ID: 912336283

View in Genome Browser
Species Human (GRCh38)
Location 1:108866075-108866097
Sequence CTGGATGAAGGGATAAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912336279_912336283 0 Left 912336279 1:108866052-108866074 CCAAAAGAGGAGTTTGGATGTTG No data
Right 912336283 1:108866075-108866097 CTGGATGAAGGGATAAAGCATGG 0: 1
1: 1
2: 2
3: 31
4: 314
912336278_912336283 3 Left 912336278 1:108866049-108866071 CCACCAAAAGAGGAGTTTGGATG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 912336283 1:108866075-108866097 CTGGATGAAGGGATAAAGCATGG 0: 1
1: 1
2: 2
3: 31
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912336283 Original CRISPR CTGGATGAAGGGATAAAGCA TGG Intronic
901873497 1:12152466-12152488 CAGGGTGAAGGGGAAAAGCAAGG + Intergenic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
902721176 1:18305200-18305222 ATGGATGAATGGATAATGGATGG + Intronic
902989468 1:20176312-20176334 CTGGATGTAGGGAAAAAACTGGG + Intronic
903187243 1:21635588-21635610 CGGGAGGAAAGGATTAAGCAAGG - Intronic
904480669 1:30791422-30791444 ATGGATGAAGGGAAAAGGGAAGG + Intergenic
904581390 1:31546770-31546792 CAGGATGAAGGGATAGTGAATGG + Intergenic
904862589 1:33549962-33549984 CTGACTGAGGGGATAAGGCAGGG + Intronic
905479290 1:38250145-38250167 ATGGATGATGGGATAGACCATGG + Intergenic
906369955 1:45245082-45245104 CTCTATAAAAGGATAAAGCAGGG + Intronic
906817819 1:48897357-48897379 ATGGATGAATGGATAAAGTGTGG - Intronic
906850919 1:49249832-49249854 ATGGATGAATGGATAAAAAATGG + Intronic
907748471 1:57238656-57238678 CTGGAGGAAGGGATTAACTAGGG - Intronic
911339987 1:96624198-96624220 CAGGAGGAAGAGAGAAAGCAAGG - Intergenic
911833538 1:102585313-102585335 CTGGAGGGAGGGAAAAATCAGGG + Intergenic
912336283 1:108866075-108866097 CTGGATGAAGGGATAAAGCATGG + Intronic
912395796 1:109342700-109342722 CAGGATGAAGGGAACAGGCATGG + Intronic
913228922 1:116724915-116724937 CAGGATGAAGGAATAAAGACTGG - Intergenic
913322923 1:117601966-117601988 CAGCATGAAGGGGTAAAGTAGGG - Intergenic
915032659 1:152896844-152896866 CTGCATGTAGGGATGAGGCAAGG - Intergenic
915945172 1:160144513-160144535 CTGAATGAAGTGACAAAGCCAGG - Intergenic
916353768 1:163881480-163881502 CTGGATGAATTTATAAAGGAGGG + Intergenic
916456886 1:164980297-164980319 ATGAATGAAGGGATAAAGAGAGG - Intergenic
916582260 1:166119579-166119601 CTGGAAGAAGGGTTAAAGTGGGG - Intronic
916681363 1:167108155-167108177 CTGGATGAATGGATGGACCATGG - Intronic
919051590 1:192517964-192517986 CTGCATGAAGGAAAAAGGCAAGG + Intergenic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
921214877 1:212928265-212928287 CAGGATGAAGGGAAACACCAAGG - Intergenic
922493928 1:226041047-226041069 CTAGATCAAGAGCTAAAGCAAGG + Intergenic
923295848 1:232594302-232594324 CTGGCTGTGGGGAAAAAGCAAGG + Intergenic
923471769 1:234297402-234297424 ATGGATGAATGGATAAAGTGTGG + Intronic
923544860 1:234916770-234916792 CAGAATGAAGGCATAAAGAAGGG + Intergenic
923839041 1:237647476-237647498 CTAGATGAAAGGATAATGCCTGG - Intronic
1063121089 10:3106192-3106214 CTGGAGGGAGGCAGAAAGCATGG + Intronic
1063591260 10:7397906-7397928 CTTGATGATGGGATGAGGCAGGG - Intronic
