584783-51584805 TATGGAGCTTTCTACAGTGATGG - Intergenic
1149100703 17:52903060-52903082 TTTCTAGATTTTAACATTGATGG + Intergenic
1149106861 17:52979272-52979294 TTTAGAGCTGCATACATTTAAGG - Intergenic
1149187340 17:54015031-54015053 CTTAGAGCTATTTACTTTGAGGG + Intergenic
1150324747 17:64247693-64247715 TTTAGAGCTTTTTAGATGAGAGG + Intronic
1150364119 17:64566110-64566132 TTTAAAGATTTTTAAATTGGGGG - Intronic
1152138124 17:78518152-78518174 TTTAGACCATTTTGCATTTAAGG - Intronic
1153132871 18:1877425-1877447 GTAAGGGCTTTTTCCATTGATGG - Intergenic
1153606468 18:6838520-6838542 TTTAGAACTTTCTATAGTGATGG + Intronic
1154451701 18:14482718-14482740 TTTAGGGATGATTACATTGAGGG + Intergenic
1154451934 18:14485538-14485560 TTTAGGGATGATTACATTGAGGG + Intergenic
1155721962 18:29026374-29026396 TTTAGAGGTCTTCAGATTGACGG + Intergenic
1156379500 18:36544826-36544848 TTCAAAGCTTTTTATATTGCTGG - Intronic
1156616763 18:38795716-38795738 TTCAGTGCTTATTTCATTGAAGG + Intergenic
1156970535 18:43148954-43148976 TTTAGAGGGTTTTCCATAGAAGG - Intergenic
1157098496 18:44708959-44708981 TTTAGATCTTTTGACATTTCGGG - Intronic
1158014441 18:52766894-52766916 TATTGAGCTTTTACCATTGATGG - Intronic
1159706996 18:71702942-71702964 TTTAGAGCATTTTAGATTCACGG - Intergenic
1165583250 19:36888349-36888371 ATTAAAGATTTTTGCATTGACGG - Exonic
1166347755 19:42176980-42177002 TTTAAAGATTTTTAAATGGAAGG + Intronic
1168496078 19:56852693-56852715 TTGAGAGCTTTTTAGCATGAAGG + Intergenic
925523168 2:4770732-4770754 TTTACTGCTGTCTACATTGAGGG - Intergenic
926479064 2:13365556-13365578 TTTATAGGTTTTTACCATGAAGG - Intergenic
928352955 2:30579300-30579322 TTTAAAGCTGTATACATTAAAGG + Intronic
928860857 2:35855660-35855682 TTTAAAGCTTTTTAAGTTCAGGG - Intergenic
929390437 2:41462803-41462825 TTTAATGCTTTTGCCATTGAGGG - Intergenic
929408508 2:41670097-41670119 TTTAGTTCTTTTTTCATTTAGGG + Intergenic
929684557 2:44022719-44022741 TTTAGAGCTTTTTCTAATGCTGG + Intergenic
929705877 2:44211294-44211316 TATGGAACTTTTTCCATTGAGGG - Intronic
930175656 2:48298879-48298901 TTTAGAGTTTTTAACATGAAGGG + Intergenic
930251508 2:49039902-49039924 TTTATAACTTTCTACATTGGTGG + Intronic
930700122 2:54451313-54451335 TTGAGAGCCTTGTACATTGTTGG - Intergenic
930793740 2:55365088-55365110 TATAGAACTTTCTGCATTGATGG - Intronic
931068617 2:58618370-58618392 ATTATAACTTTTTACATTCATGG - Intergenic
931631506 2:64305591-64305613 TGCAGAGCTTTTTAGTTTGATGG + Intergenic
931956874 2:67437017-67437039 TTTAGATATTTTTAGATGGAAGG - Intergenic
932875668 2:75448670-75448692 TTTACAGCTTTTTAGTCTGAAGG + Intergenic
933270187 2:80224895-80224917 TTTAGAGCTGTTAAAATAGAAGG + Intronic
