ID: 912337591

View in Genome Browser
Species Human (GRCh38)
Location 1:108877078-108877100
Sequence CCGCCCCCGGCAGGTCACGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912337591_912337601 -5 Left 912337591 1:108877078-108877100 CCCACGTGACCTGCCGGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 912337601 1:108877096-108877118 GGCGGGAGCAGGGGGCGCGCCGG 0: 1
1: 1
2: 7
3: 91
4: 851
912337591_912337611 26 Left 912337591 1:108877078-108877100 CCCACGTGACCTGCCGGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 912337611 1:108877127-108877149 GGTGCCCCTGCCTTGGGGAGGGG 0: 1
1: 0
2: 5
3: 40
4: 378
912337591_912337605 19 Left 912337591 1:108877078-108877100 CCCACGTGACCTGCCGGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 912337605 1:108877120-108877142 CTCCTGCGGTGCCCCTGCCTTGG 0: 1
1: 0
2: 3
3: 46
4: 701
912337591_912337610 25 Left 912337591 1:108877078-108877100 CCCACGTGACCTGCCGGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 912337610 1:108877126-108877148 CGGTGCCCCTGCCTTGGGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 229
912337591_912337602 5 Left 912337591 1:108877078-108877100 CCCACGTGACCTGCCGGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 912337602 1:108877106-108877128 GGGGGCGCGCCGGCCTCCTGCGG 0: 1
1: 0
2: 5
3: 17
4: 225
912337591_912337609 24 Left 912337591 1:108877078-108877100 CCCACGTGACCTGCCGGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 912337609 1:108877125-108877147 GCGGTGCCCCTGCCTTGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 224
912337591_912337606 20 Left 912337591 1:108877078-108877100 CCCACGTGACCTGCCGGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 912337606 1:108877121-108877143 TCCTGCGGTGCCCCTGCCTTGGG 0: 1
1: 0
2: 0
3: 16
4: 191
912337591_912337608 21 Left 912337591 1:108877078-108877100 CCCACGTGACCTGCCGGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 912337608 1:108877122-108877144 CCTGCGGTGCCCCTGCCTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912337591 Original CRISPR CCGCCCCCGGCAGGTCACGT GGG (reversed) Exonic
901323834 1:8355567-8355589 TGGCCCCAGGCAGGTCACGGGGG + Exonic
904560920 1:31396788-31396810 CTGCCCCCTGGAGGTCACTTTGG - Intergenic
912337591 1:108877078-108877100 CCGCCCCCGGCAGGTCACGTGGG - Exonic
914506753 1:148296084-148296106 CCAGCCCCGGAAGGACACGTAGG + Intergenic
924710528 1:246527196-246527218 CAGCCCCCTGCAGGGCACGATGG + Intergenic
1067484582 10:46635673-46635695 CTGACGCCGGCCGGTCACGTGGG - Intergenic
1067610176 10:47705973-47705995 CTGACGCCGGCCGGTCACGTGGG + Intergenic
1076789381 10:132768583-132768605 CTGCCCCTGTCAGGACACGTTGG + Intronic
1083048296 11:59755518-59755540 CCGCTTCCGGCAGCTCACCTGGG + Exonic
1083192550 11:61062728-61062750 ACACACCAGGCAGGTCACGTTGG - Intergenic
1083312628 11:61792587-61792609 CCGCCACCGGAAGAACACGTCGG + Exonic
1084657275 11:70526963-70526985 CCGCCCCGCCCAGGTCACCTTGG + Intronic
1085533190 11:77203548-77203570 CTGCCCCCTCCAGGTCACATGGG - Intronic
1089316236 11:117593160-117593182 CCGCCGAGGGCAGGACACGTGGG - Intronic
1089543803 11:119206738-119206760 ACGCCCCCGGCCGGTCACCCCGG - Intronic
1089582892 11:119492573-119492595 CCCGCCCCGGGAGGTCACCTGGG - Intergenic
1096396580 12:51270471-51270493 CCGCCCTCTGCAGGTCCCCTTGG + Exonic
