ID: 912331984

View in Genome Browser
Species Human (GRCh38)
Location 1:108828341-108828363
Sequence GCTGCAGGTGGGCCACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 388}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912331984_912331994 16 Left 912331984 1:108828341-108828363 CCTTCCTGTGGCCCACCTGCAGC 0: 1
1: 0
2: 6
3: 61
4: 388
Right 912331994 1:108828380-108828402 AGAAATCCCAACTCCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912331984 Original CRISPR GCTGCAGGTGGGCCACAGGA AGG (reversed) Intronic
900110699 1:1004305-1004327 CCTGCAGGTGGTCCTCAGCATGG + Intergenic
900373136 1:2341138-2341160 GCAACAGGTGGGACACAGCAGGG - Intronic
900529890 1:3148006-3148028 GTTGCAGGTGAGCAGCAGGATGG - Intronic
900587380 1:3439797-3439819 GAGGCAGGAGGGCCCCAGGAAGG - Intergenic
900873791 1:5326656-5326678 GCTGTATCTGAGCCACAGGAGGG - Intergenic
900947086 1:5837142-5837164 GCTGCCGGTGGGCAGGAGGAGGG - Intergenic
901574857 1:10192605-10192627 GCTGGAGGAGAGACACAGGAAGG - Intergenic
901791596 1:11656094-11656116 GCTGAAGGTGGGGTACAGGCCGG + Exonic
902331050 1:15731412-15731434 GCTGCAAGGAGCCCACAGGAGGG + Intronic
902667422 1:17949308-17949330 CCTGCAGGCTGGCCAAAGGAAGG - Intergenic
904033520 1:27547515-27547537 GCTGCAGCAGGGCCACGGGGTGG + Exonic
904399666 1:30247898-30247920 TCTGCAGGTGGGACCCAGGTAGG - Intergenic
904466895 1:30713653-30713675 GGTGCAGGTTGGCCAGAGCAGGG + Intronic
904590069 1:31608597-31608619 GCTGCTGGCGGCCGACAGGATGG + Intergenic
905516364 1:38564850-38564872 GCTGGAGGTTCGCCAGAGGAAGG - Intergenic
905865723 1:41375581-41375603 GCTACAGAGGGCCCACAGGATGG - Intronic
907296986 1:53461576-53461598 GCTGCAGGGGGACGCCAGGAGGG - Exonic
909913703 1:81292133-81292155 GTTGCAGATGGGCCAAATGAAGG + Intergenic
910733135 1:90420924-90420946 GCAGCAGCTTGGCCACAGGGCGG + Intergenic
910773411 1:90851663-90851685 GCTGCAGGTCCGCCGCCGGACGG - Intergenic
910784458 1:90980000-90980022 GTTGCTGTTGGGCCATAGGAAGG - Intronic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
912456839 1:109803719-109803741 ACTGCAGCTGGGCTATAGGAGGG + Intergenic
912975748 1:114328731-114328753 GATGCAGGTGCCCTACAGGAAGG - Intergenic
915353856 1:155243893-155243915 GCTGCAGATGGGTGCCAGGATGG - Intronic
916965856 1:169942367-169942389 GCAGGAGGTGGGCCAGGGGAGGG - Intronic
917505126 1:175620510-175620532 GCTGGAGGTGGGCGAAGGGATGG - Intronic
918177155 1:182056733-182056755 GCCGCAGGTGGGGCAGGGGAAGG + Exonic
918565529 1:185925938-185925960 GCTGCAGGTGAGTGACAGGTGGG + Intronic
918741071 1:188131031-188131053 GCAGCCTGTGGGCCACAGGTTGG + Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920556745 1:206909709-206909731 GCTGCAGGTGAGCCGCCGGGCGG - Exonic
920690154 1:208140134-208140156 GCAGAAGGTGGGACAGAGGAGGG + Intronic
922160264 1:223074564-223074586 GCAGCAGGTGGGCTGCAGAAAGG - Intergenic
922340741 1:224652969-224652991 GCTGGAGGAAGGCCACCGGAAGG + Intronic
922468315 1:225860012-225860034 GCTGTAGCTGGGGTACAGGAAGG + Intronic
924385784 1:243496969-243496991 GCTGCAGGACAGCCACAGGAGGG + Intronic
924385785 1:243496980-243497002 GCCACAGGAGGGCCACAGCAAGG + Intronic
1063123984 10:3124177-3124199 GCTACTGGTGGGACACAGGGCGG - Intronic
1063161305 10:3420829-3420851 GATGTAGGTGGGGCACAGGTAGG + Intergenic
1063161325 10:3420919-3420941 GATGCAGGTGGGACGCAGGTAGG + Intergenic
1063161344 10:3421007-3421029 GGTGCGGGTGGGACACAGCAGGG + Intergenic
1063379574 10:5575924-5575946 GCTGAGGGTGGGCCTCAGGAGGG + Intergenic
1066193383 10:33076468-33076490 TCTCCAGGTGGGTCACAGGTGGG + Intergenic
1067045559 10:42983312-42983334 GCTGCAGCTGGGCCAGAGGGAGG - Intergenic
1067081575 10:43215477-43215499 GATCCTGGTGGGCCTCAGGAGGG + Intronic
1067232878 10:44424466-44424488 GGTGGAGGGAGGCCACAGGAGGG + Intergenic
1067937601 10:50624592-50624614 GCGGAAGGTGGGCCCCAGGCGGG - Intronic
1069855068 10:71435700-71435722 CCTGAAGGTGGGCCTGAGGATGG + Intronic
1070739605 10:78894158-78894180 GCTGCAGAGGGACAACAGGAAGG - Intergenic
1070935227 10:80288891-80288913 GCTGGTGGTGGGCCACAGCACGG + Intronic
