ID: 912325406

View in Genome Browser
Species Human (GRCh38)
Location 1:108754386-108754408
Sequence GTTTAGAGCTTTTTACATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912325406_912325407 18 Left 912325406 1:108754386-108754408 CCTCAATGTAAAAAGCTCTAAAC 0: 1
1: 0
2: 0
3: 15
4: 248
Right 912325407 1:108754427-108754449 AGCCTTGATTTTTCTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912325406 Original CRISPR GTTTAGAGCTTTTTACATTG AGG (reversed) Intronic
907421417 1:54349971-54349993 GTTTAGAGCGGTTTAATTTGGGG - Intronic
909130915 1:71736064-71736086 ATTTTGAGCTTTCTACACTGAGG - Intronic
909149399 1:71981945-71981967 GTTTAGCACTGTATACATTGTGG + Intronic
909520301 1:76560340-76560362 GTGCAGAGCTTTTTAACTTGAGG - Intronic
910001109 1:82343300-82343322 TTTTACAGCTTTTTCCCTTGGGG + Intergenic
911248801 1:95551077-95551099 GTATAGAGCTTTGAACATGGGGG + Intergenic
911361179 1:96878512-96878534 GTTTACACTTTTTTACATTATGG + Intergenic
911501780 1:98695037-98695059 ATTTAGAGCTTAATACATTCTGG - Intronic
911717482 1:101150556-101150578 GCTTAGAGTGTTTTACACTGGGG + Intergenic
912171493 1:107105936-107105958 TTTTATAACTTTTAACATTGAGG - Intergenic
912325406 1:108754386-108754408 GTTTAGAGCTTTTTACATTGAGG - Intronic
912421638 1:109546245-109546267 GTCTAGTGCCTATTACATTGTGG + Exonic
912884852 1:113460223-113460245 ATTGAGAGTTTTTTACATTAAGG - Intronic
913393965 1:118345877-118345899 GTTTAGAGCTTCTTCCATGGTGG - Intergenic
914315809 1:146510635-146510657 TTTTATAGCTTTTTAAGTTGGGG + Intergenic
914498546 1:148222726-148222748 TTTTATAGCTTTTTAAGTTGGGG - Intergenic
915594944 1:156891670-156891692 TTTTAGACTTTTTTAAATTGGGG - Intergenic
916341107 1:163736082-163736104 TTTTGGAGCTTTTTAGATTTGGG - Intergenic
916760972 1:167817377-167817399 GTTTTAAGCTGTTTACTTTGTGG + Intronic
917621770 1:176803406-176803428 GTTTACAACTAATTACATTGGGG - Intronic
919169466 1:193935688-193935710 ATTTACAGCTTTTAACATTTGGG + Intergenic
919491225 1:198207830-198207852 TTTTAGAACTTTTTAAATTAAGG - Intronic
921142092 1:212318349-212318371 ATGCAGAGCTTTTTATATTGTGG + Intronic
922971444 1:229744179-229744201 GTTGAGGGCTTTTTACATGAAGG + Intergenic
923432097 1:233932629-233932651 TTTAAGAGATTTTTAAATTGTGG - Intronic
923616328 1:235541127-235541149 ATATAGAGCTTTTTTCATGGGGG + Intergenic
923974541 1:239247029-239247051 CTTTAGACATTTTTAAATTGAGG - Intergenic
924300409 1:242632179-242632201 TTTTAGAGATTTCTACTTTGAGG + Intergenic
1063284508 10:4670846-4670868 GTTTTGAGCTATTTAGAGTGTGG - Intergenic
1063531351 10:6834296-6834318 GTTTAGTTCTTTTTCCATTTTGG + Intergenic
1065363677 10:24913889-24913911 GTTTGGAGATTTTTAAATTCAGG + Intronic
1069497431 10:68918251-68918273 ATTTACAGTTTTTTAAATTGAGG + Intronic