1063896115 10:10684113-10684135 CGGGATGAAGGGATGAAGCACGG + Intergenic
1064596476 10:16950581-16950603 ATGGTTGAAGGGATAAAGCAAGG + Intronic
1066034086 10:31463207-31463229 GTAGATGAAGGGAGAAAGGAAGG + Intronic
1066258502 10:33705325-33705347 TTGGATGAATGGATGAAGCTGGG - Intergenic
1067946156 10:50689929-50689951 GTGGATGAAAGGATAAAATATGG - Intergenic
1068328887 10:55535056-55535078 ATGGAGGAACGGAGAAAGCATGG + Intronic
1068688947 10:59896338-59896360 CTGGATGAGGGAATAACCCATGG - Intronic
1068877021 10:62007928-62007950 CTGGGTGATGGGATAGAGCTGGG - Intronic
1070257267 10:74824068-74824090 TTGGATGAAAGGATAGAGAAAGG - Intergenic
1070820191 10:79349882-79349904 CTGGATACAGGGCTAATGCAGGG - Intronic
1071444355 10:85731862-85731884 AGGGAGGAAGGGATAAAGAAAGG + Intronic
1071648046 10:87371244-87371266 GTGGATGAAAGGATAAAATATGG - Intergenic
1071746391 10:88424316-88424338 CTGGAAGACTGGATGAAGCAAGG + Intronic
1075272625 10:121065735-121065757 GCTGATGAATGGATAAAGCATGG - Intergenic
1076459398 10:130630110-130630132 GTGGAGGGAGGGATAAAGAAGGG + Intergenic
1076485384 10:130812344-130812366 CTGGATAAATGGATAAGGCAGGG - Intergenic
1077945367 11:6891637-6891659 ATAGATGAGGGGATTAAGCATGG + Exonic
1078157817 11:8813808-8813830 CTGGGGGAAGGGACAAAGGAAGG + Intronic
1079028364 11:16966774-16966796 CTGACTGAAGGAATAAAGCAGGG - Intronic
1079880177 11:25917956-25917978 CTGGAAGAAGGGAAAAACCATGG + Intergenic
1082862047 11:57866368-57866390 ATAGATGAAGGGATTGAGCATGG + Intergenic
1082898841 11:58223532-58223554 CTGGATGAAGGGAATGAGCAGGG + Intergenic
1082967094 11:58977310-58977332 CTGCAGGAAGTGATACAGCATGG + Intronic
1083088708 11:60177525-60177547 CTGGAATAAGGGATAAAGACGGG + Intronic
1083735966 11:64681467-64681489 CTGGAGGAAGGGATCAAGGAAGG + Intronic
1084303623 11:68267184-68267206 CTGGCTGAAGTGCTAAAGCAGGG - Intronic
1084672322 11:70614667-70614689 CTGGAGGATGGGATGAAGGAAGG - Intronic
1086184685 11:83999200-83999222 GTGGAAGAAGGGACAAAGCCAGG - Intronic
1086401996 11:86468430-86468452 ATGGATGGATGGATAAATCAAGG - Intronic
1088514662 11:110617695-110617717 CTGGATTCAGGTATAGAGCAGGG - Intronic
1088612863 11:111595020-111595042 CTGCATGAAGCAGTAAAGCAAGG + Intergenic
1090195399 11:124811990-124812012 AGGGATTAAGGGATAGAGCACGG + Intergenic
1091112091 11:132979134-132979156 ATGGATGGAGGGAGAAGGCATGG - Intronic
1091232813 11:133999515-133999537 CTGGATGCAGGGACAGAGCCGGG - Intergenic
1091290207 11:134435264-134435286 CTGGGTGATGGGAGAGAGCAGGG + Intergenic
1091466356 12:688183-688205 CTGGTGGAAGGGAAAAGGCAAGG + Intergenic
1092096203 12:5844041-5844063 CGGGCTGAAGGAATAAAGAAAGG + Intronic
1094230994 12:28103190-28103212 CAGGATGAAGTGAAAAAGCGGGG + Intergenic
1094275031 12:28664747-28664769 CAGGATGAAGAGATGAAGCACGG + Intergenic
1098551598 12:71768216-71768238 CTGGATGTAGTGATTAACCAAGG - Intronic
1098963056 12:76759511-76759533 ATGGATGAATGGATAAAGTGTGG + Intergenic
1098993103 12:77087805-77087827 TGGGCTGAAGGGATAAAGCAAGG - Intergenic
1100558812 12:95726493-95726515 CTTGATGAATGGATAAACTATGG - Intronic
1100750993 12:97698069-97698091 ATGGATGAAGGTGTACAGCAGGG - Intergenic
1101334530 12:103784635-103784657 CTGGAGCCAGGGAGAAAGCAAGG + Intronic
