ID: 912340883

View in Genome Browser
Species Human (GRCh38)
Location 1:108913876-108913898
Sequence TGAGATCTTAAAATAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 432}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912340883 Original CRISPR TGAGATCTTAAAATAGAAAG GGG Intronic
902131093 1:14261181-14261203 TAAGATCTCACAATAGTAAGGGG - Intergenic
902421048 1:16280390-16280412 TGGGATCTTAGAACAGAAAAAGG + Intronic
904866877 1:33586414-33586436 TGAGAACTGGGAATAGAAAGAGG + Intronic
905244016 1:36600008-36600030 TGAGTCCTTAAAAGAGGAAGAGG + Intergenic
905839675 1:41163908-41163930 TAAGATTATAAAGTAGAAAGTGG - Intronic
906168297 1:43704256-43704278 TGAGATTTTCACAGAGAAAGAGG + Exonic
906918496 1:50037738-50037760 TGAGATCTTGGAAAAGAAAAAGG - Intergenic
907691225 1:56668674-56668696 TAATATATTAAAATAGAATGAGG + Intronic
908620477 1:65974320-65974342 TGAGACCTTAATATAGAATCAGG - Intronic
908793982 1:67813044-67813066 TGGGATGTTACAACAGAAAGGGG - Intronic
908952030 1:69571346-69571368 TAAAAGCTTAAAAAAGAAAGTGG - Intronic
909236692 1:73161764-73161786 TGAGATTTTAAAATAAAATAAGG + Intergenic
911665152 1:100543470-100543492 TGAGATGTTAAAATGGAGGGGGG - Intergenic
912171844 1:107110077-107110099 TTAAATCCTAAAATAGAAATAGG + Intergenic
912208632 1:107534831-107534853 TGAGGTCATATAATTGAAAGTGG - Intergenic
912278251 1:108283869-108283891 TGGGATCCTAAAACAAAAAGAGG + Intergenic
912289975 1:108410488-108410510 TGGGATCCTAAAACAAAAAGAGG - Intronic
912340883 1:108913876-108913898 TGAGATCTTAAAATAGAAAGGGG + Intronic
913296644 1:117327978-117328000 TGACATTTTAAAGTGGAAAGTGG - Intergenic
914427754 1:147594055-147594077 TGAGATCTTAAGGTAGATAGAGG + Intronic
914696412 1:150085443-150085465 TAAGTTCTAAAAATAAAAAGTGG - Intronic
916384457 1:164251566-164251588 TGAGATATTGAAATAGACAATGG + Intergenic
916437985 1:164794289-164794311 TTAAATTTTAAAATAGAAATAGG + Intronic
917008599 1:170445170-170445192 TGAGGTCTGAAAATAGTAAAGGG + Intergenic
917428499 1:174940658-174940680 TGAGGTTTTAAAATAGTAAAAGG - Intronic
918249444 1:182688627-182688649 TGAGTCCTTAAAAGTGAAAGAGG + Intergenic
918745893 1:188198840-188198862 TGAGATCTTAAACATGTAAGAGG + Intergenic
921200176 1:212797266-212797288 TGAGAATATAAATTAGAAAGAGG - Intronic
921295147 1:213694330-213694352 TGACCTCTGAAAATAGAGAGAGG - Intergenic
922007358 1:221545327-221545349 TTTTATTTTAAAATAGAAAGGGG + Intergenic
923852277 1:237809594-237809616 TGAGATCTTAGATCAGGAAGGGG + Intronic
923952027 1:238966807-238966829 TAAGATCTTAAAAGAAAAAAAGG - Intergenic
923994330 1:239475566-239475588 TGGGATCTTAGAATAGAAAAAGG + Intronic
924287147 1:242499538-242499560 GGAGATCTTAAAAGAAAAAGGGG - Intronic
1062887304 10:1027184-1027206 TAAACTCTTAAAATAGAAACTGG - Intergenic
1063346839 10:5319456-5319478 TGAGGTCCCAAAGTAGAAAGTGG - Intergenic
1064498062 10:15936851-15936873 TGAGATCCTGGAACAGAAAGGGG - Intergenic
1064807075 10:19147480-19147502 TTAAAGTTTAAAATAGAAAGGGG + Intronic
1065036464 10:21644099-21644121 TGAGATGATAAAATAGGAAAAGG - Intronic
1065423203 10:25570523-25570545 AGAAATTTTAAAATAGAGAGTGG - Intronic
1065508484 10:26454138-26454160 TGGGATCTAAAAATAGAAACAGG + Intronic
1065662193 10:28017409-28017431 TCAGTTCTAAATATAGAAAGTGG - Intergenic
1065790614 10:29256942-29256964 GGAGATAATAAAAGAGAAAGGGG + Intergenic
1065941121 10:30564729-30564751 TAAGATCTTAGCAGAGAAAGGGG + Intergenic
1067985242 10:51136488-51136510 TGGGATCTAAAAATATTAAGTGG + Intronic