936717054 2:115199465-115199487 TTTAAAACTTTCTACATTAAGGG + Intronic
936811846 2:116412445-116412467 TTTAGAGCTACTTACTTTCATGG - Intergenic
937685912 2:124697114-124697136 TTTAGAATTTTTTAAATTTACGG + Intronic
937944327 2:127318679-127318701 TTTCCAGCTTTCTACATTGTAGG - Intronic
939313913 2:140521693-140521715 TTTAAGGCCATTTACATTGAAGG - Intronic
940213926 2:151285076-151285098 TTTAGTGCTTTTTACTTTTCTGG - Intronic
940367333 2:152862744-152862766 TTCAGAGCTTATTACAGTAAAGG + Intergenic
940493507 2:154394673-154394695 TTTTGAGCTTCTTATTTTGAAGG + Intronic
941743064 2:169056765-169056787 TTGAGAGCTTTTAACATGAAAGG - Intergenic
941870731 2:170382610-170382632 TTTAGTGATTTAGACATTGAAGG - Intronic
942428993 2:175889443-175889465 TTTGCAGCGTTTTACATAGATGG - Intergenic
943244339 2:185426839-185426861 TTTAAAGCTTTTCATATTCATGG - Intergenic
943296446 2:186146291-186146313 TTTAGAGTTTTTAACATGAAGGG - Intergenic
943619183 2:190128764-190128786 TTTATACATTTCTACATTGAGGG - Intronic
945331175 2:208540733-208540755 TTTAGAGATGTTTACATGGGAGG + Intronic
945661405 2:212689711-212689733 TTAAGATCTATTTACATTGTTGG - Intergenic
945836932 2:214845009-214845031 TTTCCAGCTTTTAACATTGGAGG + Intergenic
946704791 2:222447670-222447692 TTTACTGCATTTTACATAGATGG + Intronic
946775757 2:223139100-223139122 CTTAGAGCTTTTTTCTTTCACGG - Intronic
948035659 2:234856441-234856463 TTTAAACCTTTTTGCATTGTGGG - Intergenic
948545041 2:238722111-238722133 TTTAGCACTTTTTATATTCACGG - Intergenic
1168922862 20:1555071-1555093 TTTATTCCTTTATACATTGATGG - Intronic
1170051227 20:12147840-12147862 TTGAGAGTTTTTAACATGGAGGG - Intergenic
1170265611 20:14463724-14463746 TTGAGAGCTTTTAGCATGGAGGG + Intronic
1170496944 20:16934573-16934595 TTGAGAGTTTTTAACATTAAGGG - Intergenic
1170885478 20:20337043-20337065 TTCAGAGCTTCTGACATTAACGG - Intronic
1171207237 20:23290638-23290660 TGTAGAGACCTTTACATTGAGGG - Intergenic
1174975544 20:55329027-55329049 TTCAGAGATTTTTAGTTTGAAGG + Intergenic
1175041980 20:56061227-56061249 TTCAGAGCTTTGTACATTATTGG - Intergenic
1175616080 20:60399404-60399426 TTTAGAGTTTTTTTCCTTTATGG + Intergenic
1176344104 21:5725245-5725267 TTTAGAGCTTTTAACATGAAGGG + Intergenic
1176444443 21:6807502-6807524 TTTAGGGATGATTACATTGAGGG - Intergenic
1176500723 21:7599211-7599233 TTTAGAGCTTTTAACATGAAGGG - Intergenic
1176538425 21:8123314-8123336 TTTAGAGCTTTTAACATGAAGGG + Intergenic
1176822608 21:13672540-13672562 TTTAGGGATGATTACATTGAGGG - Intergenic
1177463529 21:21444030-21444052 TTTAGAGTTTTTAACATGAAGGG + Intronic
1177540710 21:22490984-22491006 TTAAGAGCCTTCTACATTGTTGG + Intergenic
1177724736 21:24952204-24952226 TTCAGAGCTTTACACATTAAAGG - Intergenic