1071489716 10:86128086-86128108 GCTGCTGGTGGCACAGAGGAAGG - Intronic
1071503704 10:86220690-86220712 GCAGCATGTGGGACACAGGCTGG - Intronic
1072296021 10:94010125-94010147 GATGCAAGTGTGACACAGGATGG - Intronic
1072611389 10:97019591-97019613 TCTGCAGGTTGGCCACACCAGGG + Intronic
1074007168 10:109438913-109438935 GCTTAAGGTGGGCCACAGGCTGG - Intergenic
1074171914 10:110948837-110948859 GCTGCATGTGGCCCACAGGTTGG - Intronic
1074360737 10:112822466-112822488 GCCTCAGGAGGGCCAGAGGAGGG - Intergenic
1075374587 10:121968271-121968293 GCTGCCAGTGGGCTACAGCAGGG - Intronic
1076064558 10:127439272-127439294 GCTACAGGTGGGGCAAAGGTAGG - Intronic
1076467922 10:130697745-130697767 GCAGAAGGTGGGCCAGATGATGG + Intergenic
1076693014 10:132233327-132233349 GCTTCAGGGGGGTCTCAGGAGGG - Intronic
1076778183 10:132709592-132709614 GTGGCAGCTGGGCCACAGGCTGG + Intronic
1076812702 10:132897607-132897629 GCTGCATCTGGCCCACAGGATGG + Intronic
1077238729 11:1499440-1499462 CCTGCAGGATGACCACAGGACGG + Intronic
1077298546 11:1837084-1837106 GGTCCAGGTGGGCCACCGGGAGG + Exonic
1077560493 11:3257424-3257446 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077560550 11:3257677-3257699 GATGCAGGTGGGACTCAGGTAGG - Intergenic
1077560570 11:3257776-3257798 GATGCAGGTGGGACTCAGGTGGG - Intergenic
1077560579 11:3257820-3257842 GATGCAGGTGGGACTCAGGTGGG - Intergenic
1077566389 11:3303241-3303263 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077566449 11:3303516-3303538 GATGCAGGTGGGACTCAGGTAGG - Intergenic
1078408928 11:11095512-11095534 GCTGCAGGAGGCTCCCAGGAAGG + Intergenic
1078789901 11:14531929-14531951 GCTCCATGTTGGCCACAGGTTGG + Intronic
1079083052 11:17427456-17427478 GTTGGAGGTGGGACCCAGGATGG - Intronic
1079175620 11:18137570-18137592 GTACCAGATGGGCCACAGGATGG - Exonic
1079261584 11:18887510-18887532 GTACCAGATGGGCCACAGGACGG + Intergenic
1079266081 11:18934395-18934417 GTACCAGATGGGCCACAGGACGG + Exonic
1079334381 11:19558578-19558600 GCTGCCATTGGGCCATAGGAAGG - Intronic
1079710969 11:23681012-23681034 GCTGCAGGGAGGGCACAGGGAGG - Intergenic
1081651781 11:44828711-44828733 ACTGCAGCTGGGCTACAGAAGGG - Intronic
1081914700 11:46723397-46723419 CCTGTAGGTCGGCCCCAGGATGG - Exonic
1082847252 11:57736426-57736448 GCTGCATGTGAGCCACAGGTTGG + Intronic
1082895965 11:58190468-58190490 GTTGCAGGTGAACCACTGGATGG + Exonic
1083316423 11:61817178-61817200 GCTGCGGGGTGGCCGCAGGAAGG + Intronic
1083663228 11:64261767-64261789 GGTGCAGGAGGGCCGCCGGAGGG - Intronic
1083773972 11:64884146-64884168 GTGGCAGCTGGGCCACAGGACGG - Intronic
1085150589 11:74249886-74249908 GCAGGAGGAGGGGCACAGGATGG + Intronic
1085252196 11:75151259-75151281 GCAGCAGGTGAGCCACAGCAGGG - Exonic
1085470662 11:76755539-76755561 GCGGCCCGTGGGCCACAGGGTGG + Intergenic
1087380356 11:97398079-97398101 GCTTCAGGTTGGCCACAGCACGG - Intergenic
1089145419 11:116326418-116326440 TCTGCAGATGTGCCACAGAAGGG - Intergenic
1089214103 11:116825349-116825371 GCGCCAGGTGGGCCAGAGGCAGG + Intergenic
1089597380 11:119589375-119589397 CCTTCAGGTGGGTCACAGAATGG + Intergenic
1090273791 11:125405663-125405685 GTTGCAGCTGGCCCAGAGGATGG + Intronic
1090869507 11:130730785-130730807 GCAGCCTGTGGGCCACAGGTTGG - Intergenic
1091232779 11:133999376-133999398 GTTGGAGGTGGGACCCAGGAAGG - Intergenic
1091389513 12:117560-117582 CCTCAAGGTGGGCCACAGGGTGG - Intronic
1091879535 12:3965746-3965768 ACTACAGGAAGGCCACAGGAAGG + Intergenic
1093855925 12:24102155-24102177 GCAGCAGGTGCTACACAGGAAGG - Intergenic
1095662337 12:44752049-44752071 GCAGCCCGTGGGCCACAGGTTGG + Intronic
1096579119 12:52573193-52573215 GGTGCAGCTGGGCCTCAGGAAGG - Intronic
1097307332 12:58083977-58083999 GATGCAGGTTGGCCACATGAGGG + Intergenic
1098070911 12:66673766-66673788 GCTGCAGCTGGGTCCCAGGCAGG - Intronic
1102137029 12:110583580-110583602 ATTGCAGGTGGGCCACGTGAGGG + Intergenic
1103086896 12:118068496-118068518 GCTGCAGTAGGGGAACAGGAGGG - Exonic
1103465444 12:121138783-121138805 GCTCCTGGTGGGACTCAGGAAGG - Intronic
1103597339 12:122031739-122031761 GCTCCAGGAGGGCTCCAGGAGGG + Intronic