1102070976 12:110019236-110019258 CTTGATGAAGCCAAAAAGCAGGG + Exonic
1102754203 12:115323584-115323606 AGGAAGGAAGGGATAAAGCAAGG + Intergenic
1103022776 12:117549603-117549625 CTGGATGAAAGAAAAAAGAAAGG + Intronic
1103175126 12:118856518-118856540 ATATATGAATGGATAAAGCATGG + Intergenic
1104269782 12:127272704-127272726 CTGTCTGAAGGGCTCAAGCATGG + Intergenic
1104552232 12:129767715-129767737 ATGGATGAATGGATAAAGTGTGG - Intronic
1104711602 12:130990976-130990998 CTGGATTAAGGACTAAAACATGG - Intronic
1104896404 12:132167016-132167038 CTGGGTGAATGGATAATGGATGG - Intergenic
1106490873 13:30220483-30220505 ATGGATGAAGAGAAAAAGAATGG + Intronic
1106697109 13:32187010-32187032 GTGGGTGGAGGGATAAATCAAGG - Intronic
1107818037 13:44261786-44261808 CAGGACCAAGGGATAATGCAAGG - Intergenic
1109245668 13:59952021-59952043 GTGAATGAATGGATAAATCATGG + Intronic
1109512317 13:63394343-63394365 ATGGAGGAAGGGAGGAAGCAAGG + Intergenic
1112428531 13:99327995-99328017 CTGGATGTGGGGAAAGAGCATGG - Intronic
1112829576 13:103432346-103432368 CAGGATAAAGGGAAAATGCAAGG - Intergenic
1112856507 13:103776610-103776632 ATGGATGAATGGATAAAGAGTGG - Intergenic
1112891838 13:104244293-104244315 CTGGATTAAGTAATCAAGCATGG - Intergenic
1114357333 14:21925701-21925723 CTGTAACAAGAGATAAAGCATGG + Intergenic
1117553679 14:56862420-56862442 CAGGATCTAGGGATACAGCAAGG + Intergenic
1118746381 14:68776435-68776457 CTGGATGCTGGGAGACAGCAAGG + Intergenic
1119004921 14:70915952-70915974 AAGGATGAAGGGATAAATCATGG + Intronic
1119199065 14:72739765-72739787 CCAAATGAAGGGATAAAGCAGGG - Intronic
1120851941 14:89179679-89179701 CTCATTGAAGGGCTAAAGCATGG + Intronic
1121467352 14:94124569-94124591 CTGGAGGAAGGGAGCAAGAAGGG - Intergenic
1121594669 14:95151901-95151923 CTGTTTGAAGGGAAAAAGAAAGG - Intronic
1124575125 15:30901438-30901460 ATGGATGAACAGATAAAGCATGG - Intergenic
1125516806 15:40325090-40325112 CTGACTGAAGGGGTCAAGCAAGG + Intergenic
1127173139 15:56324610-56324632 CTGCATGAACGGACAAAGTATGG + Intronic
1127340848 15:58042255-58042277 CTGTATGAAGGGATTTAGGAAGG - Intronic
1127968927 15:63944149-63944171 CTGGATAAAAGGATGAAGCCTGG + Intronic
1128628157 15:69233378-69233400 CTGAATGTAGAGATAAAACAAGG - Intronic
1129048253 15:72756277-72756299 CATGATGGAGGGACAAAGCAAGG - Exonic
1129048493 15:72758091-72758113 CATGATGGAGGGACAAAGCAAGG - Intronic
1129506017 15:76082045-76082067 GAGGATGAAGAGATGAAGCATGG - Intronic
1131639619 15:94277678-94277700 AGGGATGAATGGACAAAGCAGGG + Intronic
1131668914 15:94598801-94598823 ATGGATGAAGAGATAAATGATGG - Intergenic
1131767153 15:95690625-95690647 CTTGAGGGAGGGATAAATCAAGG + Intergenic
1131886436 15:96919516-96919538 ATGGATAAATGGATAAACCATGG - Intergenic
1133120176 16:3601559-3601581 ATGGACGAAAGGATAAACCATGG + Intronic
1134987353 16:18665037-18665059 GTAAATGAAGGGATAAACCAAGG + Intergenic
1134995968 16:18738999-18739021 CTGAGTGAATGGATAAAGGAAGG + Intergenic
1135382071 16:22003768-22003790 TTGGAAGAAGGAATAAAGCAGGG - Intergenic
1136072823 16:27798551-27798573 GGGGATGAAGGGGTAAGGCATGG + Intronic
1136103330 16:28011186-28011208 CAGGATGAAGGAAGAAAGGAAGG + Intronic