1180486400 22:15803896-15803918 TTTGGAGTTTTTTACATAAAGGG - Intergenic
1180672944 22:17567427-17567449 TTTAGTGCTTTTTTCATAAAAGG - Intronic
1180964572 22:19780096-19780118 TTTTCAGTTTTTAACATTGAGGG + Intronic
1184855744 22:47145643-47145665 TTTAGAGTTTTTTATGTTTATGG + Intronic
1203243374 22_KI270733v1_random:39670-39692 TTTAGAGGTTTTAACATGAAGGG + Intergenic
951282922 3:20774763-20774785 TTTAGCACTATTTACATTTAAGG - Intergenic
951972028 3:28456661-28456683 TTGAGAGTTTTTTACATGAAAGG + Intronic
953490051 3:43341831-43341853 TTTAGAGTGTTTTACATTACTGG + Intronic
954286719 3:49624678-49624700 CTTAGAGCTTCTTACAATGCAGG + Intronic
955573262 3:60330590-60330612 TTTAGAGCTTTTGATATATATGG - Intronic
956818140 3:72927524-72927546 TTTAGAACTTTTTATAATTAAGG + Intronic
957205120 3:77187102-77187124 GTTTTAGCTTTTTACAATGAAGG - Intronic
957433777 3:80148525-80148547 TTGAGAGATTTTAACATGGAGGG + Intergenic
957938301 3:86971773-86971795 TTTTAAGCTTTAAACATTGATGG - Intronic
958529503 3:95308929-95308951 TTTCGGGCTTTTTGCCTTGAAGG - Intergenic
959189567 3:103093578-103093600 TTTAGAGTTTTTAACATGAAGGG + Intergenic
959463273 3:106652598-106652620 TTTAGAGTTTTTAACATGAAGGG - Intergenic
960056314 3:113278927-113278949 TTTGGAGCTTTTTAAATAAAAGG + Intronic
960352144 3:116606956-116606978 TTTCAGGCTTTTTAGATTGAGGG - Intronic
960681575 3:120253256-120253278 TTGAGAGCTTTTAACATGAAGGG - Intronic
960782478 3:121334762-121334784 TTGAGAGCTTTTAACATGAAAGG - Intronic
960827124 3:121800435-121800457 CTCAGAGATTTTTACATTTAAGG - Intronic
960874146 3:122280161-122280183 TTTAGAGTTTTTAACATGAAGGG - Intronic
961904557 3:130249199-130249221 TTAAAACCTTTTTACATTGAGGG + Intergenic
961946376 3:130693419-130693441 TTGAAAGCTTTATACATTGCTGG - Intronic
962079563 3:132123013-132123035 TTGAGAGCTTTTAACATGAAGGG - Intronic
962335284 3:134524571-134524593 TTGAGAGTTTTTAACATGGAAGG + Intronic
963419911 3:145048590-145048612 TTTCAAGCTTTCTACATTCAAGG + Intergenic
965055694 3:163711846-163711868 TTTTTAGCTTTTTATATTCACGG - Intergenic
966275811 3:178166904-178166926 TTTAGGGCTTTTTATCCTGAAGG - Intergenic
967252383 3:187554130-187554152 TTTAGACCACTTTGCATTGAAGG + Intergenic
970450297 4:16159889-16159911 TTTAGAGATCTTTACATAAAAGG - Intergenic
971708215 4:30076221-30076243 TTGAGAGCTTTTAACATGAAAGG + Intergenic
972946451 4:44262593-44262615 TTTAGAGGTTTTCTCATTAAAGG - Intronic
973030889 4:45337315-45337337 TTGTGACCTTTTTACATTGTGGG - Intergenic
973055309 4:45650216-45650238 TTTAGAGATTTTTGAATTAATGG + Intergenic
973570590 4:52235001-52235023 TTTAGTGCTTTTAAAATTAAAGG + Intergenic
974268239 4:59614840-59614862 TACAGACCTTTTTAGATTGATGG - Intergenic