1104058993 12:125252197-125252219 GCAGCTAGTGGGCCTCAGGAAGG + Intronic
1104515758 12:129424939-129424961 GCTGCAGGTGGGGAGCGGGATGG - Intronic
1104689448 12:130814368-130814390 GCTGCAGCTGTCCCACAGGAGGG + Intronic
1104914265 12:132256667-132256689 GCTGGAGGGGGGACACTGGAAGG + Intronic
1104959927 12:132483812-132483834 GAGGCAGGTGGGCCTCAGGTGGG + Intergenic
1104962431 12:132494549-132494571 GCTGCGCCTGGGCCACAGGGAGG + Intronic
1105455847 13:20540471-20540493 GCTGCAGTTGGGCCAGATGATGG + Intergenic
1106671442 13:31910070-31910092 GCTGCACGTGGGACACCAGAGGG + Intergenic
1106816881 13:33418367-33418389 GCTGCAGCTGGGCAAGGGGAGGG + Intergenic
1107129420 13:36879434-36879456 GCTGCAGGTGTCCCACCGCAAGG - Exonic
1107155539 13:37163042-37163064 GCTGCCCATGGGCCACAGGTTGG - Intergenic
1109765842 13:66895997-66896019 GCAGGAGCTGGGCCACAGCAAGG + Intronic
1113015588 13:105824680-105824702 CCTGCAGGTAAGCCACTGGATGG - Intergenic
1113628907 13:111866919-111866941 GCAGCAGGTAGGCCATAAGACGG - Intergenic
1113767754 13:112891589-112891611 GCTGCAGGTGTGCTACAGTGCGG + Intergenic
1113772231 13:112917580-112917602 GGGCCAGGTGGGCCACCGGAGGG - Intronic
1114443554 14:22770508-22770530 TCTGCAGGCTGGGCACAGGAAGG - Exonic
1118863461 14:69683816-69683838 CCTCCAGGTGGGCTGCAGGAAGG + Intronic
1119105290 14:71917586-71917608 GGAGCAGGTGGGCCACACGCAGG - Intergenic
1119388868 14:74276630-74276652 CCTGCAGGGGTGCCACAGGAGGG + Intergenic
1119567091 14:75637922-75637944 ACTGCTGGAGGGGCACAGGAGGG + Intronic
1121598299 14:95183148-95183170 TCTGCAGGTGAGCCACAGCTAGG + Exonic
1122123565 14:99567330-99567352 GCCCCAGGGGGGTCACAGGAGGG + Intronic
1122596660 14:102898495-102898517 GGTGCAGGCGGGCCACAGGATGG - Intronic
1122825694 14:104369414-104369436 GTTGCAGTGGGGACACAGGATGG + Intergenic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1123019874 14:105392646-105392668 GCTGCAGGTGGACTACTGGACGG + Exonic
1123058609 14:105584256-105584278 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123061546 14:105596950-105596972 GCTGCAGGTGGATGGCAGGAGGG + Intergenic
1123082940 14:105704490-105704512 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123113123 14:105882202-105882224 GGTGTAGGTGGGACTCAGGATGG + Intergenic
1124431484 15:29612461-29612483 GCTGAAGGTGTGCCAGAGGCTGG - Intergenic
1124521332 15:30408474-30408496 GCTGCAGCTGGACAACTGGATGG + Exonic
1124537330 15:30557743-30557765 GCTGCAGCTGGACAACTGGATGG - Exonic
1124761325 15:32449844-32449866 GCTGCAGCTGGACAACTGGATGG + Exonic
1124777309 15:32599219-32599241 GCTGCAGCTGGACAACTGGATGG - Exonic
1126066786 15:44831866-44831888 GCTGCATGTGGGCTGCAGGTTGG - Intergenic
1126093045 15:45068689-45068711 GCTGCATGTGGGCTGCAGGTTGG + Intronic
1126739612 15:51764454-51764476 GCTGCAGGTGGGCCTCTTAAGGG - Intronic
1128550829 15:68596912-68596934 GCAGGAGGAGAGCCACAGGATGG - Intronic
1129170194 15:73802901-73802923 GCTGCAGGCCTGGCACAGGAAGG + Intergenic
1129524381 15:76204579-76204601 GCTGAAGCTGGGCCACAGGCTGG - Exonic
1130555959 15:84922694-84922716 GGGGCAGGTGGGCCACAGAGGGG - Intronic
1132086269 15:98910824-98910846 ACTACAGGTGTGCCACAGAAAGG - Intronic
1132543518 16:522500-522522 CCTCCAGGGGGGCCACAGGGTGG + Exonic
1132687952 16:1170131-1170153 CCTGCAGGTGTGCCAGGGGAGGG + Intronic
1132739396 16:1403921-1403943 CCTGCAGGTGGCCCATGGGATGG - Intronic
1132815596 16:1824928-1824950 GCTGCAGGTGGGGTGCAGAAGGG + Intronic
1132993725 16:2811804-2811826 GCTGGAGATGGCCCACAGCAGGG + Intergenic
1136398879 16:30007138-30007160 GCTGCAGGGGCGCCAGGGGAGGG - Intronic
1137632700 16:49958114-49958136 GCTGAAGGAGGGACCCAGGAAGG + Intergenic
1139291310 16:65860477-65860499 GCTGCAGGTGGCATCCAGGAGGG - Intergenic
1139431509 16:66913351-66913373 GCTGGAGCTGGCCCACCGGAAGG - Intronic
1139594706 16:67950921-67950943 GGGGCAGGTGGGGCAGAGGACGG - Intronic
1139958531 16:70704796-70704818 GCTGCAGGTGAGGCCCAGGAGGG + Intronic
1140467494 16:75194167-75194189 CCTGCAGAAGGGGCACAGGATGG + Intergenic
1140950898 16:79816389-79816411 GCTGAAGGTGGGACACAGCCTGG - Intergenic
1141480714 16:84304856-84304878 GCTGGGGCTGGGCCACAGGAGGG + Intronic
