ID: 912325407

View in Genome Browser
Species Human (GRCh38)
Location 1:108754427-108754449
Sequence AGCCTTGATTTTTCTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912325405_912325407 19 Left 912325405 1:108754385-108754407 CCCTCAATGTAAAAAGCTCTAAA 0: 1
1: 0
2: 1
3: 34
4: 391
Right 912325407 1:108754427-108754449 AGCCTTGATTTTTCTACTCCTGG No data
912325406_912325407 18 Left 912325406 1:108754386-108754408 CCTCAATGTAAAAAGCTCTAAAC 0: 1
1: 0
2: 0
3: 15
4: 248
Right 912325407 1:108754427-108754449 AGCCTTGATTTTTCTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912325407 Original CRISPR AGCCTTGATTTTTCTACTCC TGG Intronic
No off target data available for this crispr