1138490850 16:57375685-57375707 CTGGATGAGGTGATAAAGGGAGG - Intronic
1139445842 16:66998130-66998152 CTGGATGATGGGAGAAAGGATGG + Intronic
1140253584 16:73316252-73316274 CTGAATGTAGAGAAAAAGCAGGG + Intergenic
1140339396 16:74142000-74142022 CGGGAGGAAGGGAAAAATCAGGG - Intergenic
1140690432 16:77478317-77478339 CTGGATGTGGGGAGAAAGTAAGG - Intergenic
1140802397 16:78500416-78500438 ATAGATGAAGGGAAAAAGGAAGG - Intronic
1141854881 16:86674058-86674080 TTGGATGAAGGGATGAAGGAAGG - Intergenic
1143185524 17:5007717-5007739 ATGGCTGAAGGGAGAAGGCAGGG - Intronic
1143347574 17:6261225-6261247 GTCGATGGAGGGATAAAGGAAGG - Intergenic
1143352820 17:6301455-6301477 CTGGAGGAAGGAGTAAGGCAGGG + Intergenic
1143695429 17:8612103-8612125 CTGGACGAAGGGATAATTCACGG - Intronic
1143846339 17:9775153-9775175 ATGAATGAAGGCATGAAGCAAGG + Intronic
1144958986 17:19034307-19034329 CGGGAGGAAGGGATGAAGGAAGG - Intronic
1144976173 17:19140217-19140239 CGGGAGGAAGGGATGAAGGAAGG + Intronic
1145865848 17:28241040-28241062 CTGGAAACAGGGATAAAGCCAGG + Intergenic
1146693994 17:34895353-34895375 CTGGATGAGGGGAGAAGGGAAGG + Intergenic
1147688599 17:42301509-42301531 CTGGATGCAAGGACAAAGCGGGG - Intronic
1147775312 17:42896696-42896718 ATGGATAATGGGATAAAGGAAGG - Intergenic
1148549182 17:48540155-48540177 ATGGAGGAAGGCAGAAAGCAAGG + Intergenic
1150168162 17:62965086-62965108 CTGGATGAAGTGCTACAGGATGG + Intergenic
1151604010 17:75124916-75124938 CTGGTGGAAGGGACAGAGCAAGG + Intronic
1153770346 18:8410234-8410256 CTGGTTGAAGTGATACATCATGG - Intergenic
1157442820 18:47723391-47723413 CTGGCTGAAGGGACAAATGAGGG - Intergenic
1157709408 18:49839603-49839625 CTGGATGAAGGGAAAAAGCAGGG - Intronic
1158758722 18:60358083-60358105 TTGGATGAATGAATAAAGAAAGG - Intergenic
1158900403 18:61957139-61957161 CTGGCAGAAGGGAGAAGGCAGGG - Intergenic
1161774361 19:6250856-6250878 ATGGATGAATGGATAAAGTGTGG + Intronic
1161830962 19:6603863-6603885 CTGGCTCATGGGATAAAGAAAGG - Intronic
1162157802 19:8691485-8691507 ATGAAAGAAGGGATAAAGGAAGG - Intergenic
1162211278 19:9094092-9094114 GTAGATGAAGGGATTCAGCATGG - Exonic
1163238486 19:16043634-16043656 ATGGATGAAGGGATGAAGGGAGG + Intergenic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165789805 19:38484471-38484493 ATGGATGAATGAATAAAGGAAGG - Intronic
1167797436 19:51719086-51719108 ATGGATGAAAGAATAAAGAAAGG + Intronic
1168301168 19:55406003-55406025 CTGGTGGAAGGTTTAAAGCAGGG - Intronic
1168330971 19:55568328-55568350 ATGGATGAATGGATAATGGATGG + Intergenic
1168508250 19:56954490-56954512 ATGGATGAATGGATAATGGATGG - Intergenic
925497819 2:4471915-4471937 CTGGATGAGGGGAGACAACAGGG + Intergenic
925882249 2:8362702-8362724 CTGGATGAAGCTGGAAAGCAGGG - Intergenic
926045243 2:9705042-9705064 CAGCAGGTAGGGATAAAGCAAGG + Intergenic
928394176 2:30931445-30931467 GTGGATGAAGGGAGGAAGCAGGG + Intronic
928708495 2:33977999-33978021 CTGAATAAATGGATAAAGAAGGG + Intergenic
929001213 2:37348756-37348778 CTGGATGAAAAGACAAGGCAGGG + Intronic
930669654 2:54135186-54135208 CTGGACAAAGGGATAATTCATGG + Intronic
930714016 2:54575932-54575954 TTGGATGAGTGGTTAAAGCAGGG + Intronic