974490342 4:62556919-62556941 ATTAGAGCTTTTTCTATGGAGGG - Intergenic
974843759 4:67326286-67326308 TTCAGAGCTTTTCAAATTGATGG - Intergenic
974874069 4:67681170-67681192 TTAAGAGCTTGTTACATTTTAGG + Intronic
975245240 4:72112943-72112965 TTTAGAGCTATGTAAGTTGAAGG - Intronic
976144501 4:82028753-82028775 TTTAGAGCATTTTACATACGAGG + Intronic
976684054 4:87790883-87790905 TCTAGATATTTTTAGATTGAGGG + Intergenic
976859362 4:89644593-89644615 TTAAGAGATTTTTAAATTGCAGG - Intergenic
977737506 4:100434826-100434848 TTTAGAGTTTTTAACATAAAGGG - Intronic
978118837 4:105053736-105053758 TTGAGAGCTTTTAACATGAAGGG - Intergenic
978303255 4:107294106-107294128 TTTAGAGCTTTTTCTAATGTCGG + Intergenic
978810068 4:112839798-112839820 TATAGAGATTTTTTGATTGAAGG + Intronic
978960365 4:114670615-114670637 TTAAGAGTTTTTTACATGAAGGG - Intronic
980018034 4:127676116-127676138 TTCAAATCTTTTTACATGGAGGG + Intronic
980507837 4:133745946-133745968 TTGAGAGTTTTTAACATTAAGGG - Intergenic
981330473 4:143502675-143502697 TTCAGAACTTGTTATATTGAGGG - Intergenic
982993671 4:162313388-162313410 TTTCTAGCTTTTTACATGTAAGG + Intergenic
983669509 4:170219337-170219359 TTTAAAACTTTTTATATTGCGGG - Intergenic
984076035 4:175181094-175181116 TTGAGAGTTTTTAACATTAAGGG + Intergenic
984581403 4:181514509-181514531 TTAAGAGATTTTTCCATTTATGG + Intergenic
984620494 4:181946648-181946670 TTTAGTGGCTTTTACATTGCTGG + Intergenic
987544462 5:19294878-19294900 TTGAGAGTTTTTTACATCGAAGG + Intergenic
987585522 5:19850907-19850929 TTTATAGCTTTTAACAATTAGGG + Intronic
987995281 5:25269078-25269100 TGTTGAGGATTTTACATTGATGG + Intergenic
988000127 5:25337223-25337245 TTTAGAGCTTTTTGCATGCTGGG - Intergenic
988059847 5:26152460-26152482 TTGAGAGCTTTTAACATGAAGGG - Intergenic
988439397 5:31214818-31214840 TGTGAAGCTTTTTACATCGAAGG - Intronic
988675209 5:33426340-33426362 ATTAAACCTGTTTACATTGAAGG + Intergenic
989192407 5:38684194-38684216 TTAAGTGCTTTTTACAATGTAGG - Intergenic
989526363 5:42457830-42457852 TTTTGAACTTTTTACTTTGCAGG - Intronic
989687097 5:44102918-44102940 TTTAGAGCTAATGACATAGAGGG + Intergenic
990266089 5:54077460-54077482 TTTTGAGTTCTTTACATTTATGG - Intronic
990906903 5:60813537-60813559 AATAGAGATTTTTACATTGGAGG - Intronic
991008436 5:61855456-61855478 TTTAGAGATTTTTTAATTGAGGG - Intergenic
992256403 5:74925201-74925223 TTTTGAGGTATTTACGTTGATGG + Intergenic
992848404 5:80778598-80778620 TTTACAGCTGTTTACTTTCAAGG + Intronic
993494208 5:88588762-88588784 TTTAGCCCATTTTACATTTAAGG - Intergenic
993589925 5:89781724-89781746 TTGAGAGCTTTTAACATGAAGGG - Intergenic
993621789 5:90177286-90177308 TTGAGAGTTTTTTACATGAAGGG - Intergenic