1072294629 10:93997160-93997182 TTTTAGAGCTTTTTTGATTTTGG - Intronic
1072847168 10:98844343-98844365 ATTTAGAGGTTCTTACATTTTGG + Intronic
1072955329 10:99883157-99883179 TTTTAGAGCTTTTTGGATTTTGG + Intronic
1073900851 10:108218932-108218954 GTTCAGTGTTTTTTACATTTCGG - Intergenic
1076289722 10:129335809-129335831 TTTTAGAGCTGTGTACACTGAGG + Intergenic
1076292352 10:129356247-129356269 AGTTAGAGCTTGTTACATTTTGG - Intergenic
1076941945 10:133615866-133615888 GTTTCTAGCTATCTACATTGGGG + Intergenic
1077232719 11:1465262-1465284 GTTTTAAGCTTCTTACTTTGCGG - Intergenic
1080064286 11:27992147-27992169 GTTTAGATCTATATACATTGGGG - Intergenic
1080106948 11:28520745-28520767 GTTTAGAGCTGTATTCATTTAGG + Intergenic
1082707626 11:56512006-56512028 CTATAGAGCTTCTTACTTTGGGG + Intergenic
1085078932 11:73617746-73617768 ATTTAGTGCTATTTACATTGTGG + Intergenic
1085813100 11:79704240-79704262 GTTGAGAGCTTTTAACATAAAGG - Intergenic
1087601577 11:100323107-100323129 GTTCGCAGCTTTTTACACTGAGG - Intronic
1088373315 11:109114767-109114789 GTTTTGTCCTTTGTACATTGGGG + Intergenic
1090628896 11:128629106-128629128 GTTTAGAACTCTTTTCTTTGCGG - Intergenic
1095761004 12:45836034-45836056 GTTTAGGGCTTTTTAACCTGAGG - Intronic
1098417250 12:70248332-70248354 TTTCAGAGCTTTTTAAATTTTGG - Intronic
1100123587 12:91396608-91396630 GTTTTGTGCTTCTTACTTTGTGG + Intergenic
1100244434 12:92743042-92743064 GATTAGAACATTTTACATTTAGG - Intronic
1100998541 12:100330685-100330707 GTTGAGAGCGTTTGGCATTGGGG + Intronic
1102402596 12:112643026-112643048 CTTTAGAGCTATTGACATTTTGG - Intronic
1103163898 12:118753739-118753761 ATTTAGAGCTCTTTGCATAGTGG + Intergenic
1104829798 12:131742355-131742377 ATTGAAAGCTTTTTACTTTGAGG + Intronic
1107115893 13:36744978-36745000 TTTTAAAGCTTTTTACCTTTTGG + Intergenic
1107659964 13:42628596-42628618 GTATACATCTTTTTACATAGAGG - Intergenic
1108294334 13:48998310-48998332 TTTTTGAGCTTTTTATATTTCGG - Intronic
1109880590 13:68469447-68469469 CTTTAAAGGTTTTTACACTGGGG + Intergenic
1110431243 13:75426715-75426737 GTTTAAAGCTTTTTGTTTTGGGG - Intronic
1110744061 13:79032050-79032072 GTTTACAGATTTTTAATTTGGGG + Intergenic
1110924747 13:81137535-81137557 TTTTAAAGCTTTTTTGATTGTGG + Intergenic
1111080224 13:83295946-83295968 GTTGAGAGCTTTTATCATTAGGG + Intergenic
1112752694 13:102597656-102597678 TTTTACAGCTTTTATCATTGGGG + Intronic
1113397270 13:109960178-109960200 GTTGAGAGTTTTTTACATGAAGG + Intergenic
1114067927 14:19081330-19081352 GTTTGGAGTTTTTTACATAAAGG - Intergenic
1114901584 14:27067137-27067159 GTTTACAGCTCTTGACAATGTGG + Intergenic
1120088763 14:80306647-80306669 GCTTAAAGCTTTGGACATTGAGG - Intronic
1120378740 14:83745816-83745838 TTTTAGAGCAGTTTAGATTGAGG + Intergenic