1068668524 10:59701033-59701055 TGAGATCTTGACATGGAAAATGG - Intronic
1069199488 10:65594860-65594882 TGGGATCTTAGAACAGAAAACGG + Intergenic
1069332550 10:67310430-67310452 TGAGATATTAAATTTGTAAGAGG + Intronic
1069411368 10:68157107-68157129 TGATATCTTACAATTCAAAGTGG + Intronic
1071850602 10:89565471-89565493 TGAGATTTTGGAACAGAAAGAGG + Intergenic
1072323814 10:94276713-94276735 TGAGAACTTAGAAAATAAAGAGG - Intronic
1072930380 10:99657597-99657619 TGAGAACTGAATATAGAAACTGG + Intergenic
1072992084 10:100206116-100206138 TGAGATCTTAGAACAGAAAAAGG + Intronic
1073899279 10:108201231-108201253 AGAGATCTTAACTTGGAAAGTGG - Intergenic
1076244398 10:128934741-128934763 TGGGATCTCAAAACAGAAAATGG - Intergenic
1076269656 10:129140555-129140577 TGAGATTTTTAAAGACAAAGAGG - Intergenic
1077877831 11:6322463-6322485 CAAGATCTTAAAAAAAAAAGGGG + Intergenic
1079590160 11:22173823-22173845 TGGGATCTTAGAACAGAAATAGG + Intergenic
1079812715 11:25015429-25015451 TTAGATCCTAAAATAGGAAAAGG - Intronic
1080543346 11:33291462-33291484 GGATATCTTAAAATAGACAGGGG + Intronic
1081060914 11:38475788-38475810 TGAGATCCTAAATGAGACAGAGG - Intergenic
1082157495 11:48843413-48843435 TAATATCTTCACATAGAAAGGGG + Intergenic
1082654353 11:55835155-55835177 TGATATAATAAAAGAGAAAGTGG - Intergenic
1083711148 11:64549510-64549532 TGAGTTGTTAAAAGACAAAGTGG + Intergenic
1086128332 11:83373359-83373381 TGGGATCTTGGAATAGAAACAGG - Intergenic
1086240995 11:84691124-84691146 GGAGACCTTAAAAAAGGAAGTGG - Intronic
1086347233 11:85909409-85909431 CAAGAGCATAAAATAGAAAGAGG - Intronic
1087383767 11:97443454-97443476 TGAGTTCTAAACCTAGAAAGAGG - Intergenic
1088058025 11:105609736-105609758 TGAGAAATGAAAATTGAAAGAGG - Intergenic
1088780689 11:113131457-113131479 GAAGAGCTTAAAAGAGAAAGAGG + Intronic
1088833231 11:113555854-113555876 TAATTTCTTAAAATAGAAATGGG - Intergenic
1089161767 11:116443613-116443635 TGAGATCTGAAAATATTAAATGG + Intergenic
1089982045 11:122780618-122780640 TCAGCTCTGAAAAGAGAAAGGGG + Intronic
1090140683 11:124257277-124257299 TGAGATCTTAAAAAAGGAAGAGG - Intergenic
1090641362 11:128731686-128731708 TGAAATCTTAAAATAGGAGACGG - Intronic
1091397068 12:160477-160499 TGAGATCTTTAAGTGGGAAGTGG + Intronic
1091578311 12:1760760-1760782 TGAGATCTGAAAATATTAAATGG + Intronic
1092080270 12:5710266-5710288 TCAGATCTACAAAGAGAAAGAGG + Intronic
1092609744 12:10159611-10159633 TCAAATTTTAAAATAAAAAGGGG + Exonic
1095710364 12:45281767-45281789 TGTTATCTTAAATTTGAAAGTGG + Intronic
1097723398 12:63048295-63048317 TAGGATCTTAAAAAAGAAAAAGG - Intergenic
1098321351 12:69247089-69247111 TGTGATATTAAAATTGTAAGAGG + Intronic
1099108982 12:78532999-78533021 TGAAATCATACATTAGAAAGGGG - Intergenic
1100310186 12:93387446-93387468 TGAGATTATAAAAGAGAAACTGG - Intronic
1100366571 12:93926705-93926727 TGATGTTTTAAAAAAGAAAGAGG + Intergenic
1102692004 12:114768721-114768743 CTAGATTTTAAAACAGAAAGAGG + Intergenic
1102708770 12:114906770-114906792 TGAGATCCTAGAACAGAAAAAGG - Intergenic
1104080855 12:125429513-125429535 TGGGATCCTAGAACAGAAAGAGG - Intronic
1104190280 12:126475512-126475534 TGAGATCCCGAAATAGAAAAAGG + Intergenic
1104365949 12:128177497-128177519 TGAGATCCTAGAAGAGAAAGAGG + Intergenic
1104547846 12:129728466-129728488 TGAGTTCTCAAAAGAGAAAGTGG - Intronic
1105342987 13:19545420-19545442 GGAGAAATTAAAATGGAAAGAGG + Intergenic
1105658738 13:22469894-22469916 TGACATCTTAAAATAAAACTAGG - Intergenic
1105755180 13:23457278-23457300 TGAGTTCTAGGAATAGAAAGAGG + Intergenic