931132720 2:59355450-59355472 GTGAATGAAGGTATAAAGAATGG - Intergenic
931638243 2:64359836-64359858 CTGGAGAAAGGGATGAAACAGGG - Intergenic
932337210 2:70938172-70938194 GTGGATGAAGGGACACACCAAGG - Intronic
932337386 2:70938844-70938866 CTGGTTGGAGGGATGAAGCCAGG + Intronic
933195969 2:79390475-79390497 CTGGATGAAGTAATCAAGAAAGG - Intronic
933779441 2:85791345-85791367 CTGAATGAATGAATAAAACATGG + Intergenic
934667223 2:96180803-96180825 TTAGATGAAGGCATGAAGCATGG + Intergenic
934897464 2:98131328-98131350 ATGGGTGAATGGATAAAGAAAGG - Intronic
935458041 2:103293274-103293296 CTGGATTAAGGCAAGAAGCAAGG - Intergenic
935717339 2:105950868-105950890 CTGGTTGCAGAGAAAAAGCAAGG - Intergenic
936956995 2:118032447-118032469 ATGGATGAAGGGATAATGGGTGG + Intergenic
937317760 2:120942785-120942807 ATGAATGAATGAATAAAGCAGGG - Intronic
939237271 2:139512219-139512241 ATGGATGAATGGATAGAGGAGGG - Intergenic
939645294 2:144690121-144690143 CTGCATGAAGTGCTATAGCAGGG + Intergenic
941170029 2:162125246-162125268 CTGGGAGAAGGGAGAAAGCAAGG - Intergenic
941472637 2:165907979-165908001 CTGGATGAAAAGTTAAAGAACGG + Intronic
942346758 2:175011360-175011382 CTTGTTGAATGGATAAAGGATGG - Intergenic
946805304 2:223465274-223465296 ATTGATGAATGGATAAAGAATGG - Intergenic
948272936 2:236687897-236687919 TGGGATGAAGGCAGAAAGCAGGG + Intergenic
948461654 2:238132627-238132649 CTGGAGGGAGGGATACAGGAAGG + Exonic
948529720 2:238596775-238596797 CGGGAGGAAGGGAGAAAGCTGGG - Intergenic
1171095472 20:22328652-22328674 CTGTATGAAGGGCTATGGCAAGG - Intergenic
1171227117 20:23451190-23451212 ATGGATGAAGAAATGAAGCAAGG - Intronic
1171940449 20:31323870-31323892 CTGGATATAGGGATTAGGCAGGG - Intergenic
1172276373 20:33681869-33681891 CTGGAGGAAGGCCTTAAGCAGGG - Intronic
1172897051 20:38307548-38307570 CTGGCTGAAGGGAGAAGGCAGGG - Exonic
1174264865 20:49324002-49324024 CTTGGTGATGGGATACAGCAGGG + Intergenic
1175515911 20:59569646-59569668 CTGGATGGATGGATAATGGATGG + Intergenic
1178489177 21:33037151-33037173 CTGGAAGAAGGAATGAAGTAAGG - Intergenic
1178570250 21:33729085-33729107 CAGGATGAAGGGATGAGGCCAGG - Intronic
1178613908 21:34113337-34113359 GTGGATGAATGGATAAAGTATGG + Intronic
1178676388 21:34634997-34635019 CTGGATGAAGGAATACTGCATGG - Intergenic
1179560258 21:42211383-42211405 CTGCTTGAAGGGCTAAGGCATGG + Intronic
1181824848 22:25506855-25506877 CCGGATGTAGGGATACATCAGGG - Intergenic
1182049328 22:27300896-27300918 CTTGATGAAGGGAACAAGAATGG - Intergenic
1182161540 22:28127342-28127364 CTGGGTGCAGGGATAAAGCCTGG + Intronic
1184792481 22:46708619-46708641 GTGGCTGAAGGGAGAAAGGACGG + Intronic
1184979174 22:48084126-48084148 ATGGCTGAAGGGAGCAAGCAAGG - Intergenic
949642776 3:6057772-6057794 ATGGATGCAGGGAGGAAGCAAGG - Intergenic
952453335 3:33451041-33451063 CTGGATGCAGGGAGATAGCCAGG + Intergenic
953076430 3:39574798-39574820 CTGGGTGATGGGATGAGGCATGG + Intergenic
953207505 3:40844638-40844660 ATGGAATAAAGGATAAAGCAAGG - Intergenic
953571067 3:44072431-44072453 CTTGCAGAAGGGAGAAAGCAAGG + Intergenic
953911156 3:46893677-46893699 CTGATCGAAGGGAAAAAGCAGGG - Intronic
955531750 3:59880301-59880323 CTGGATGAAGGGAAGGAGCCAGG - Intronic