1120451791 14:84677678-84677700 ATTTAGAGTTTTTTTCATGGTGG + Intergenic
1120587951 14:86339077-86339099 GTTGAGAGCTTTTAACATAATGG + Intergenic
1120934242 14:89877534-89877556 ATTTAGAAATTTTTAAATTGTGG - Intronic
1122828062 14:104381681-104381703 GTTTACAGATTTTTAAAGTGTGG + Intergenic
1123883837 15:24702993-24703015 GTTTTGGGCTGTTGACATTGTGG + Intergenic
1124873768 15:33570974-33570996 CTTTAGAACTTTTTACATACAGG + Intronic
1125178043 15:36847911-36847933 GTTTAGAGCTTTTTAATTCTTGG - Intergenic
1125596527 15:40890719-40890741 GTATAGAGCATTTTGTATTGAGG + Intergenic
1134100941 16:11450910-11450932 GTTTTGAGATTTGTCCATTGCGG - Intronic
1135511345 16:23086704-23086726 GTGAAGAACTTCTTACATTGTGG + Intronic
1135647863 16:24179084-24179106 GATAAGTGCATTTTACATTGGGG - Intronic
1136677871 16:31929937-31929959 GTTTAGAGTTTTTAACATTAAGG - Intergenic
1136746244 16:32594597-32594619 ATTTACAGCTTTCTGCATTGGGG + Intergenic
1138671358 16:58617694-58617716 ATTTTGAGGTGTTTACATTGAGG - Intronic
1139287540 16:65829104-65829126 TTTTATCGCTTTTTACATGGAGG - Intergenic
1203048373 16_KI270728v1_random:853801-853823 ATTTACAGCTTTCTGCATTGGGG + Intergenic
1143297235 17:5880483-5880505 GTTTAGAGCTGTTTAGAGCGGGG - Intronic
1149187339 17:54015030-54015052 TCTTAGAGCTATTTACTTTGAGG + Intergenic
1149253997 17:54803928-54803950 ATTTAGTGGTTTTTACATTTGGG - Intergenic
1150364120 17:64566111-64566133 TTTTAAAGATTTTTAAATTGGGG - Intronic
1157098497 18:44708960-44708982 TTTTAGATCTTTTGACATTTCGG - Intronic
1161761684 19:6177931-6177953 TTTTGGAGCTTTTTAGATTTGGG - Intronic
1162846020 19:13393216-13393238 GTTTGGTGCTTTCTACTTTGGGG - Intronic
1162860343 19:13501870-13501892 TTTTGGAGCTTTTTGGATTGGGG + Intronic
1166444834 19:42849630-42849652 GTTTTGAGCATTTCAGATTGTGG + Intronic
1166447807 19:42873370-42873392 GTTTTGAGCATTTCAGATTGTGG + Intronic
1166452266 19:42912184-42912206 GTTTTGAGCATTTCAGATTGTGG + Intronic
1166454728 19:42931047-42931069 GTTTTGAGCATTTCAGATTGTGG + Intronic
1166470682 19:43076953-43076975 GTTTTGAGCATTTCAGATTGTGG + Intronic
1166484267 19:43199600-43199622 GTTTTGAGCATTTCAGATTGTGG + Intronic
925355300 2:3236786-3236808 ATTTATAGCTTTTTAATTTGGGG - Intronic
926529480 2:14025262-14025284 TTGTAGAGCTTTTTACATCAAGG - Intergenic
928860858 2:35855661-35855683 GTTTAAAGCTTTTTAAGTTCAGG - Intergenic
929652648 2:43696608-43696630 GATTAAAGCTCTTTATATTGTGG + Intronic
931028782 2:58146223-58146245 GTTTAGAGCTTTTAAGAATCTGG + Intronic
931792649 2:65678747-65678769 GTTTAGAGGATTTTAGTTTGAGG + Intergenic
933604356 2:84366287-84366309 ATTTAGAGCTTTTAACATAAAGG - Intergenic
934088275 2:88528624-88528646 GTTTAGATCTTTTTTTAGTGGGG - Intronic
937747071 2:125426922-125426944 GTTTGGAGCTCACTACATTGGGG - Intergenic