994027054 5:95096619-95096641 ATTAGAGCTTCTTCCATTTATGG - Intronic
994201822 5:96985232-96985254 TTCAAAGATTTTTACATTCAAGG - Intronic
994889719 5:105617630-105617652 TGTAGAGCATTTTACATTTATGG - Intergenic
995153337 5:108878589-108878611 TTTCCAGTTTTTTCCATTGATGG + Intronic
995428930 5:112053362-112053384 TTGAGAGTTTTTAACATGGAGGG - Intergenic
996072222 5:119144891-119144913 ATGAGAGCTTTTTGCATGGATGG + Intronic
997187463 5:131896867-131896889 TTTAGCCCATTTTACATTTAAGG + Intronic
998772453 5:145561748-145561770 TTTAAATCTTATTATATTGATGG - Intronic
998774442 5:145583242-145583264 TTGAGAGCTTTTAACATGAAGGG - Intronic
998787917 5:145732418-145732440 AATAGAACTTTCTACATTGATGG + Intronic
999389082 5:151177127-151177149 TTTTGCATTTTTTACATTGAAGG + Intergenic
999597099 5:153216709-153216731 TTTAGCCCATTTTACATTTAAGG - Intergenic
999713598 5:154340811-154340833 TTTAGAGCTGTTTACATCAGAGG + Intronic
999987871 5:157022062-157022084 ATTAGAGATATTTACATTGATGG - Intergenic
1002595690 5:180320861-180320883 TTTAGAGCCTTAGACCTTGATGG - Intronic
1003567780 6:7235214-7235236 GTTAGAGCATTTTCCATTCACGG + Intronic
1004135075 6:12958121-12958143 TTTAGAGAATTTTCCTTTGATGG + Intronic
1004983716 6:21056713-21056735 TTGAGAGCTTTTAACATGAAGGG + Intronic
1005165991 6:22921286-22921308 TTTAGAGCATTTTAATTTTAAGG - Intergenic
1007972844 6:46070023-46070045 TTGAGAGCTTTTAACATGAAGGG - Intronic
1008866865 6:56222430-56222452 ATTAGAGCTTTTTAGATGAATGG - Intronic
1010708069 6:79137976-79137998 TTTAGAGTTTTTAACATGAAGGG - Intergenic
1010771001 6:79830921-79830943 TTCAGAGCTCTTTACTTTCATGG - Intergenic
1010820989 6:80415461-80415483 TTCAGAGCTTTTAACATGAAGGG + Intergenic
1010857151 6:80853855-80853877 CTGAGATCTTTTTACTTTGATGG - Intergenic
1011321464 6:86098181-86098203 TTGAGAGCTTTTAACATGAAGGG - Intergenic
1012334242 6:98034653-98034675 TTTAACTCTTTTCACATTGAGGG + Intergenic
1012361375 6:98385070-98385092 TTTAAAGCTCTTTACATATAAGG - Intergenic
1012420121 6:99055848-99055870 TTGAGAGCTTACTACACTGAAGG + Intergenic
1012599967 6:101083565-101083587 TTTAGAGCTTGTTACACTGAAGG + Intergenic
1012740823 6:103014705-103014727 TTGAGAGTTTTTAACATTAAGGG + Intergenic
1013322446 6:109008425-109008447 TTTTGAGATTTTAACATTTATGG - Intronic
1013392702 6:109702825-109702847 TTGAGAGATTTTTACATCTAGGG - Intronic
1014385588 6:120797887-120797909 TTGAGAGCTTTTAACATGAAGGG + Intergenic
1015107012 6:129548760-129548782 TGTATAGCTTTTGACATTGAAGG + Intergenic
1015281752 6:131442017-131442039 TCTAGAGTTTTTTACCTTGAAGG - Intergenic
1015376906 6:132520841-132520863 TTTGGAACTTTCTACATAGACGG + Intergenic