1141483026 16:84319409-84319431 GCTGCAGGAGGGACACACGCTGG - Exonic
1141743383 16:85909376-85909398 GCAGCAAGTGGGGCACAGGTTGG - Intronic
1141774852 16:86116442-86116464 GCTCCAGCTGGGCCCAAGGAGGG - Intergenic
1142142371 16:88478348-88478370 GCTGCGGGTGGGCCAGGGGTGGG + Intronic
1142245423 16:88968121-88968143 CCTCCAGGTGGGCCCCAGCATGG - Intronic
1142968286 17:3594614-3594636 GCTGCAGGGGGTCCACCTGATGG - Intronic
1143347139 17:6258188-6258210 GATGCAGCTGGCCCCCAGGATGG + Intergenic
1143614171 17:8039628-8039650 GCTGCAGGGGGAGCACAGGAAGG + Intronic
1143838906 17:9714984-9715006 GCAGCAGGTGGACCAGAGGCTGG + Intronic
1143902443 17:10184289-10184311 GGTGGAGGTGGGCCTCAGGGAGG - Intronic
1144030856 17:11321772-11321794 GCAGCCTGTGGGCCACAGGTTGG - Intronic
1144079228 17:11747503-11747525 GATGCAGGTGAGTCACAGGCTGG + Intronic
1144622866 17:16829666-16829688 GTGGGAGGTGGGACACAGGATGG - Intergenic
1144819943 17:18065550-18065572 GCTGGAGGTGGGACGGAGGAAGG - Exonic
1144883565 17:18443050-18443072 GTGGGAGGTGGGACACAGGATGG + Intergenic
1144969560 17:19099144-19099166 GCTGTGGGTGGTCCACAGGGTGG + Intergenic
1144978356 17:19152920-19152942 GCTGTGGGTGGTCCACAGGGTGG - Intronic
1144989865 17:19225313-19225335 GCTGTGGGTGGTCCACAGGGTGG + Intronic
1145013540 17:19382924-19382946 GTGGCTGATGGGCCACAGGATGG + Exonic
1145148663 17:20501336-20501358 GTGGGAGGTGGGACACAGGATGG - Intergenic
1145771375 17:27495536-27495558 GGTGGAGTTGGGCGACAGGAGGG + Intronic
1146970288 17:37066521-37066543 GCTGACGGCGGTCCACAGGAGGG + Intergenic
1147577188 17:41609601-41609623 GTGGGAGGTGGGACACAGGATGG - Intergenic
1147667271 17:42156577-42156599 GCTGGAGGTGGGCCAAAGCCAGG + Intergenic
1148155877 17:45425144-45425166 GCTGCAGGTGAGTCACCGGGAGG + Intronic
1148445883 17:47736871-47736893 GCTGTAGGTGGGCCTGAGGTGGG - Intronic
1148610229 17:48960040-48960062 GGGACAGGCGGGCCACAGGATGG + Intronic
1149181244 17:53939544-53939566 GCTACAGGTGGGCAACACCATGG - Intergenic
1149451256 17:56751744-56751766 GCTGCAGGGAGGCCAGAGGCAGG - Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150173912 17:63030057-63030079 GCTGCAAGTGAGCCACTGCAGGG + Intronic
1150335249 17:64326243-64326265 GCTGCAGGTGGAACTCAGCAAGG + Intronic
1151358264 17:73573008-73573030 AGTGCAGGTGTGCCACATGAAGG + Intronic
1151395558 17:73820298-73820320 GCTGCAGGGAGGACACAGGGAGG - Intergenic
1151842326 17:76627191-76627213 GCTGCTGCTGGGGCACTGGAGGG + Exonic
1152130095 17:78471335-78471357 GCAGCAGGTGGGCCGCAGGTGGG + Intronic
1152576759 17:81144496-81144518 GCTGCAGCTGGGACAATGGAGGG + Intronic
1154055919 18:11014060-11014082 GCTGCAGGTTTCCCAGAGGACGG - Intronic
1154210898 18:12377519-12377541 GCTGGAGGTGGGGCCGAGGAAGG + Intergenic
1154321782 18:13360040-13360062 GCTGTAGGTGGGCCACAGAATGG + Intronic
1155533799 18:26795000-26795022 GCACCAGCTGGGCCACAGAAGGG + Intergenic
1157553080 18:48594705-48594727 GCTTCAGGATGGGCACAGGAGGG - Intronic
1157785468 18:50478166-50478188 GATGCAGGTGGCCCACAGAGGGG + Intergenic
1158900081 18:61954367-61954389 GCTGCAGGAAGTCAACAGGAGGG + Intergenic
1160040135 18:75337590-75337612 GCTGCAGGTGGGGCCAAGGCAGG + Intergenic
1160106854 18:75986572-75986594 GCTGCAGATGGGCCTCAGCATGG - Intergenic
1160135211 18:76265932-76265954 GCTGAAGCTGGGCCACTGGCTGG + Intergenic
1160183393 18:76655469-76655491 CCTGCATGTGTGCCCCAGGAAGG + Intergenic
1160505879 18:79426669-79426691 GCTGCAGCTGAGTCACAGGGGGG - Intronic
1161155758 19:2731325-2731347 GCTGCAGCAGGGCCACCGGCCGG + Intronic
1161812967 19:6481360-6481382 GCTTCAGGGGGTCCACAGGGCGG - Intronic
1162146563 19:8615891-8615913 ACTGCAGCTCTGCCACAGGAGGG + Intergenic
1162475953 19:10899444-10899466 GCTGTGGGTGGGTCCCAGGAAGG - Intronic
1162587590 19:11570231-11570253 GTTGAGGGTGGGCCAAAGGAGGG + Intronic
1162935049 19:13978080-13978102 GCTGCACCTGGGGCAGAGGAAGG + Exonic
1164464166 19:28473428-28473450 GCTGCAGGCGGGCCACAGCGAGG + Intergenic
1165486728 19:36101029-36101051 GTTCCAGGTGGGGTACAGGAGGG + Intronic
1165882049 19:39051269-39051291 GCTACAGCTGGGCTCCAGGAGGG - Intergenic