940913420 2:159228920-159228942 GTCTAGAGCTTTTTTTCTTGTGG + Intronic
941036964 2:160579370-160579392 GCTTATTGTTTTTTACATTGGGG + Intergenic
941078292 2:161031272-161031294 GTTTAAAGCTCTTTGCATGGTGG - Intergenic
941690658 2:168498078-168498100 GATAACAGCGTTTTACATTGTGG - Intronic
941798483 2:169627827-169627849 GATTAAAGCTTTTTTAATTGTGG + Intronic
942675745 2:178424919-178424941 TATTATAGGTTTTTACATTGTGG + Intergenic
943202911 2:184852423-184852445 GTGCAGAGCTTTATACTTTGAGG + Intronic
943945563 2:194058060-194058082 TTTTACAGCTTTTTACCTTATGG + Intergenic
944098300 2:195994522-195994544 GTTTAGAGATATTCCCATTGTGG + Intronic
946525872 2:220519655-220519677 GGTTAGAGCTGTTTAGATTTTGG - Intergenic
947275333 2:228385383-228385405 GTTTAGGGCTTTTTGTATAGTGG + Intergenic
948035660 2:234856442-234856464 GTTTAAACCTTTTTGCATTGTGG - Intergenic
948881991 2:240863655-240863677 TTTTAGAGGATTTTCCATTGTGG - Intergenic
1169098091 20:2921529-2921551 GTTTAGAATTTTTAACATTTTGG + Intronic
1170266752 20:14475121-14475143 TTTTATAGGTTTTTACTTTGTGG + Intronic
1171860204 20:30393757-30393779 GTTAATAGCTTTTTATAATGTGG + Intronic
1173079875 20:39855618-39855640 GTACAGAGCTTTTTAGATTAAGG - Intergenic
1174358408 20:50013205-50013227 TATTATAGCTTTTTACAGTGAGG - Intergenic
1174716089 20:52760574-52760596 GTTTTGAGATTTTAACATTTAGG + Intergenic
1176344103 21:5725244-5725266 ATTTAGAGCTTTTAACATGAAGG + Intergenic
1176500724 21:7599212-7599234 ATTTAGAGCTTTTAACATGAAGG - Intergenic
1176538424 21:8123313-8123335 ATTTAGAGCTTTTAACATGAAGG + Intergenic
1177903140 21:26941904-26941926 GTTTAGCTCAGTTTACATTGTGG - Intronic
1178847919 21:36188927-36188949 TTTTAAAGCATTTTAAATTGTGG + Intronic
1178979601 21:37251758-37251780 GCTTAGAACTTTGTACATTGAGG - Intronic
1180411957 22:12621040-12621062 GTTAATAGCTTTTTATAATGTGG + Intergenic
1180486401 22:15803897-15803919 GTTTGGAGTTTTTTACATAAAGG - Intergenic
1180575945 22:16774539-16774561 GTTTAGTGCTTTGTCCATTTGGG + Intergenic
1180964571 22:19780095-19780117 GTTTTCAGTTTTTAACATTGAGG + Intronic
1182019553 22:27069873-27069895 GTACAGAGCTTGTTACATGGTGG + Intergenic
950956850 3:17063060-17063082 ATTTAGAAATTTTTAAATTGTGG - Intronic
951554005 3:23902638-23902660 GTTTAGACCTTTTGATATTTTGG + Intronic
953711817 3:45278342-45278364 CTTTACAGGTTTTTGCATTGTGG - Intergenic
955182437 3:56684181-56684203 GTTAAGAGCCCTTTACATAGTGG + Intergenic
955726497 3:61938868-61938890 GTTTCGAGATTTTTGCTTTGGGG + Intronic
956283190 3:67580879-67580901 GTTTAGAGCTGTTTATAATAGGG + Intronic
956807154 3:72826893-72826915 CTTAAAAGCTTTTTACATAGGGG + Intronic
957679478 3:83414355-83414377 TTTTAGAGTATTTTAAATTGAGG - Intergenic
957821317 3:85378089-85378111 TTTTAAAGTATTTTACATTGTGG - Intronic