1106160372 13:27195978-27196000 TGAGATCTTAAAATGCAGAAAGG - Intergenic
1106899242 13:34337587-34337609 TAAGATGGAAAAATAGAAAGTGG + Intergenic
1107878939 13:44816289-44816311 TTCGATCCTAAAATACAAAGAGG + Intergenic
1108033063 13:46257048-46257070 TGAGCTCTTAAAAATGGAAGGGG + Intronic
1108281345 13:48865284-48865306 TGAGATGTTAAAATAGGCAGTGG + Intergenic
1109425493 13:62161543-62161565 TGAGAACTCAAAATAAAAAATGG + Intergenic
1110046281 13:70836187-70836209 TGATATTTAAAAATAGTAAGGGG - Intergenic
1110483391 13:76010229-76010251 TGAATTCTAAAAATAGAAAAAGG + Intergenic
1110530497 13:76591882-76591904 TGAGAATTTAAAGGAGAAAGAGG + Intergenic
1111601485 13:90480923-90480945 TGAGAATTTATAATGGAAAGAGG + Intergenic
1111667345 13:91285851-91285873 TGAGATCTTAAAAGCCAAGGAGG + Intergenic
1111776123 13:92664255-92664277 TGAGATATTAGAAAAGAAATTGG + Intronic
1112114556 13:96338012-96338034 TCACATCTAAAAATAGAAAAAGG - Intronic
1112997136 13:105587619-105587641 TGTGTTCCTAAAATAGCAAGGGG - Intergenic
1113135322 13:107082618-107082640 TGAGATATAACAATAGAAAGTGG + Intergenic
1114413253 14:22519816-22519838 AGAGAAATTAAAAGAGAAAGGGG + Intergenic
1114978407 14:28130468-28130490 GGAGAGCTTAAAATACAAAAAGG - Intergenic
1115340139 14:32284938-32284960 AGAGATCAAAAAATACAAAGTGG - Intergenic
1116790789 14:49337650-49337672 AGAGAAATTCAAATAGAAAGTGG + Intergenic
1117005010 14:51412426-51412448 TGAGAGCTCCAAATATAAAGAGG + Intergenic
1118741690 14:68744186-68744208 AAAGTTCTGAAAATAGAAAGTGG - Intergenic
1118882157 14:69838494-69838516 TGAGATCTTACAACAGAAAAAGG - Intergenic
1119122587 14:72092914-72092936 TGGGATCTTGGAATAGAAAAAGG - Intronic
1120122354 14:80696438-80696460 TGAGATATGAAAAGATAAAGGGG + Intronic
1120186425 14:81398139-81398161 TGAGATCTTAGAATCCTAAGTGG - Intronic
1120375682 14:83703948-83703970 TGAGATCTTGGAATAGAAAAAGG + Intergenic
1123803291 15:23844437-23844459 TGTTATCTTTAAATAGACAGAGG + Intergenic
1123812044 15:23937101-23937123 TGGGATCTTGAAATAGAAACTGG - Intergenic
1123962689 15:25422451-25422473 TGAGAACTTAATATAGAAAAAGG + Intronic
1124582782 15:30975996-30976018 TAAGAACATAAAATAGCAAGAGG + Intronic
1124838014 15:33214291-33214313 TGAAACCTTAAAATAGAACACGG - Intergenic
1124870555 15:33537713-33537735 TGAGATGTCAGAACAGAAAGAGG - Intronic
1126302500 15:47213878-47213900 TAATTTCTTAAAATAAAAAGAGG - Intronic
1126453680 15:48838210-48838232 TGAGAGCTGAAACAAGAAAGCGG + Intronic
1126459948 15:48904438-48904460 TGATCTCTTCAACTAGAAAGAGG + Intronic
1127108174 15:55639865-55639887 TAACATTTTAACATAGAAAGTGG + Intronic
1127670381 15:61188911-61188933 TTAGTTCTTAATATTGAAAGTGG - Intronic
1128461999 15:67877243-67877265 TGAATTCTTAATATGGAAAGAGG - Intergenic
1129498078 15:76006266-76006288 TGAGATGTCATAATAGAAACAGG + Intronic
1130753435 15:86737746-86737768 TGTGATCTTGAAATTAAAAGGGG - Intronic
1131810521 15:96168654-96168676 TGAGAACTTACAGAAGAAAGTGG + Intergenic
1133169720 16:3974535-3974557 TGCATTCTTAGAATAGAAAGTGG - Intronic
1133306896 16:4815493-4815515 TGTGATTTTACAATTGAAAGTGG - Intronic
1134143201 16:11740200-11740222 AAAGATCTTAAAACTGAAAGAGG + Intronic
1134877489 16:17714965-17714987 TAAGTTAATAAAATAGAAAGGGG - Intergenic
1135617373 16:23923398-23923420 TGAGATATAACAAGAGAAAGAGG - Intronic
1135643667 16:24142836-24142858 TGGGATCTTAAGATAGAGGGAGG + Intronic
1135933547 16:26759940-26759962 TCAGACCAAAAAATAGAAAGAGG + Intergenic