955582064 3:60434409-60434431 CAGGATGAAGGAGGAAAGCAGGG - Intronic
957184400 3:76923130-76923152 CTGGATGAAGATATAAATCCTGG - Intronic
957382498 3:79450345-79450367 AGGGATGAAGGGAGAAAGGAAGG + Intronic
959824038 3:110771596-110771618 GTGGATGATTGGATCAAGCAAGG + Intergenic
961828201 3:129609615-129609637 CTGAATGAATGAATAAAGGAAGG + Intergenic
962470659 3:135705228-135705250 GTGGATTAAAGGATGAAGCAGGG + Intergenic
962506607 3:136052508-136052530 CAGGATGAAGGGAGCAAACAAGG - Intronic
964173062 3:153793742-153793764 CAGGAGGAAGAGATAAAGAAGGG - Intergenic
964648342 3:158983363-158983385 ATCCATGAAGGGATAAATCAAGG + Intronic
965905690 3:173702300-173702322 GCGGATGAAGGGATAGAGAAAGG + Intronic
967019025 3:185506345-185506367 GTGAATGAATGGATAAAGAAAGG - Exonic
967188925 3:186968500-186968522 CAGGAAGGAGGGATAAAGCTCGG - Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969909741 4:10432708-10432730 CTAGATGAAGGGAGAAACTAAGG + Intergenic
973344671 4:49041783-49041805 ATAGAGGAAGGGATAAAGAAGGG + Intronic
976504363 4:85830133-85830155 CTGAAAGAAGGAAGAAAGCAAGG - Intronic
977642809 4:99376274-99376296 ATGAATGAATAGATAAAGCAGGG - Intergenic
978662303 4:111141800-111141822 CTGAATGAATGGATAAAGAAAGG - Intergenic
979011698 4:115378611-115378633 GTGGAGGAAGGTACAAAGCAAGG - Intergenic
980060476 4:128123461-128123483 CTGGGTAAAGGGATAGAGAATGG - Intronic
980602872 4:135047572-135047594 CTGTGTGGAGAGATAAAGCATGG - Intergenic
980838390 4:138226455-138226477 CTGGATGCTCAGATAAAGCAGGG - Intronic
981659046 4:147145023-147145045 ATGGCTCAAGGGATAAATCATGG + Intergenic
983304857 4:165973032-165973054 CTGGAAGAAATAATAAAGCACGG - Intronic
983405612 4:167325693-167325715 CTGGATGAAAGTATAAGTCAAGG - Intergenic
983709884 4:170700909-170700931 CTGGAAGAAGGCATACACCATGG - Intergenic
984208642 4:176818034-176818056 CGGAATGAAGAGATAAAGCTGGG - Intergenic
985709258 5:1419117-1419139 ATGGATGAATGGATGATGCATGG - Intronic
985709276 5:1419211-1419233 CTGGATGTATGGATAATGGATGG - Intronic
986832199 5:11592295-11592317 CAGGAGGAAGGGAGAAAGGAAGG - Intronic
990103261 5:52220214-52220236 ATGGATGATTGGATAAAGAAAGG - Intergenic
990365660 5:55067549-55067571 CTGGATGAATAGATAAATCTGGG - Intergenic
990992222 5:61697508-61697530 CTGGATGAAGCGCTACAGCCTGG - Intronic
995193041 5:109339931-109339953 CTGGGAGAAGGGAGAGAGCAAGG + Intronic
997853668 5:137354765-137354787 CTGGGTGCTGGGATACAGCAGGG - Intronic
998325378 5:141275520-141275542 CTGTCAGAAGGGATAAAGGATGG + Intergenic
999267562 5:150276782-150276804 GTGGATGGAGGGATAGAGGAAGG + Intronic
1000652039 5:163830260-163830282 CTGGAGGCAGGGATCAGGCAGGG - Intergenic
1005098444 6:22143884-22143906 GTGGATGAAGGAATCAAGTAGGG - Intergenic
1006737426 6:36284504-36284526 ATGGATGGATGGATAAAGGAAGG - Intronic
1010535467 6:77023569-77023591 CTAGATAAAGGGATAATGAATGG + Intergenic
1012246636 6:96933421-96933443 TTGGATGCAGGGACAAGGCAAGG + Intronic
1014548394 6:122759053-122759075 CTTTATGAAGTTATAAAGCAGGG + Intergenic
1015883366 6:137891706-137891728 ATGGATGATGGGCCAAAGCAGGG - Intergenic
1016662939 6:146602294-146602316 CTGGAGGAAAATATAAAGCAGGG - Intronic
1018697608 6:166402630-166402652 CTGGATGAGGCGACAAAGGAAGG - Intergenic