959193450 3:103145346-103145368 TTTTGGAGCTTTTTGCATTAAGG + Intergenic
960352145 3:116606957-116606979 GTTTCAGGCTTTTTAGATTGAGG - Intronic
960660991 3:120058595-120058617 GTTTACAGCTTTATAAGTTGTGG - Intronic
960865161 3:122192380-122192402 GTTTAGAGCTTTGAAGATTTTGG - Intronic
961904556 3:130249198-130249220 GTTAAAACCTTTTTACATTGAGG + Intergenic
962059412 3:131909894-131909916 GTTTAGAGTTTTTTAAATCATGG + Intronic
963442894 3:145363278-145363300 ATTTAGAACTGTTTACCTTGAGG + Intergenic
966618035 3:181933299-181933321 GTTTAAAGCTTATTAAAATGGGG - Intergenic
966745274 3:183268856-183268878 GTTTAGAACATGTTACATTGAGG + Intronic
971288862 4:25316935-25316957 GTTTAGAGATTTTTAAAGTTTGG - Intronic
973030890 4:45337316-45337338 ATTGTGACCTTTTTACATTGTGG - Intergenic
973950195 4:56005048-56005070 TTTTATAGCTTTTTACACTGTGG + Intronic
975146584 4:70974075-70974097 GTTTAGAGATTTTTCCACTTTGG + Intronic
976200812 4:82576999-82577021 GTTTAGAGTTTATTTTATTGGGG - Intergenic
976684053 4:87790882-87790904 GTCTAGATATTTTTAGATTGAGG + Intergenic
976882322 4:89942818-89942840 GTTTAGAACTTTTATCATTCTGG - Intronic
979825466 4:125227929-125227951 GTTAAGGACTTTTTACTTTGGGG - Intergenic
980018033 4:127676115-127676137 GTTCAAATCTTTTTACATGGAGG + Intronic
980416853 4:132500297-132500319 GTTAAGAGGATATTACATTGCGG + Intergenic
981934749 4:150227729-150227751 GCTCAGAGCTTTGTACACTGTGG - Intronic
982159130 4:152549971-152549993 GTTTAGACATTTGTAAATTGGGG + Intergenic
982879780 4:160699183-160699205 ATTTTGAGCTTTTGATATTGTGG + Intergenic
983597944 4:169491826-169491848 GTTTATACCTTTTTACATTTTGG - Intronic
983669510 4:170219338-170219360 ATTTAAAACTTTTTATATTGCGG - Intergenic
983920264 4:173336290-173336312 GTTTAGATTTTTTTAAATTATGG + Intergenic
984210945 4:176847235-176847257 GTTTAGAACTTTTCAGATTTTGG - Intergenic
984669890 4:182470709-182470731 TTTTAGAGCTTTCTACATAATGG - Intronic
986833418 5:11607751-11607773 GTTTTGAGTTTCTTTCATTGGGG - Intronic
987557184 5:19468189-19468211 GTTCACAGCTTTTTACATGCAGG + Intergenic
988000128 5:25337224-25337246 ATTTAGAGCTTTTTGCATGCTGG - Intergenic
988422328 5:31021851-31021873 GTTCTTAGCTTTTTGCATTGAGG + Intergenic
988432087 5:31130694-31130716 TTTCAGAGCTTTTTAGATTTTGG - Intergenic
991008437 5:61855457-61855479 TTTTAGAGATTTTTTAATTGAGG - Intergenic
994134340 5:96268058-96268080 TATTAGAGGTTTTTACACTGTGG - Intergenic
994610272 5:102028076-102028098 ATTCATAGCTTTTTACATTAAGG - Intergenic
995127738 5:108595732-108595754 GTAGTGAGCTTTTTACATTGTGG - Intergenic
996769600 5:127072356-127072378 ATTTGGAGCTGTATACATTGGGG - Intronic
996986655 5:129574898-129574920 GTTTTTAGGTTTGTACATTGAGG - Intronic
997146936 5:131444964-131444986 ATTGAGAGCTTTCTACATTCTGG - Intronic