1166595346 19:44043286-44043308 GCTGCATGTGTGCCACTGGCTGG - Intergenic
1167429416 19:49446074-49446096 GCGGCTGGGGAGCCACAGGAGGG + Intergenic
1168650917 19:58091589-58091611 GCTGAGGGTGGGGCACAGGTTGG - Intronic
926220742 2:10934115-10934137 GCTGCAGGTTGTCCAGAGGCAGG - Intergenic
927006921 2:18860947-18860969 GCAGCTGGTGGGCCATGGGATGG + Intergenic
927704841 2:25290752-25290774 GCTGCAGGTGGGCTGCAGCCTGG - Intronic
929044308 2:37775464-37775486 GCTGCTGGTGGGGCCCAGGTGGG - Intergenic
929165326 2:38875891-38875913 GCTGCAGCTGGGCCACCGCAGGG - Exonic
930025862 2:47028815-47028837 GGTGCAGCTTGACCACAGGAAGG - Intronic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
932319808 2:70813425-70813447 GCAGGAGGTGGGGCTCAGGAAGG + Intronic
933632255 2:84671666-84671688 GCTTCCAGGGGGCCACAGGATGG + Intronic
933671038 2:85007507-85007529 GCTGGAGGTGGGCCAAGTGAAGG - Intronic
933703535 2:85273284-85273306 ACTGCAGGTGAAACACAGGAGGG - Intronic
934517272 2:94996610-94996632 GCTCCTGGAGGGCCTCAGGATGG + Intergenic
935344578 2:102093955-102093977 GCTGCAGGTGAAGCTCAGGACGG - Intronic
935359519 2:102235662-102235684 GCTGTCGGGGGACCACAGGAGGG + Intronic
935639898 2:105280660-105280682 GGAGGAGGTGGGCAACAGGAAGG + Exonic
936075135 2:109397000-109397022 ACTGCAGGTAGGCCACCGGGGGG - Intronic
941713664 2:168741586-168741608 GCAGCCCGTGGGCCACAGGTTGG + Intronic
947197104 2:227579161-227579183 GCTCCAGGCTGGTCACAGGATGG + Intergenic
948324047 2:237097068-237097090 TCTGCAGCTGGCCCAGAGGAGGG - Intronic
948385325 2:237577289-237577311 GATGCTGGTGGGCAACAAGACGG - Exonic
948405659 2:237716925-237716947 GCTGCATGTGGCCCGCAGGTTGG - Intronic
948465510 2:238149961-238149983 CCTGCAGGGGGGCTGCAGGAAGG - Intronic
948599310 2:239099447-239099469 GCTGCCTGTGGGCCCCATGAGGG - Intronic
948605223 2:239130709-239130731 GCCGCAGGTGGGCCTAGGGAAGG - Intronic
948606911 2:239141608-239141630 GCTGCAGGTGGGGCAGAGATGGG - Intronic
948635264 2:239330424-239330446 ACTGCAAGAGGGCGACAGGAAGG + Intronic
1170812842 20:19687982-19688004 GCTTCAGGAAGGACACAGGAGGG - Intronic
1172444292 20:34984994-34985016 GCGGCAGGTCGGGCACAGGTGGG + Intronic
1173041185 20:39464500-39464522 GCTGCCTGTAAGCCACAGGAGGG + Intergenic
1173250442 20:41361618-41361640 GCTTCAGGCTGGCCACAGGCAGG - Exonic
1173274023 20:41563264-41563286 TCAGCAGCTGGCCCACAGGAAGG - Intronic
1174252617 20:49230863-49230885 GCTGGAGGTGGGGCAGGGGAAGG + Intronic
1174406970 20:50309022-50309044 GCTGCCGGTGGGCCCCTGGGAGG - Intergenic
1174653722 20:52152402-52152424 GCCTCAGGTGGCCCCCAGGAAGG - Exonic
1174737899 20:52983156-52983178 GCTGCAGTTGGACCCCAGGTCGG - Intronic
1175280136 20:57798390-57798412 GCTGCAGGAGTCCCACAGCAGGG - Intergenic
1175465964 20:59191531-59191553 GCCGCAGGTGGCACACGGGAAGG - Exonic
1176139085 20:63537338-63537360 GCTCCAGCTGGGCCACAGCCTGG - Exonic
1176227719 20:64011497-64011519 GATCCAGGTGGGCCGCAGGCGGG + Exonic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1176428079 21:6560895-6560917 GCTGATGGTGGACGACAGGAAGG - Intergenic
1179112618 21:38460525-38460547 GTTGCATGTGGGACAAAGGATGG - Intronic
1179405320 21:41121144-41121166 GCTGAAGCTGAGCCTCAGGAAGG - Intergenic
1179703570 21:43169212-43169234 GCTGATGGTGGACGACAGGAAGG - Exonic
1180040789 21:45278493-45278515 GCTGCAGGCGTGCCTGAGGAGGG + Intronic
1181022668 22:20111942-20111964 CCTGCAGGGAGGCCCCAGGAGGG - Exonic
1181386889 22:22552886-22552908 GCTTCAGAGGGGCCAGAGGAGGG - Intronic
1181396877 22:22629224-22629246 TCTGCAGGTGGAACCCAGGAAGG + Intergenic
1181556484 22:23674522-23674544 GCTGCAGGTGGGACAATGGCTGG + Intergenic
1183585498 22:38750839-38750861 GCTGCTGGGAGGCCTCAGGAAGG - Intronic
1183971003 22:41477475-41477497 GCAGCACCTGGGCCAGAGGAAGG + Intronic
1185003817 22:48263439-48263461 GCATCAGCTGGGCCGCAGGATGG + Intergenic
1185040635 22:48502051-48502073 ACAGCGGGTGGGCCACAGGCTGG - Intronic
1185151540 22:49166838-49166860 GCTGCTGGTGACCCTCAGGATGG + Intergenic
1185311943 22:50161137-50161159 GCTGCAGGTGGGTAAGTGGATGG - Intronic
950101566 3:10360075-10360097 TCGGCAGGTGGGCAACAAGACGG - Exonic