1020021543 7:4872357-4872379 CGGGAGGAAGGGAGAAAGCAAGG + Intronic
1020631047 7:10640154-10640176 CTGCAAGAAGGGCAAAAGCAAGG + Intergenic
1020723293 7:11776705-11776727 CTGGATAAACTGATAAAACATGG + Intronic
1020882268 7:13777094-13777116 GTGGATGAAGAGATCAATCAGGG + Intergenic
1021338775 7:19437458-19437480 CTAGATGCAGGCATAAAGCTAGG - Intergenic
1025855273 7:65270947-65270969 GGGGAGGAAGGGATAAAACATGG + Intergenic
1027456283 7:78395842-78395864 GTGGATAAAGGAATACAGCATGG + Intronic
1027698374 7:81437713-81437735 GAGGGTGAAGGGTTAAAGCAGGG - Intergenic
1027891623 7:83984460-83984482 CTTGTTCAAGGGATAAAGCATGG + Intronic
1028627983 7:92898691-92898713 CTGGAAAAAGGGATGAAGCCAGG - Intergenic
1029409315 7:100398579-100398601 CTGGGTGAATGGATAGAGAAGGG - Intronic
1029878626 7:103781178-103781200 ATGGCTCATGGGATAAAGCAAGG - Intronic
1029989958 7:104954182-104954204 CTGGCTGATGGGTTGAAGCAAGG - Intergenic
1030066705 7:105665065-105665087 AAGGATCAAGGGATAAACCATGG - Exonic
1032354656 7:131199184-131199206 CTGAATTGAGGGTTAAAGCATGG + Intronic
1032642623 7:133786471-133786493 GTGGATCCAGGGTTAAAGCACGG + Intronic
1033227933 7:139575508-139575530 CTGCATGAGGGAATGAAGCAAGG + Intronic
1034186462 7:149181476-149181498 CTTGATGAAGTGATAAGGAAAGG + Intronic
1034651730 7:152696493-152696515 ATGGATGAGTGGATAAAGCAAGG - Intergenic
1034715132 7:153234972-153234994 CTGGATAAAGGGCTGAAGCCAGG - Intergenic
1035058183 7:156050713-156050735 CTGGAGGATGGGAGAAAGCCGGG + Intergenic
1036005547 8:4658051-4658073 CAGTATGAAGGGAAAAAGAAGGG + Intronic
1036565709 8:9936223-9936245 GTGGATGCATGGATAAACCATGG - Intergenic
1038954485 8:32452228-32452250 CTAGTTGAAGGGATAACACATGG + Intronic
1039457353 8:37716310-37716332 ATGAATGAATGAATAAAGCAAGG + Intergenic
1040415969 8:47196411-47196433 GTGGATGAAAGTATAAGGCAGGG + Intergenic
1040776077 8:51044674-51044696 CTGGATGATGAGATAGAGGATGG - Intergenic
1040793435 8:51261772-51261794 ATGGATGAATGGATAAAGAAAGG + Intergenic
1041433311 8:57808916-57808938 CTGGCTGAGGGAAGAAAGCAGGG - Intergenic
1042275956 8:67005643-67005665 CAGGATGTAGGCATAAAGGAAGG - Intronic
1044775478 8:95682585-95682607 CTCCATGCAGAGATAAAGCAAGG - Intergenic
1046457179 8:114482041-114482063 CAGTGTGAAGGGATAAAACATGG - Intergenic
1047303660 8:123636123-123636145 ATGGATGAAGGGAAGAAACAAGG + Intergenic
1047306885 8:123659628-123659650 CTGGATGAATGGAGAATGGATGG - Intergenic
1047852221 8:128869537-128869559 ATGGATCAAGAAATAAAGCAAGG - Intergenic
1048943543 8:139423878-139423900 CAGGATGAAGGGAAACAGAAGGG - Intergenic
1049832470 8:144710802-144710824 TTGGATGAAGGGATAGAACTGGG + Intergenic
1052389839 9:27866857-27866879 GTGGATCAAGGGATGAAGAAAGG + Intergenic
1052804871 9:33003880-33003902 GTGGATGAATGGATAAAGTATGG - Intronic
1053307214 9:36993557-36993579 CAGGAAGAAGGGACACAGCAGGG + Intronic
1053385336 9:37682696-37682718 CTGGAAGACTGGTTAAAGCATGG - Intronic
1053682302 9:40493696-40493718 CTGGAGTAAGGAATAGAGCAAGG + Intergenic
1054281412 9:63131233-63131255 CTGGAGTAAGGAATAGAGCAAGG - Intergenic
1054393418 9:64633700-64633722 CTGGAGTAAGGAATAGAGCAAGG + Intergenic