997227239 5:132218175-132218197 GTTCAGAGCTTTTTATCCTGTGG - Intronic
997969121 5:138385863-138385885 GATTAGAGCTTTTAACAAAGGGG + Intronic
998918038 5:147037545-147037567 ATTTTGAGAATTTTACATTGGGG + Intronic
999660266 5:153854814-153854836 TGTTACAGATTTTTACATTGTGG + Intergenic
1001348119 5:170927590-170927612 TTTAAGAGCTTTTTACAGTTAGG + Intronic
1001985664 5:176072984-176073006 ATTTATAGCTTTCCACATTGGGG + Intronic
1002231207 5:177765140-177765162 ATTTATAGCTTTCCACATTGGGG - Intronic
1002264130 5:178018608-178018630 ATTTATAGCTTTCCACATTGGGG + Intronic
1004975112 6:20956889-20956911 GTTTAGTGCTTTAGACAGTGTGG + Intronic
1005818810 6:29579874-29579896 GTTTAGAGCCTCTTCTATTGTGG + Intronic
1011544915 6:88472749-88472771 GTTTAGAGTTTCTTGAATTGGGG + Intergenic
1012334241 6:98034652-98034674 GTTTAACTCTTTTCACATTGAGG + Intergenic
1013392703 6:109702826-109702848 GTTGAGAGATTTTTACATCTAGG - Intronic
1014673989 6:124342453-124342475 GTTTAGAATTTTTAACAATGAGG - Intronic
1014876678 6:126669862-126669884 TTTTAGAGTTTTTTAAATGGGGG - Intergenic
1015676656 6:135757995-135758017 ATATAGATCTTTTTGCATTGTGG + Intergenic
1016117613 6:140307107-140307129 GTTTTGAGCTCTTTAAAGTGAGG - Intergenic
1017538905 6:155379636-155379658 TTTTACATATTTTTACATTGTGG - Intergenic
1018559810 6:165090076-165090098 GAATACATCTTTTTACATTGTGG + Intergenic
1019090045 6:169521777-169521799 TTTTATAGGTTTTTGCATTGTGG - Intronic
1020751954 7:12152548-12152570 CTTTAGAGGATTTTTCATTGTGG - Intergenic
1021119395 7:16781499-16781521 GTTTTGATCTTTTTGCATTTTGG + Intronic
1023288778 7:38647079-38647101 GTTTCTTGCTTTTTACATTGAGG + Intergenic
1023691775 7:42796706-42796728 GTTAAGAGCTTTTCATAATGAGG + Intergenic
1024773260 7:52750588-52750610 GTTTAGAGCTATTTTCAATCAGG - Intergenic
1025226517 7:57169670-57169692 ATATAGAGCTTTTTCCATGGGGG - Intergenic
1025730775 7:64105013-64105035 ATATAGAGCTTTTTCCATAGGGG + Intronic
1030430393 7:109439052-109439074 GCTTAAAGCTTTTCACATTTAGG + Intergenic
1031511776 7:122659218-122659240 GTTTTCAACTTTTTACATTAGGG - Intronic
1033575795 7:142683359-142683381 ATTTAGAGATTTTCACATTGTGG + Intergenic
1033846683 7:145441914-145441936 TTTTACAGCTTTTCAGATTGAGG + Intergenic
1036052558 8:5216658-5216680 TTTCAGAACTTTTTACATTTTGG - Intergenic
1037245521 8:16830283-16830305 GTTTATATTTTTTTACATTAAGG + Intergenic
1037394520 8:18428018-18428040 CTTTAGTGCTTCTTACTTTGGGG + Intergenic
1037612522 8:20488336-20488358 GTTTAGTGTCTCTTACATTGTGG + Intergenic
1038510256 8:28127454-28127476 ATTTAGAGCTTTTTGCTTTCTGG + Intronic
1039247723 8:35627968-35627990 GTTTAGATTTTTTTTGATTGGGG + Intronic
1041610407 8:59840120-59840142 GTTTAGAGCATTGTTCATAGAGG + Intergenic