950220949 3:11195753-11195775 GCTGCAGATGAGCTTCAGGAAGG + Intronic
950666690 3:14499969-14499991 GCGGCCCGTGGGCCACAGGTTGG + Intronic
952338921 3:32428874-32428896 GGGCCAGGTGGGCCACAGGTGGG - Intronic
952509064 3:34036006-34036028 GCTGCAGGCGGGCAGGAGGAGGG + Intergenic
954081841 3:48216853-48216875 GCTGGAGGTGGGGAACTGGAAGG - Intergenic
954613876 3:51959790-51959812 GCTGCAGGTGGGGCAGGGCAGGG - Intronic
960045512 3:113193578-113193600 GCAGGATGTGGGCCACAGGGAGG + Intergenic
960967367 3:123114581-123114603 GCTGCAGATGGCGCAGAGGAAGG - Intronic
961386542 3:126526240-126526262 CCTGCAGGTGGCACACAGGGAGG + Intronic
961415440 3:126753354-126753376 CCTCCAGGTGGGCAAAAGGACGG - Intronic
961431680 3:126888532-126888554 GCAGCAGGTGGGGCACAGCAGGG - Intronic
961477261 3:127156736-127156758 GCTGGTGGAGGGCCACAGGAGGG - Intergenic
963723072 3:148886459-148886481 GGTACAGGTGGGAAACAGGAAGG - Intronic
964116285 3:153139541-153139563 GCTGAAGGTGGGCTTCAGGGTGG - Intergenic
964887100 3:161496943-161496965 TCTGGAGGTGGGCCACTGGATGG - Exonic
965964089 3:174466190-174466212 GCTGCATGTGGGCCACAGGTTGG - Intronic
967910709 3:194540402-194540424 GGTGCAGATGTGGCACAGGAGGG - Intergenic
968512174 4:1000605-1000627 TCTGCAGGGGGTCCACTGGACGG + Exonic
968663031 4:1806633-1806655 GCTGAAGGAGGGCCACCGCATGG + Exonic
969522342 4:7685809-7685831 GCTGCAGGAGGGACACAGTCAGG - Intronic
969541017 4:7788906-7788928 GCTGCAGCAGGGACAAAGGATGG + Intronic
969562877 4:7960517-7960539 GCTGCCGGTGGCCCACTGTAAGG + Intergenic
969693299 4:8719731-8719753 GCTCCACGTGGGCTCCAGGAGGG + Intergenic
969868304 4:10089611-10089633 CCTGCAGGTGGGCAGCAAGAGGG - Intronic
970882407 4:20947398-20947420 GAGGCAGGTGGACCACATGAGGG - Intronic
972668302 4:41189363-41189385 GCAGGAGGAAGGCCACAGGAGGG + Intronic
977272916 4:94940213-94940235 GCTGCCTGTGGGCCACGGGTTGG - Intronic
979755153 4:124331062-124331084 TCTGGAGATGGGCCACAGGAGGG + Intergenic
980550439 4:134327992-134328014 GCAGGAGGAGGACCACAGGAAGG + Intergenic
984951943 4:185014580-185014602 GCAGCAGGTGTCCCACAGAAGGG + Intergenic
985672126 5:1212506-1212528 GCTGCAGGTGCTCCAGAGGGCGG + Intronic
986200521 5:5574349-5574371 GCTGCAGGTGGTTCACAGCAGGG - Intergenic
986325429 5:6669879-6669901 ACTGCAGATGGACCACAGCACGG + Intergenic
987373631 5:17216205-17216227 GCTGCAGGTTGTCCTCAGGATGG - Intronic
987803973 5:22738134-22738156 GCTACAGAGGGGCCACAGCAAGG + Intronic
989998935 5:50869975-50869997 GCAGCAGATTGGCCAAAGGAAGG - Intergenic
990321554 5:54634427-54634449 GCAGCCCGTGGGCCACAGGTTGG - Intergenic
990403601 5:55465627-55465649 GCCACATGTGGGCCACAGGTTGG + Intronic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
997067317 5:130577039-130577061 ACTGCAGGTCAGTCACAGGATGG - Intergenic
997364733 5:133318722-133318744 GCTGCAGCAGGGCCACCTGAAGG + Intronic
997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG + Intronic
997529475 5:134573037-134573059 GCTGCAGGCTGGGCACAGGTGGG + Intronic
997579641 5:135009171-135009193 GCTGATGGTGGTCAACAGGACGG + Intronic
997963154 5:138337903-138337925 GCTGCAGTTGGGCCGTTGGAGGG + Intronic
1000631875 5:163599884-163599906 CCTGCAGGAGAGACACAGGAGGG - Intergenic
1001897900 5:175397180-175397202 GCAGCAGGTGGACCCCAGGCAGG + Intergenic
1002093558 5:176818082-176818104 GCTGCAGCTGGGCTACAGCACGG - Intronic
1002635986 5:180609085-180609107 CCTGCAGGAGGGCCTCAGGCGGG - Intronic
1004215487 6:13700209-13700231 GCTGCATGTTGGCGACTGGAAGG - Intronic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1007112218 6:39319464-39319486 GCTGCTGGTGGCCAAAAGGATGG + Intronic
1007825161 6:44594758-44594780 GCTGCTGGCTGGCCCCAGGACGG - Intergenic
1011128884 6:84034246-84034268 GCGGCAGGAGGGCCGCAGCAAGG - Intronic
1011769352 6:90658851-90658873 GCTGCAGGTGGCTTACAGGATGG + Intergenic
1013512692 6:110858965-110858987 GCTGCAGATGGGCTACACGCAGG + Intronic
1014561964 6:122901616-122901638 AGTGCAGGTGGGCCACAGGAGGG + Intergenic
1014644091 6:123953217-123953239 GCTGCAGATGGGACACAGGTGGG + Intronic
1014734369 6:125075059-125075081 GCAGCAAGTGGTCCACAGGTTGG - Intronic