1016117612 6:140307106-140307128 TTTTGAGCTCTTTAAAGTGAGGG - Intergenic
1016264662 6:142218008-142218030 TTAAGAAATTTTTACATGGATGG + Intronic
1016279150 6:142394266-142394288 TTTAAAGCTATTTTCTTTGAAGG - Intronic
1016665965 6:146640712-146640734 TTAAGAGGTTTTTACATGAAGGG - Intronic
1020751953 7:12152547-12152569 TTTAGAGGATTTTTCATTGTGGG - Intergenic
1021260209 7:18446799-18446821 TTTATAGCTTTTAACACAGAAGG - Intronic
1022222724 7:28329909-28329931 TTAAGTACTTTTTACACTGATGG + Intronic
1022584075 7:31588276-31588298 TTAAAAGCTTTTTATTTTGAGGG + Intronic
1023363202 7:39436813-39436835 TTGAGAGCTTTTAACATGAAGGG + Intronic
1024468389 7:49739322-49739344 TTTAGTCATTTTTCCATTGATGG - Intergenic
1024773259 7:52750587-52750609 TTTAGAGCTATTTTCAATCAGGG - Intergenic
1025159997 7:56649397-56649419 TTTAGAGTTTGTTTCATTTAGGG + Intergenic
1025717840 7:63979811-63979833 TTTAGAGTTTCTTATATTTAGGG + Intergenic
1025726752 7:64070177-64070199 TTTAGAGTTTGTTTCATTTAGGG - Intronic
1025755702 7:64337547-64337569 TTTAGAGTTTGTTTCATTTAGGG - Intronic
1026086634 7:67268286-67268308 TTCAGAGCTTTTAGCAGTGAAGG + Intergenic
1026690505 7:72546572-72546594 TTCAGAGCTTTTAACAGTGAAGG - Intergenic
1027479309 7:78674905-78674927 TTAAGAGCTTTTTATATTTCAGG - Intronic
1027629781 7:80588745-80588767 CTTAGGGCCTGTTACATTGAAGG - Intronic
1027740802 7:82001804-82001826 TTTAGACCTTTTTGCAATCAAGG - Intronic
1028140361 7:87266918-87266940 TTAAAAGCTTTTTACATTCTAGG - Intergenic
1028357907 7:89931591-89931613 TTTTGAGCTCTCTGCATTGAAGG + Intergenic
1028419281 7:90613841-90613863 TTTAGAAATTTTTATATTGCTGG + Intronic
1030105497 7:105983630-105983652 TTCAGAGTTTTTCACAGTGATGG - Intronic
1030160302 7:106501238-106501260 TTAAGAGCTCTTTATATTGTTGG - Intergenic
1030798956 7:113825845-113825867 ATTATAGCTTTATACATTAAAGG + Intergenic
1031859335 7:126959601-126959623 TTTAGATTTTTTTCCCTTGAAGG - Intronic
1032825235 7:135562129-135562151 TTGAGAGCTGTTTACAAGGATGG - Intronic
1033022378 7:137739399-137739421 TTTAGAGTTTTTAACATGGAAGG - Intronic
1035091689 7:156318516-156318538 TTTGGAGCTCTTTACATTCTAGG - Intergenic
1036165855 8:6432936-6432958 TTGAAAGCTGCTTACATTGAGGG - Intronic
1038510257 8:28127455-28127477 TTTAGAGCTTTTTGCTTTCTGGG + Intronic
1038707973 8:29913314-29913336 TTGAGAGTTTTTAACATTAAGGG - Intergenic
1039625444 8:39046648-39046670 TTGAGAGCTTTTTGCATGAAAGG + Intronic
1040461160 8:47649774-47649796 TTTAAAACTTTTTACAGGGATGG + Intronic
1041057763 8:54005216-54005238 TCTAGAGCTGTTTACATATATGG + Intronic
1041224718 8:55686959-55686981 TTTAAACCTTTTTGGATTGAAGG - Intergenic
1041380651 8:57251253-57251275 AATAGAACTTTTTGCATTGATGG - Intergenic