1042050932 8:64705938-64705960 ATTTAGAGCATTTAACATTGTGG + Intronic
1044410967 8:91882140-91882162 GTTTAAAGATTTGTACTTTGTGG + Intergenic
1045275486 8:100700714-100700736 GTTTGGAGCTTTTTGGATTAGGG - Intronic
1048770007 8:137885048-137885070 TTTTAGAGCATTTTAGATTTAGG - Intergenic
1050288005 9:4123968-4123990 GCTTAGCGTTTTATACATTGGGG - Intronic
1050798847 9:9583136-9583158 ATTTAGAGATTTTGACATTTTGG - Intronic
1051770433 9:20572425-20572447 TTTGAGAGCTTTATAGATTGTGG - Intronic
1052236843 9:26220861-26220883 GTTTACTCCTTCTTACATTGTGG - Intergenic
1052889409 9:33684165-33684187 ATTTAGAGATTTTCACATTGTGG + Intergenic
1053334946 9:37259209-37259231 GTTTAAAGCTTTTTTCCTTTGGG + Intronic
1054774558 9:69114168-69114190 TTTTAGAGTTTTTTACATCCTGG + Intergenic
1055748823 9:79481428-79481450 GTTTATAGCTTGTTTCCTTGAGG + Intergenic
1057102071 9:92371211-92371233 GTTTATAACTTTTTACCTTCTGG + Intronic
1058226410 9:102370066-102370088 GTTTTGATATGTTTACATTGTGG - Intergenic
1058386621 9:104444102-104444124 GTTCAGAGCTCTTTATATTTGGG + Intergenic
1058474370 9:105316841-105316863 GTTTAAAGCTTCTTACTTTATGG - Intronic
1060064604 9:120493713-120493735 CTTTAGAGTTTTTCACATTATGG - Intronic
1060250266 9:121981060-121981082 GTCTTGAGCTTCTTAGATTGTGG + Intronic
1062569281 9:137177459-137177481 GTTTAGATCTATTTACGTAGAGG + Intronic
1202803565 9_KI270720v1_random:25992-26014 GTTAATAGCTTTTTATAATGTGG - Intergenic
1185969320 X:4644395-4644417 ATTTAGTTCTTTTTACAGTGAGG - Intergenic
1187061189 X:15788995-15789017 GTTGAAAGCTTTTTAAATAGAGG - Intergenic
1187433484 X:19245808-19245830 GTTTAGAGCTTTTTTCCTATTGG - Intergenic
1190523735 X:51307174-51307196 ATTGAGAGCTTTTAACATTAAGG + Intergenic
1190555451 X:51629582-51629604 CTTTACAGCTTTTTTCCTTGTGG + Intergenic
1191147321 X:57181080-57181102 GTTGAGAGCTTTTAACATGAAGG - Intergenic
1192934230 X:75841877-75841899 GTTGAGAATTTTTAACATTGAGG + Intergenic
1193496115 X:82215300-82215322 GTTGAGAGTTTTTAACATGGAGG + Intergenic
1193797972 X:85899655-85899677 GTTTAGAGCATTTTGGATTTCGG - Intronic
1195930113 X:110065922-110065944 TTTTAGAGCTTTTTGGATTTTGG + Intronic
1196218671 X:113086259-113086281 ATTTAGAGTTTTTAACATGGAGG + Intergenic
1198195802 X:134360369-134360391 GTTTAGTTCTTTTATCATTGAGG - Intergenic
1198816087 X:140591959-140591981 GTTTAGAGCTGTTGACCTGGTGG + Intergenic
1199254829 X:145707561-145707583 GTTTAGAGTTTTTCAGATTTTGG + Intergenic
1199284442 X:146040285-146040307 GTTGAGAGCTTTTAACATGAAGG - Intergenic
1199318617 X:146411522-146411544 GTTCAGAGTTTTTAACATTAAGG - Intergenic
1201059142 Y:10028253-10028275 CTTTAGAGTTTTCTACTTTGGGG - Intergenic
1201323451 Y:12728057-12728079 GTTTAGTGGTTTTATCATTGTGG + Intronic
1202197976 Y:22314971-22314993 CTTTAGAGTTTTCTACTTTGGGG + Intronic