1015950551 6:138548397-138548419 GCTGCATGTGGGCCACAGGTTGG - Intronic
1017051787 6:150400129-150400151 GCTGCCCCTGAGCCACAGGAGGG - Exonic
1017847479 6:158271894-158271916 GCTTCAGGTGAGACAAAGGATGG + Intronic
1017861036 6:158397451-158397473 GCTGCATGAGGCCCACAGGTTGG - Intronic
1018843148 6:167533044-167533066 GCTGCAGCAGCCCCACAGGAGGG + Intergenic
1019265689 7:116377-116399 GGTGCAGGTGGGGCACAGGCTGG - Intergenic
1019335643 7:481299-481321 GCTGCAGGAGCTCCAGAGGAAGG + Intergenic
1019637494 7:2083866-2083888 CCTGCAGCCGGCCCACAGGATGG - Intronic
1019667744 7:2260448-2260470 GCAGCCTGTGGGCCACAGGTTGG + Intronic
1019718585 7:2554771-2554793 GCTGCAGGTGGGCCAGAGTCAGG + Intronic
1019758139 7:2788420-2788442 GCTGCATATGAGCCAGAGGAGGG - Intronic
1020117193 7:5482359-5482381 GCCGCAGGTGGGCCACCTCAAGG + Intronic
1020258958 7:6519983-6520005 GCTGCAGGTGGGCCAAGGCACGG + Intronic
1020558006 7:9693576-9693598 GGTGCAGGTGCACCAGAGGATGG - Intergenic
1021483781 7:21145912-21145934 GCTACAGCTGGGCCACAGGTGGG + Intergenic
1021645139 7:22782369-22782391 GGTGGAGGTGGGCCAGGGGAGGG - Intergenic
1022094640 7:27130939-27130961 GCTGCACGTGGGGCACGGGGCGG - Intronic
1022673301 7:32476109-32476131 GCAGTAGGTGCTCCACAGGAGGG - Intergenic
1023883296 7:44333869-44333891 CCTGCAGATGGGCCCCAGGGAGG - Intronic
1024229427 7:47352930-47352952 GCTACAGGTGGGGCAGAGGTGGG + Intronic
1024281507 7:47723070-47723092 GCTGGATGGCGGCCACAGGATGG - Intronic
1025097528 7:56107937-56107959 GCTGTTGCTGGGACACAGGAAGG - Intergenic
1026199527 7:68202238-68202260 GCTTCAGGGAGGCCAAAGGATGG + Intergenic
1026310108 7:69175886-69175908 GCAGGAGGTGAGCCACAGGCAGG + Intergenic
1026479053 7:70763159-70763181 GCTGGAGCTGGGCCTCAGGAGGG - Exonic
1027212943 7:76165345-76165367 GCTGCAGGTATGATACAGGACGG + Intergenic
1027241324 7:76331448-76331470 GCAGCCTGTGGGCCACAGGTTGG - Intronic
1027578257 7:79958669-79958691 TCTGAAGATGGACCACAGGAGGG + Intergenic
1027698499 7:81438980-81439002 GCTGCAATTGGGCTACAGAAGGG + Intergenic
1028113906 7:86975882-86975904 GCTGAAGGTGGGCCAAATCAGGG + Intronic
1028357627 7:89928420-89928442 GCAGCCTGTGGGCCACAGGTTGG + Intergenic
1028802307 7:94980279-94980301 GCGGCCCGTGGGCCACAGGTTGG + Intronic
1029220942 7:98989741-98989763 GCAACAGGTAGGCCACAGGCTGG - Intronic
1030112366 7:106037873-106037895 GCTGGAGGTGGGCTAGAGGCAGG - Intergenic
1030805474 7:113912776-113912798 GCTGCAGATGGGCTTCAGGTGGG + Intronic
1031690328 7:124780368-124780390 GCAGCAGGTGGCCAACAGGAAGG - Intronic
1033230492 7:139593829-139593851 GCTCCAGCTGGGACACAGAAGGG + Intronic
1033558339 7:142508229-142508251 GGGAAAGGTGGGCCACAGGAGGG - Intergenic
1033652084 7:143351321-143351343 GCTGCAGGTGGTCACTAGGAAGG + Intronic
1034222650 7:149458674-149458696 ACTGTAGAGGGGCCACAGGAGGG + Intronic
1034347843 7:150397983-150398005 GCCGCAGGCGGGACACAGGTAGG - Exonic
1034562636 7:151891209-151891231 GCTGTGGGTGGGCCACAGCTTGG - Intergenic
1035064452 7:156094991-156095013 GCTGCAGGTGGACCTGAGGTAGG + Intergenic
1035599951 8:891510-891532 GCAGCTGCTGGGCCACAGGATGG + Intergenic
1036122546 8:6034041-6034063 GCTGAAAGTGGGCCAAAGGCAGG - Intergenic
1036287045 8:7452135-7452157 GATGCAGGTGGGCCACTGTGGGG - Intronic
1036334436 8:7859387-7859409 GATGCAGGTGGGCCACTGTGGGG + Intronic
1036701368 8:11015949-11015971 GCTGCAGGCGGGCTCCATGAGGG + Intronic
1037801885 8:22040447-22040469 CCTGCAGGTGCCCAACAGGAAGG + Intergenic
1038198380 8:25389069-25389091 TCTGCAGGTGAGACACAGAAAGG - Exonic
1039656347 8:39412114-39412136 GCTTCAGGTGTGACACAGCAGGG + Intergenic
1040296475 8:46151621-46151643 GCGGCAGCTGAGCCACAGGCAGG - Intergenic
1040332967 8:46401648-46401670 GCAGCAGCAGGGCCACAGGCAGG - Intergenic
1042184341 8:66122023-66122045 GCTGTAAGTGGGACACAGGAGGG - Intergenic
1044441717 8:92231189-92231211 CCTGCACTTGGGCCACAGGCCGG - Intergenic
1045582824 8:103499490-103499512 GCTGAAGGTGGGTGACAGGGAGG - Intergenic
1048035648 8:130674800-130674822 GATGCTGGTAGGACACAGGAAGG - Intergenic
1048531596 8:135255002-135255024 GCTTCTGGAGGGTCACAGGAGGG - Intergenic