1136651393 16:31675440-31675462 TGAGATGATAATATAGAATGAGG - Intergenic
1138166178 16:54803742-54803764 TGAGATTTTAAGATAGAAGCAGG - Intergenic
1138777162 16:59736957-59736979 TGAGATCTAAAAACAGAAGATGG - Intronic
1139427619 16:66892828-66892850 TGAGCTCTTTAAATAGAGCGGGG + Intronic
1139489139 16:67277383-67277405 TGAGATCATAAAATGGGAATGGG - Intergenic
1203137541 16_KI270728v1_random:1738516-1738538 TGGGATCTTTAAATAAAATGAGG + Intergenic
1144320671 17:14116242-14116264 TGAGATCTGAAAATATTAAACGG + Intronic
1145170893 17:20655610-20655632 TGAGAGGTGAAAATAGAAATGGG - Intergenic
1146123091 17:30211882-30211904 AGGGACTTTAAAATAGAAAGAGG - Intronic
1146226720 17:31073354-31073376 TAAGATTTTAAAAAAGAAGGGGG + Intergenic
1146786233 17:35724338-35724360 TGAGATTATAATATGGAAAGGGG - Intronic
1148058599 17:44818277-44818299 TAAGATCTTAAAATGTAAAATGG + Intronic
1149454695 17:56778371-56778393 TGACTTTTTAAAAGAGAAAGAGG + Intergenic
1150885620 17:69082405-69082427 TCATACCTTAAAATAGAGAGTGG - Intronic
1150995724 17:70315192-70315214 TGAGTTCTTAAAACTGGAAGAGG - Intergenic
1151266829 17:72962989-72963011 TGAGCCCTTAAAAGAGAGAGTGG - Intronic
1151895735 17:76979624-76979646 TGAAATTTTAAAATAGAAACAGG + Intergenic
1152511402 17:80791924-80791946 TGAGATAGTAAAATGGAAACTGG - Intronic
1154139331 18:11809474-11809496 TGACATGAAAAAATAGAAAGAGG + Intronic
1155556333 18:27023161-27023183 TGAGATCATGAAAAAGAAAATGG + Intronic
1155745028 18:29345397-29345419 TGAGAACTGAAAATAGACATTGG + Intergenic
1157157455 18:45281830-45281852 TGAGAGTGTAAAATAGGAAGGGG + Intronic
1158820728 18:61155793-61155815 TGTGATCTGAAAAGAGATAGAGG - Intergenic
1159018057 18:63118499-63118521 TGGCATCACAAAATAGAAAGAGG + Intergenic
1159826081 18:73212399-73212421 TGAGATCATATAATAGACAGAGG - Intronic
1161389240 19:4012653-4012675 AGAGAACCTAAAATAGAAGGGGG + Intronic
1163086294 19:14982158-14982180 TGAGATCCTAGAAAAGAAAAAGG + Intronic
1163486578 19:17591028-17591050 TGAGGTCTTTTAACAGAAAGGGG + Intergenic
1163910697 19:20188808-20188830 TCAAATCATAAAACAGAAAGTGG - Intronic
1164147689 19:22522195-22522217 TGAGAAATCAAAAAAGAAAGTGG + Intronic
1164158914 19:22613895-22613917 TGAGAAATCAAAAAAGAAAGTGG - Intergenic
1165088146 19:33365703-33365725 TGGGATCCTGAAACAGAAAGAGG - Intergenic
925285093 2:2710479-2710501 TGAGATATTCAAATAGAATTTGG + Intergenic
925479065 2:4250410-4250432 TGTGATATTGAAATAGAAATTGG + Intergenic
925780049 2:7373675-7373697 TGAAAACTTAACAAAGAAAGGGG + Intergenic
926498168 2:13617312-13617334 TGGAATCATAAAACAGAAAGAGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927321001 2:21745687-21745709 AGAGAGGTTAAAATAAAAAGAGG - Intergenic
928294707 2:30072653-30072675 TGAGACCTGAAAAAAGAGAGAGG + Intergenic
928828024 2:35443254-35443276 GGAGATCAGAAAAGAGAAAGAGG + Intergenic
928840952 2:35603863-35603885 TGTGAGCTTAAAATTTAAAGTGG + Intergenic
929016268 2:37499440-37499462 TGAGTTCTAAATATAGAAATGGG + Intergenic
929303089 2:40328544-40328566 TGAGAGCTGAAAATAGAGATTGG - Intronic
929433668 2:41910046-41910068 TGGGATGTTAAAAAAGATAGTGG - Intergenic
931903037 2:66811665-66811687 TGAGATCCTGTAATAGAAAAAGG - Intergenic
934077906 2:88443433-88443455 TGAGATTTTAAAACAAAAAAAGG - Intergenic
934150238 2:89140150-89140172 TGAGATCTTTAAATACTAAAAGG - Intergenic
935080134 2:99784734-99784756 TCATATCCTAAAATAAAAAGTGG - Intronic
935458266 2:103295934-103295956 TGAGATCATAAAAGAGAGAGCGG + Intergenic
936147683 2:109991862-109991884 TGGGATCTTTAAATAAAATGAGG - Intergenic