1054428068 9:65138914-65138936 CTGGAGTAAGGAATAGAGCAAGG + Intergenic
1054502311 9:65882630-65882652 CTGGAGTAAGGAATAGAGCAAGG - Intronic
1055080089 9:72260134-72260156 CTGGATGGAAGGAAAGAGCATGG + Intergenic
1055269340 9:74539698-74539720 CTGGATAAGGGAATAAAGAATGG + Intronic
1055557206 9:77487164-77487186 CTGGATGAAGGGATGATTCATGG + Intronic
1055913310 9:81375144-81375166 TTGAAAGAAGGAATAAAGCAGGG + Intergenic
1056085475 9:83144774-83144796 ATGGAAGAAGAGATAAACCAGGG + Intergenic
1056621018 9:88214627-88214649 ATGGATGAATGGATAAACTATGG - Intergenic
1057181133 9:93031085-93031107 GTGGATGAAGGGATGATGGATGG + Intronic
1057352529 9:94311476-94311498 GTGGATGAAAGGATAAAATATGG + Intergenic
1057418320 9:94885465-94885487 GTGGCTAAAGGGAAAAAGCATGG + Intronic
1057574551 9:96231785-96231807 CTGGATGGTGGGATAATGCTGGG + Intergenic
1057655113 9:96944597-96944619 GTGGATGAAAGGATAAAATATGG - Intronic
1058997576 9:110315075-110315097 CTGGATGATGGGCAAATGCAGGG - Intronic
1059648511 9:116292156-116292178 GAAGATGGAGGGATAAAGCAGGG + Intronic
1059814463 9:117896326-117896348 ATGGATGAATGGATAAAGAGTGG + Intergenic
1061417522 9:130455169-130455191 ATGGATGAATGGATGATGCATGG - Intronic
1185871699 X:3670099-3670121 CTTGATGAAGGTATAAAACGAGG - Intronic
1186294130 X:8130366-8130388 CTTTATGAAGTGAGAAAGCATGG + Intergenic
1186309898 X:8306531-8306553 CTGGATGAAGAGATTAATCTTGG - Intergenic
1187005414 X:15228308-15228330 CAATATGAAGGGAAAAAGCAAGG + Intergenic
1191133526 X:57040359-57040381 CTGGATGATGAGACAAAGCAGGG + Intergenic
1191869150 X:65730849-65730871 GTGGATGAAGGTACAAAGGAAGG + Intronic
1192176050 X:68886266-68886288 CTGGACAAAGGCAAAAAGCAGGG - Intergenic
1192200389 X:69062849-69062871 CTGGTTGAAGGCAAAAAGCAAGG - Intergenic
1192732439 X:73814727-73814749 CTACATTAAGTGATAAAGCAGGG - Intergenic
1195292633 X:103443944-103443966 ATGGAAGAATGGATGAAGCAGGG - Intergenic
1195640420 X:107168824-107168846 CTGGATAAATGCATAAACCATGG + Intronic
1195761128 X:108247590-108247612 GTGGATGAAGGGAGAAGGGAGGG - Intronic
1195788101 X:108549499-108549521 CTGGACCAAGGAATAAATCAAGG + Intronic
1196131966 X:112166521-112166543 CTAGAGGAAGTGAGAAAGCAGGG + Intergenic
1196143556 X:112292152-112292174 CTGAATAGAGGTATAAAGCATGG - Intergenic
1196234715 X:113265136-113265158 GTGGATGGGGGGATAAAGTAGGG - Intergenic
1196316356 X:114229416-114229438 ATGGATGATGGGATAAATCTGGG + Intergenic
1196593115 X:117511686-117511708 GTTGATGAAGGGACAAAGAAAGG - Intergenic
1196752229 X:119128430-119128452 CTAGGTGAAGGGATGAAGTAGGG - Intronic
1198395678 X:136216670-136216692 CTGGATGAAGAGGGAAATCAGGG + Intronic
1199949093 X:152691656-152691678 TTAGATGGAGGGAGAAAGCATGG - Intergenic
1199960583 X:152776793-152776815 TTAGATGGAGGGAGAAAGCATGG + Intergenic
1200338043 X:155372912-155372934 CTGGAAGAATGCATAAAACAAGG + Intergenic
1200348426 X:155467782-155467804 CTGGAAGAATGCATAAAACAAGG - Intergenic
1200792552 Y:7312610-7312632 ATTGATGAAGGTGTAAAGCAAGG + Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic
1200964829 Y:9026377-9026399 CAGGATGAAGGGAGAAAGTGAGG - Intergenic
1202148271 Y:21822409-21822431 CAGGATGAAGGGAGAAAGTGAGG + Intergenic