1048533701 8:135273537-135273559 GCTGCGGTTGGGGCACAGGTAGG - Intergenic
1049092471 8:140526488-140526510 GCTGCCCGTGGGTCACAGTATGG + Intergenic
1049443336 8:142619062-142619084 ACTGCAGGTGGCCCTCAGGACGG - Intergenic
1049593077 8:143471423-143471445 GCAGCAGCTGGCCCACAGCAGGG + Intronic
1049710774 8:144062390-144062412 GCCTCAGCTGGGCCTCAGGATGG - Intronic
1049791088 8:144473045-144473067 GCTGCAGGTGGGCGCCGGGGCGG + Exonic
1049804373 8:144532338-144532360 GCTGCAGGTGGACCAGTGGAAGG - Exonic
1049830773 8:144699636-144699658 GGTGCTGGTGGGCTACGGGACGG + Intergenic
1050825577 9:9941164-9941186 GCTGCCTGTGGGCTACAGGATGG + Intronic
1051354733 9:16231304-16231326 CCTCCAGGTGGGGCACAGGAAGG - Intronic
1051368306 9:16336914-16336936 GCTCCAGGTAGGCCACTGCAAGG + Intergenic
1051868440 9:21708906-21708928 GATGCAGTGGGGCCTCAGGAAGG + Intergenic
1052772838 9:32705269-32705291 GCTGCAGGTGAGTCACTGGCTGG - Intergenic
1053153903 9:35760753-35760775 GCAGCAGTTATGCCACAGGAGGG - Intergenic
1053463140 9:38286181-38286203 GCTGCATGTGGGCCACGGGTTGG + Intergenic
1055243763 9:74216993-74217015 GCAACAGTTTGGCCACAGGATGG - Intergenic
1056408385 9:86299058-86299080 GCTGCAGGTCAGCCAGAGGAAGG + Intronic
1056547947 9:87628478-87628500 ACTGAAGCTGGGACACAGGAAGG - Intronic
1057180518 9:93027214-93027236 CCTGCAGGTGGGCCAATGAACGG + Intronic
1057831371 9:98409655-98409677 GCTGCAGGTTGCCCCCAGGGAGG - Intronic
1058804655 9:108579051-108579073 GCTGGAGGAGGGCCAGAGGGGGG + Intergenic
1058846362 9:108963659-108963681 GCTGGAGGAGTGCCACAGGATGG - Intronic
1061132409 9:128715325-128715347 GCTCCAGGTGGGCCAGACCAGGG - Intronic
1061163927 9:128911634-128911656 GCTGGGGGTGGGGGACAGGATGG - Intronic
1061406487 9:130395341-130395363 GCTGCAGGTGGGCGCCAGGCAGG + Intronic
1061407923 9:130402957-130402979 GAGGCAGGTGGGGCTCAGGATGG + Intronic
1061485814 9:130920021-130920043 CCTGCAGGTGGGCGGAAGGAGGG - Intronic
1062034389 9:134376420-134376442 GCTGTGGTTGGGCCACTGGAGGG - Intronic
1062045854 9:134424185-134424207 GCTGCAGGGAGACCACAGGCAGG - Intronic
1062209434 9:135355826-135355848 GCAGCTGGTGGGCCCCAGGTGGG - Intergenic
1062246044 9:135566683-135566705 GGTGCAGGTGTGCAGCAGGAAGG - Exonic
1062370597 9:136236831-136236853 GCTCCAGGTGTGGGACAGGATGG - Intronic
1062370615 9:136236904-136236926 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370629 9:136236954-136236976 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370657 9:136237054-136237076 GCACCAGGTGTGGCACAGGACGG - Intronic
1062370663 9:136237077-136237099 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370690 9:136237177-136237199 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370723 9:136237304-136237326 GCTCCAGGTGTGGCGCAGGACGG - Intronic
1062370755 9:136237431-136237453 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370782 9:136237535-136237557 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370795 9:136237585-136237607 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370809 9:136237635-136237657 GCTCCAGGTATGGCACAGGACGG - Intronic
1062370823 9:136237685-136237707 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062370836 9:136237735-136237757 GCTCCAGGTGTGGCACAGGACGG - Intronic
1062474240 9:136719567-136719589 GCTGCAGGCGGGGAACAGGCTGG + Intronic
1185862060 X:3588963-3588985 GATGCAGTTGGGCCCCAGGCTGG - Intergenic
1186556694 X:10567368-10567390 CCGGCAGGTGGGGCACTGGAAGG + Exonic
1189273596 X:39768960-39768982 GATTCAGGAGGGCCACATGAGGG + Intergenic
1190741713 X:53293104-53293126 GGAGCAGGTGGGCCTCAGAAGGG + Intronic
1191197905 X:57744427-57744449 GCTGGAGCTTGGCAACAGGAGGG + Intergenic
1191722736 X:64248313-64248335 GCTGGCAGTGGGCCACAGGCAGG + Intergenic
1192157196 X:68755359-68755381 GCTGCATGAGGGCTACAGGAGGG + Intergenic
1196609577 X:117695883-117695905 GTTCCAGCAGGGCCACAGGATGG + Intergenic
1197831341 X:130646382-130646404 GCTGAAGCTGGGCCCCAGGAGGG - Intronic
1199654510 X:149981153-149981175 GCTGCAGCAGGGCCAGAGTAAGG + Intergenic
1200226718 X:154421505-154421527 GCCTCAGGTGGGCCGCAGGCGGG + Exonic