936197009 2:110379579-110379601 TGGGATCTTTAAATAAAATGAGG + Intergenic
937539504 2:122931248-122931270 TGAGATCTTAACAGTGAAAAAGG + Intergenic
937550989 2:123091556-123091578 TGGGATCCTAGAAAAGAAAGAGG - Intergenic
937731872 2:125242224-125242246 TGAGTTCTGAAAATATTAAGTGG + Intergenic
937786531 2:125905761-125905783 TGAAGTCTTAAAATAGGAATGGG + Intergenic
938372938 2:130784843-130784865 TAAGATCTTGAAACAGAAAAGGG + Intergenic
939492222 2:142890023-142890045 TGAGATGTTATCAGAGAAAGGGG + Intronic
939681288 2:145136996-145137018 TGAGATCTTGAAACAGGAAAAGG + Intergenic
939732526 2:145802320-145802342 AGAGAGCTAAAGATAGAAAGTGG - Intergenic
940611735 2:156001377-156001399 TGAGATTATAAAATAGGAAAAGG + Intergenic
941504488 2:166324898-166324920 TGAGATCTTGAAAGAGAAAAAGG + Intronic
941544270 2:166827873-166827895 TGATATCTTGTAATAGAAAAAGG + Intergenic
942242671 2:173977672-173977694 TTAGATCCTATAATAGAAAAAGG - Intergenic
943179155 2:184521299-184521321 AGAGATCTTAAAAATGGAAGAGG + Intergenic
943430182 2:187790003-187790025 TGAGATCTAAAAAATGAAATCGG + Intergenic
943785657 2:191875691-191875713 TGAGAAACTAAAATAGAGAGAGG - Intergenic
945342190 2:208669448-208669470 TGTGGCCTTAACATAGAAAGGGG + Intronic
945460692 2:210104576-210104598 TGACATATTAAAATAAAAAAAGG + Intronic
945513352 2:210730122-210730144 TGAGTACTTAGAATAGAAAGTGG - Intergenic
946379371 2:219334672-219334694 TAAAATCTTAAAATACAGAGAGG - Intergenic
946719830 2:222592813-222592835 TGAGGTCTGAAAATATTAAGTGG + Intronic
947296051 2:228631799-228631821 TGAGAAGTTAAAATAGGAAAAGG + Intergenic
948170124 2:235894729-235894751 AGAGATCTTAAGATGGAAGGAGG - Intronic
1169562400 20:6816191-6816213 TGATTTCTTTAAATAGATAGTGG - Intergenic
1169943099 20:10958955-10958977 TGAGATATTTAACTACAAAGAGG - Intergenic
1170015464 20:11776340-11776362 TGGGATCTTGAAACAGAAAAAGG + Intergenic
1170391055 20:15874924-15874946 AGAGTTCTTAAAATTGAAAGAGG + Intronic
1170437048 20:16341027-16341049 TGAGTGCTTATAATAGAAGGTGG + Intronic
1171050092 20:21849727-21849749 TGTGGTCTTAAATTGGAAAGTGG + Intergenic
1172376899 20:34450619-34450641 TAATATATTATAATAGAAAGTGG + Intronic
1174861169 20:54092617-54092639 TTAGATCTAAAGATAGAAATAGG - Intergenic
1175580283 20:60093574-60093596 TGAGCTCTGAAAGTAGACAGTGG - Intergenic
1177281342 21:18986742-18986764 AGAGAGCGTAAAATAGAAACTGG - Intergenic
1178329575 21:31676136-31676158 TGAGATCTTTACAGAAAAAGAGG + Intronic
1178560919 21:33639033-33639055 TGAGATCTAAAGATAGATAAAGG + Intronic
1179402221 21:41094855-41094877 TGAGATTTAAATATAGTAAGTGG - Intergenic
1180552358 22:16551060-16551082 TGGGATCTTTAAATAAAATGAGG + Intergenic
1182579161 22:31293869-31293891 TCAGATCCCAAAATAGAAATGGG + Intergenic
1182876668 22:33697759-33697781 TGTGTTCTCAAAATAGAATGTGG - Intronic
1185034407 22:48464229-48464251 TGAGATCCTGGAATAGAATGAGG - Intergenic
949228736 3:1725514-1725536 TGATATCCTAAAATAAATAGGGG + Intergenic
949697876 3:6720290-6720312 TGAGATCCTAGAACAGAAAAAGG + Intergenic
950797402 3:15521200-15521222 GGAGAGCTTAAAAGAGACAGAGG - Intronic
951634831 3:24761982-24762004 TGAGATATTAAAATATTATGGGG - Intergenic
952045136 3:29309914-29309936 TGAGATTTAAAATTAGAAAAGGG + Intronic
953695712 3:45157196-45157218 TGGGATCTTGAAACAGAAAGAGG - Intergenic
954056725 3:48032188-48032210 TGAGATCCTAGAACAGAAAAAGG + Intronic
954908977 3:54087566-54087588 TGAGTTCTTAAAAAATAAAAAGG + Intergenic
955893967 3:63679437-63679459 TGAGGTCTAGAAAGAGAAAGTGG - Intergenic