1041726332 8:61021145-61021167 TTTAGAGCTGTTTATATTGCAGG - Intergenic
1042472018 8:69201235-69201257 TTTAAAGCCTTATACCTTGAGGG + Intergenic
1042524314 8:69748627-69748649 TATATAGCTTTTTGCTTTGATGG - Intronic
1042773988 8:72409129-72409151 TTGAGAGTTTTTAACATGGAGGG - Intergenic
1043067156 8:75588973-75588995 TTGAGAGTTTTTAACATTAATGG + Intergenic
1043229048 8:77775805-77775827 TTTAGAGTTTTCTACATATAAGG - Intergenic
1043611986 8:82076349-82076371 TTTAAATTTTTTTACATTTAAGG - Intergenic
1044672793 8:94700254-94700276 ATTACAGCTTTTTCCATAGAAGG - Intronic
1045604300 8:103754913-103754935 TTTAGCCCGTTTTACATTTAAGG + Intronic
1047371399 8:124258936-124258958 ATGACAGCTGTTTACATTGATGG - Intergenic
1047587604 8:126291014-126291036 TTTGTAGCTCATTACATTGATGG + Intergenic
1047613268 8:126541552-126541574 TTTTCAGCTTTTTAATTTGAAGG - Intergenic
1047783465 8:128130655-128130677 TTTACAGCTTTCTCAATTGAGGG - Intergenic
1050224947 9:3442995-3443017 TTGAGAGTTCTTTACATTTATGG - Intronic
1050284653 9:4088744-4088766 TTTAGTGCCTTTTACTATGACGG + Intronic
1050298467 9:4231658-4231680 TTTGAAGATTTTTACATTGTTGG - Intronic
1050430812 9:5559868-5559890 GTTAGAGCTTTAGACAATGAAGG - Intronic
1051089606 9:13390909-13390931 TTGAGAGTTTTTAACATTAAGGG - Intergenic
1051168932 9:14298392-14298414 TTTTCAGCTTTTTATATTTATGG - Intronic
1051460505 9:17307908-17307930 TTTTGAGATTTTTACATTTGAGG + Intronic
1051865493 9:21676067-21676089 TTAAGTGCTTTGTACTTTGATGG + Intergenic
1052329762 9:27255426-27255448 TTGAGAGCTTTTTGCATGAAGGG - Intergenic
1052767295 9:32654336-32654358 TTGAGAGTTTTTAACATGGAGGG - Intergenic
1055261669 9:74443753-74443775 ATTAGAGATTTTTCCATTGTAGG + Intergenic
1055841932 9:80515622-80515644 TTGAGAGTTTTTTACATGAAGGG + Intergenic
1057712149 9:97455625-97455647 TTCAGAGTTTTTAACATGGAGGG - Intronic
1058189684 9:101898165-101898187 TTCACATCTTTTTACATTTAGGG - Intergenic
1058234324 9:102470337-102470359 TTTATAGCTGTTTACATTTATGG - Intergenic
1058257209 9:102782115-102782137 TTTAAACCTGTTTACTTTGAAGG + Intergenic
1058385968 9:104436226-104436248 TTTAGATATTTTAAAATTGAGGG - Intergenic
1058499599 9:105598194-105598216 TTTATACTCTTTTACATTGAGGG + Intronic
1059229180 9:112702294-112702316 TTTAATGCTTTTTCCATTGTTGG - Intronic
1060436467 9:123597347-123597369 TTAAGAGATTTTCACAGTGAAGG - Intronic
1203524755 Un_GL000213v1:77025-77047 TTTAGGGATGATTACATTGAGGG + Intergenic
1186707011 X:12151553-12151575 TTCAGAACTTTTTACAATAAAGG - Intronic
1186773985 X:12845936-12845958 TCTAGAGATTTAAACATTGAAGG - Intergenic
1186955791 X:14680321-14680343 TTGAGAGCATACTACATTGAAGG - Intronic
1188014466 X:25092811-25092833 TTGAGAGCTTTTAACATGAAGGG + Intergenic