1105748637 13:23400708-23400730 CCGCGCCCGGCCAGTCACTTTGG + Intronic
1127488238 15:59438414-59438436 TCGCCCGCGGCATGTCACATGGG - Intronic
1129221068 15:74131843-74131865 CAGCCCCGGGCAGGTGACTTTGG + Intronic
1132810102 16:1793285-1793307 CCGGCCCAGGCAGGAGACGTTGG - Intronic
1142186322 16:88696399-88696421 CCTCCCCAGGCAGCTCACGCTGG - Intergenic
1142262433 16:89049228-89049250 CAGCCCCCACCAGGTCATGTGGG - Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1144329650 17:14212391-14212413 CAGCCCCCGGCAGCTCACTCCGG + Intergenic
1150604051 17:66675979-66676001 CCGCCCCCGGAACATCACGTGGG + Intronic
1159213195 18:65356680-65356702 CCGACCAAGGCAGGTCAGGTCGG + Intergenic
1160499216 18:79394214-79394236 GCGCGCCCAGCCGGTCACGTGGG - Intergenic
1160613957 18:80109710-80109732 CCGCCCGCCGCCGGTCACGTGGG + Intronic
1162920660 19:13900386-13900408 CCACCCACAGCAGGTCACTTGGG - Intronic
1163026796 19:14517635-14517657 CTGGCCCCGGCAGGGCACGCAGG - Intronic
1163183005 19:15617165-15617187 CAGCCCACGGAAAGTCACGTGGG - Intronic
1165838209 19:38771951-38771973 CAACCCCCGGCTGGACACGTCGG - Exonic
1165841356 19:38790746-38790768 CAACCCCCGGCTGGACACGTCGG + Exonic
1166537485 19:43583830-43583852 CAGCCACCGGCAGGGCACGATGG + Intronic
929787030 2:45000684-45000706 CCGCCCCCGCCGGGGCAAGTGGG + Intergenic
935129046 2:100247663-100247685 CCTCTCCCGGCAGGGCACCTCGG + Intergenic
937903747 2:127041631-127041653 CCACCCCCTGCAGGTCACACGGG + Intergenic
938583864 2:132670472-132670494 CCGCACCCGGCAGGTCCCCACGG - Intronic
942240941 2:173964153-173964175 CCACCCCCGGGAGGGCACGCTGG + Intronic
1172010429 20:31843086-31843108 CCTCCCCCGACAGGTCCCCTGGG - Intergenic
1172664560 20:36590242-36590264 CCTCCCCCGGCTGGGCACGGTGG - Intronic
1180961208 22:19763172-19763194 CAGCCCCAGGCAGGTCAAGGGGG + Intronic
1183401682 22:37608805-37608827 CCGCCCCCCGCAGCTCTCGCGGG - Exonic
950195707 3:11007781-11007803 GAGACCCCGGGAGGTCACGTGGG - Intronic
969444164 4:7234673-7234695 CAGCTCCCAGCAGCTCACGTAGG + Intronic
985552663 5:541383-541405 CCCCCAGGGGCAGGTCACGTGGG + Intergenic
985805172 5:2038505-2038527 CCGCCCCTGGGAGGTCCGGTGGG + Intergenic
1001617773 5:173056653-173056675 CCACCGCCTGCAGGTCACGGGGG + Intronic
1006119569 6:31795750-31795772 CCGCCCCCGCCAGGACCCGCAGG - Exonic
1008046189 6:46853953-46853975 CTGTCCCCGGGAGGTCACGTAGG + Exonic
1020430724 7:8113870-8113892 CCGCCCCCAGCAGCTCCCCTGGG - Exonic
1031361905 7:120857672-120857694 GCGCCCCCGGCAGGGCGCGAGGG + Intronic
1034190329 7:149208729-149208751 CCACACCCGGCAGGGCACGGTGG + Intronic
1034509065 7:151519718-151519740 CTGACGCCGGCCGGTCACGTGGG - Exonic
1035747796 8:1974210-1974232 CCGCCTCCGGGAGGCCGCGTGGG + Intronic
1037534689 8:19813464-19813486 CTGCCCCCTGCTGGTCTCGTTGG - Intergenic
1049509176 8:143019047-143019069 CCGCCCCCGGCATATCACCCCGG + Exonic
1057152784 9:92809240-92809262 CAGCCCCCTGCAGGCCACGCGGG + Intergenic
1057231773 9:93325582-93325604 CCGCCACAGGAGGGTCACGTTGG + Intronic
1192847746 X:74924197-74924219 CCGCGCCCCGCAGCACACGTCGG - Intronic
1193572329 X:83160055-83160077 CAGCCCCAGGCAGGTCCAGTTGG - Intergenic
1197065873 X:122233695-122233717 CCGCGCCCGGCCGATCAAGTGGG - Intergenic
1199724748 X:150568897-150568919 CCGCCGCCGGCCGGCCACCTTGG - Intronic