956053745 3:65276965-65276987 TGAGATCTTGACTTAGCAAGAGG + Intergenic
956293279 3:67684374-67684396 TGAGATCTGCAATTAAAAAGAGG - Intergenic
957230871 3:77512354-77512376 TCAGCTCTCAAAATTGAAAGAGG + Intronic
957298853 3:78364911-78364933 TGAGATGTTAAAGTTGAAATGGG - Intergenic
957303992 3:78432134-78432156 TGTGATTTTAAAATAAAAAGTGG - Intergenic
957834118 3:85563632-85563654 TGAGAACTTAAAAAAGGGAGCGG + Intronic
958698548 3:97557851-97557873 TGAGATATTAAGAAAGAAAAAGG - Intronic
959743699 3:109751551-109751573 TGAGTTCTGAAAATAGATAATGG - Intergenic
959799455 3:110474273-110474295 TGAGAAATCAAAAAAGAAAGGGG - Intergenic
960204425 3:114877993-114878015 TGGTATGTTAAAAGAGAAAGAGG - Intronic
961264022 3:125625768-125625790 AAAGATCACAAAATAGAAAGAGG - Intergenic
962936563 3:140086648-140086670 TGAGCACTTAGAAAAGAAAGTGG - Intronic
963649066 3:147954447-147954469 AGAAATCTGAAAATAAAAAGTGG - Intergenic
964019005 3:151984422-151984444 AGTGATCTTAAAATAGTAAACGG + Intergenic
965076026 3:163977621-163977643 TGGGAATTTAAAAAAGAAAGAGG + Intergenic
965269121 3:166589871-166589893 TGAGATCTTAGGACAGAAAAGGG + Intergenic
965281716 3:166763633-166763655 AAATATCATAAAATAGAAAGTGG - Intergenic
965940385 3:174172433-174172455 TAAGACCTTAAAATATGAAGTGG - Intronic
966606196 3:181823955-181823977 TGAGAGATTAAAATAGTAACAGG - Intergenic
966921133 3:184612138-184612160 TGTGATCTGAAAACTGAAAGAGG - Intronic
967119006 3:186366046-186366068 TGAGATCATAAAATATTAGGTGG - Intergenic
967198735 3:187052265-187052287 TGTGGGCTTCAAATAGAAAGTGG - Intronic
967212730 3:187183011-187183033 TGAGAGTTTAAAATAAAAACGGG - Intergenic
967368498 3:188715457-188715479 TCAGAGCTTATAATAGAAAATGG + Intronic
967666417 3:192178118-192178140 TGAGAGCCTAAGAAAGAAAGAGG - Intronic
969307266 4:6332962-6332984 TGTGATGTTAAAATAAAATGTGG - Intronic
970469707 4:16365082-16365104 TGAGATAATACATTAGAAAGTGG + Intergenic
971413134 4:26396483-26396505 TGAGAACATAAAATAGTATGAGG - Intronic
971504175 4:27348115-27348137 AGACATCTTCAAATAAAAAGTGG + Intergenic
971638593 4:29098442-29098464 TAAGATTCTTAAATAGAAAGGGG + Intergenic
972632017 4:40850348-40850370 TGTCATCTTAAAAAAGAAAGAGG + Intronic
973559193 4:52117420-52117442 GGAGAAATTAAAATACAAAGAGG - Intergenic
974247741 4:59342683-59342705 TGTAATCTTAAAATAGAGTGGGG + Intergenic
974690973 4:65297681-65297703 TGAGGTCTGAAAATATTAAGTGG + Intergenic
975150867 4:71019341-71019363 TGAGAAATTAAAATAAAAGGAGG + Intronic
975328709 4:73089509-73089531 TTAGATCCTACAATAGAAAAAGG + Intronic
975604647 4:76142083-76142105 TGCTATTTTAAAATTGAAAGGGG - Intronic
976913160 4:90334206-90334228 TGAGATGCTATGATAGAAAGGGG + Intronic
978175593 4:105728195-105728217 AAATATCTTAAAATAGATAGTGG + Intronic
978267377 4:106842543-106842565 TGAGATATTATCATAGAAAAAGG + Intergenic
978534909 4:109750666-109750688 TGACATGTTAAAATATAGAGAGG - Intronic
978718735 4:111878389-111878411 TGAAATATTGAAATATAAAGTGG + Intergenic
978751768 4:112257214-112257236 TGAGAGCTGAAACAAGAAAGCGG + Intronic
979509105 4:121531272-121531294 TGAGATCTTATACAACAAAGAGG - Intergenic
979899997 4:126203581-126203603 TGAGATCTAAAACAAGAAGGTGG - Intergenic
980406742 4:132363454-132363476 TGAGTTCTTAGAATAAGAAGAGG + Intergenic
980453741 4:133011769-133011791 TGACATACTAAAATAGAAAATGG - Intergenic
980583083 4:134778777-134778799 TGGCTTCTTAAAATAGCAAGTGG + Intergenic
980704191 4:136471793-136471815 TAATATCTTAAAATAGCAAAAGG - Intergenic