1188594384 X:31879607-31879629 TTCAGAGCATTTTTCACTGATGG - Intronic
1188705709 X:33327018-33327040 TTTAAAGCTTTATACATTTAAGG + Intronic
1189589215 X:42494121-42494143 TATAGTGCTTTCTACATTGCAGG - Intergenic
1189829893 X:44961668-44961690 TATAGATATTTGTACATTGATGG + Intronic
1190523736 X:51307175-51307197 TTGAGAGCTTTTAACATTAAGGG + Intergenic
1191922709 X:66274079-66274101 TTGAGAGCTTTTAACATGAAAGG - Intergenic
1192067298 X:67899609-67899631 TTGAGAGCTTTTAACATGAAGGG + Intergenic
1192688253 X:73330521-73330543 TTTAGCTCATTTTACATTTATGG + Intergenic
1192717301 X:73657807-73657829 TTGAGAGCTTTTAACATGAAGGG + Intronic
1193100582 X:77606937-77606959 TTTAGGGCTTTTTATTATGAAGG - Intronic
1193178010 X:78417923-78417945 TTTAGGGATTTTTACATTTAAGG - Intergenic
1193309575 X:79989807-79989829 TTGAGAGTTTTTAACATTAAGGG - Intergenic
1193398734 X:81016766-81016788 TTAAGAGTTTTTAACATTAAGGG + Intergenic
1193557692 X:82976102-82976124 TTTAGACCCTTTTACATTCAAGG - Intergenic
1193605559 X:83563918-83563940 TTTAGAGTTTTTAACATAAAGGG + Intergenic
1193747141 X:85296220-85296242 TTTTGACTTTTTTACATTCAAGG + Intronic
1193807161 X:86008954-86008976 TTTAAAGATTTTTCCATTCATGG - Intronic
1193844511 X:86452017-86452039 TTTAGAGTTTTTAACATAAAGGG + Intronic
1193983405 X:88211703-88211725 TTGAGAGTTTTTTAGCTTGAAGG - Intergenic
1194221867 X:91204144-91204166 TTGAAAGTTTTTTCCATTGATGG + Intergenic
1194586907 X:95746534-95746556 TTGAGAGCTTTTAACATGAAGGG - Intergenic
1194830300 X:98615460-98615482 TTTAGAGTTTTTAACATGAAGGG + Intergenic
1194920251 X:99757129-99757151 TTGAGAGTTTTTAACATGGAGGG + Intergenic
1195568613 X:106374347-106374369 TTTAGAGTTTTTAACATGAAGGG - Intergenic
1195930114 X:110065923-110065945 TTTAGAGCTTTTTGGATTTTGGG + Intronic
1196218672 X:113086260-113086282 TTTAGAGTTTTTAACATGGAGGG + Intergenic
1196344491 X:114637349-114637371 TTGAGTGCTTTATAGATTGAGGG - Intronic
1197225186 X:123950037-123950059 TTTAGAACTTTTTGCAAGGATGG - Intergenic
1197413505 X:126147126-126147148 TTGAGAGTTTTTAACATTAAGGG + Intergenic
1197455999 X:126676049-126676071 TTGAGAGCTTTTAACATGAAGGG - Intergenic
1197641227 X:128970365-128970387 TTTAAAGCCTTTTTCTTTGAAGG - Intergenic
1197658311 X:129142247-129142269 TTTAGAGCTTTGTATACTGGAGG + Intergenic
1197685406 X:129434549-129434571 TTTATTGCTTCATACATTGAAGG + Intergenic
1199284441 X:146040284-146040306 TTGAGAGCTTTTAACATGAAGGG - Intergenic
1199318616 X:146411521-146411543 TTCAGAGTTTTTAACATTAAGGG - Intergenic
1199386039 X:147224477-147224499 TATAGAACTTTTTTCATTGGAGG - Intergenic
1199437654 X:147830748-147830770 TTGAGAGCTTTTAACATGAAAGG - Intergenic