980752744 4:137113280-137113302 TAAGATCTGAAAATAGACAAGGG - Intergenic
980795472 4:137676812-137676834 TGAGATCTTGAAACAGAAACAGG + Intergenic
981404720 4:144354930-144354952 TTAGATCTTAGGATGGAAAGAGG - Intergenic
981483913 4:145264954-145264976 TGTGTTCTAGAAATAGAAAGAGG + Intergenic
981877863 4:149570277-149570299 TTATATATTAAAATGGAAAGTGG - Intergenic
982285607 4:153730630-153730652 CAAATTCTTAAAATAGAAAGAGG - Intronic
982457690 4:155629567-155629589 TGAGATCTCAAAATAGATTTAGG - Intergenic
982544444 4:156715943-156715965 TGAAATTTTATAATAGCAAGAGG + Intergenic
982599422 4:157427551-157427573 TGAGATCCTGAAACAGAAAAAGG - Intergenic
983316692 4:166141911-166141933 TGAGAACATAAAAAAGACAGAGG - Intergenic
983350851 4:166586448-166586470 TGAAATCTTAAGATAGACACTGG - Intergenic
983484232 4:168315418-168315440 TCAGAACTTAAAATAAAAAAAGG - Intronic
983726568 4:170936329-170936351 TGTGTACTAAAAATAGAAAGAGG - Intergenic
984154024 4:176172180-176172202 TAAGATCTAAAAACAGTAAGAGG - Intronic
984513936 4:180714800-180714822 TGAGTAATTAAAAAAGAAAGAGG - Intergenic
985054590 4:186025357-186025379 TGGGATCTTGAAACAGAAACAGG + Intergenic
985382222 4:189406518-189406540 TTAGATGTTGAAATAGAAAGAGG - Intergenic
986619859 5:9660763-9660785 TGAGTTCTTAAAATAGGAAGGGG + Intronic
986864564 5:11971146-11971168 TGAGAGCCCAAAAAAGAAAGAGG + Intergenic
987202214 5:15588893-15588915 TGAGTTTTAAAAAAAGAAAGAGG - Intronic
987989036 5:25186672-25186694 TGGAATCTTAAAAAAGAAATTGG + Intergenic
988500917 5:31783015-31783037 TGGGAACTTAAAATTTAAAGTGG - Intronic
989008194 5:36839138-36839160 TGAGATCATGAATTTGAAAGTGG - Intergenic
989219340 5:38937879-38937901 TGAAATCTTAAAATAATCAGTGG - Intronic
989431842 5:41364586-41364608 TGAGATCTAATAATATAGAGTGG - Intronic
989509731 5:42271503-42271525 TCAGATCTTAAAATAGGAAGAGG + Intergenic
989712772 5:44420457-44420479 TGATCCCTTAAAATAGAATGTGG - Intergenic
989730208 5:44640035-44640057 TGAGATTGTAAAATATAAAATGG - Intergenic
989985448 5:50691500-50691522 TAAAATATTTAAATAGAAAGTGG - Intronic
990375316 5:55164188-55164210 AGTGATCATAAAAAAGAAAGAGG + Exonic
990495651 5:56345240-56345262 TGCGATCTCAAAAAACAAAGTGG + Intergenic
990607444 5:57424448-57424470 TGAGTTCTTACAAAAAAAAGCGG - Intergenic
991531831 5:67624089-67624111 TGTGGTCTGAAGATAGAAAGAGG - Intergenic
992887849 5:81176740-81176762 TGAGAAGTTAAAATAAAAAGTGG - Intronic
993090632 5:83421823-83421845 TGAGATCTGAAAAATGAATGGGG - Intergenic
993186212 5:84624016-84624038 TAATATGTTAAAATATAAAGGGG - Intergenic
993564542 5:89457176-89457198 TTGGATTTTAAAATAGAAAAGGG + Intergenic
993744739 5:91583268-91583290 TGCCTTCTAAAAATAGAAAGGGG + Intergenic
994057582 5:95435964-95435986 TGAGTTCTTATGAAAGAAAGAGG - Intronic
995137618 5:108697001-108697023 ATAGTTCTTAAAATATAAAGTGG + Intergenic
995168135 5:109072239-109072261 TGCGAGCATAGAATAGAAAGAGG - Intronic
996240830 5:121199084-121199106 AGAGATTTTAAAAGAAAAAGGGG + Intergenic
996381859 5:122870587-122870609 GGAGATAATAAAATGGAAAGTGG + Intronic
997031327 5:130132235-130132257 AGAGAGCTTAAAGTTGAAAGTGG - Intronic
997656693 5:135560394-135560416 AGAGATGTTAAAATAGGAAGAGG - Intergenic
998677027 5:144420986-144421008 TGAGATACTAGAATAGAAAGAGG - Intronic
999052737 5:148541240-148541262 AGAACTCTTAATATAGAAAGTGG - Intronic
1000152388 5:158516194-158516216 TGATATTCTAAAATAAAAAGAGG + Intergenic
1003783533 6:9456723-9456745 TGAGATATTAGAATAGCAAAGGG - Intergenic
1004255815 6:14063216-14063238 TGAGATAATATATTAGAAAGAGG - Intergenic
1004444250 6:15683598-15683620 TGAAAGCTTAAAAGAGGAAGTGG + Intergenic
1004787142 6:18981706-18981728 TGAGATCTGAGTATAGATAGAGG + Intergenic
1004793973 6:19060577-19060599 TGGTATCTTAATATGGAAAGTGG - Intergenic
1005057925 6:21747052-21747074 TGAGTTCTTTAATTGGAAAGTGG + Intergenic
1005105313 6:22218465-22218487 TGGGTTCTTAAAAGTGAAAGAGG + Intergenic
1007235403 6:40387772-40387794 AGGGGTATTAAAATAGAAAGAGG + Intergenic
1007510062 6:42367815-42367837 GGAGATCTTAGCACAGAAAGGGG + Intronic
1008209912 6:48708818-48708840 TGAGGTCATAGAATAGAAAGAGG - Intergenic
1008396256 6:51011135-51011157 TGAGATCTCAGAACAGAAAAAGG - Intergenic
1008917209 6:56801203-56801225 TGAGATCCTAAAACAAAAAGAGG - Intronic
1009278981 6:61722477-61722499 TGAGATTATAAAATAGAATCTGG - Intronic
1009754896 6:67924512-67924534 AGAGATCATATAATGGAAAGAGG + Intergenic
1009828535 6:68898967-68898989 TGAGATATTAGAACAGAAAAAGG + Intronic
1010000267 6:70941642-70941664 TGAGCCCTTTAAATAGAAACTGG - Intronic
1010309839 6:74372097-74372119 TGGGATCCTCAAATAGAAAAAGG + Intergenic
1010372370 6:75125702-75125724 AGAGAACTTAAAAAAGAAAGTGG - Intronic
1010579021 6:77571107-77571129 TTATATCTCAAAACAGAAAGAGG + Intergenic
1011562875 6:88640659-88640681 TGAGGTTTTAAAAAAGAATGAGG + Intronic
1012554662 6:100497086-100497108 TGAGATGTTAAAATGAAAAAAGG - Intergenic
1012978486 6:105805343-105805365 TGAGAACCCAAATTAGAAAGTGG + Intergenic
1013235346 6:108193752-108193774 TGAGATTTTAGAACAGAAGGAGG - Intergenic
1013545870 6:111156689-111156711 TGGGATCTTGGAATAGAAAAAGG + Intronic
1015595686 6:134864408-134864430 TCAGATCCTCAAATAGAAAAAGG + Intergenic
1016106355 6:140168325-140168347 TGAGATCATAAAATGGAAACTGG + Intergenic
1017328604 6:153170129-153170151 TGAGATCTGAAAGAAGTAAGGGG - Intergenic
1017364853 6:153623380-153623402 TGAGCTATAAAATTAGAAAGAGG + Intergenic
1017694654 6:157002551-157002573 ATAGATCATAAAATAGAATGAGG - Intronic
1019374361 7:681419-681441 TGAGACATTAAAAAATAAAGTGG + Intronic
1019455899 7:1127442-1127464 TAAGATTTTTAAATAAAAAGAGG + Intronic
1019830193 7:3320289-3320311 TGAGAACTTACAAGAGATAGGGG - Intronic
1020545744 7:9527853-9527875 AACAATCTTAAAATAGAAAGAGG + Intergenic
1020643977 7:10791210-10791232 TGAGATCCAAAAATATTAAGTGG - Intergenic
1021132050 7:16923115-16923137 TGAGATCTCAAAAAAGATAGTGG - Intergenic
1021152696 7:17170696-17170718 TGAGATCTGTACCTAGAAAGAGG + Intergenic
1021568972 7:22045124-22045146 TGGGATCTTGGAATAGAAAAAGG + Intergenic
1023320537 7:38992513-38992535 ACAGATCTTAAAAGACAAAGGGG + Intronic
1023453225 7:40310434-40310456 TGGGATCTTGGAATAGAAAAAGG + Intronic
1023525721 7:41100738-41100760 TGAAATCTAAATATAGAAAATGG - Intergenic
1023708713 7:42969203-42969225 TTAGATCTTGAAACAGAAAAAGG - Intergenic
1024167011 7:46745302-46745324 TGTCTTCTTAAAATTGAAAGTGG + Intronic
1024838417 7:53553375-53553397 TAAAATTTTAAAATAGAAATTGG - Intergenic
1025025941 7:55516090-55516112 TGTGATTTAAAAATAGCAAGTGG - Intronic
1025249135 7:57340197-57340219 TAAAATTTTAAAAAAGAAAGAGG - Intergenic
1027785164 7:82571539-82571561 TAAAATATTAAAATATAAAGAGG + Intergenic
1028974091 7:96892826-96892848 TGAGACCTTACAATTTAAAGTGG + Intergenic
1028975222 7:96905261-96905283 TGAGATCTTGAGAGAGAAAATGG + Intergenic
1030952809 7:115813051-115813073 AAAGATGGTAAAATAGAAAGGGG - Intergenic
1030953085 7:115817073-115817095 TCAGAACTTAAAATAGTAAGAGG - Intergenic
1031094100 7:117398761-117398783 TGAGATATTAGAGTAGAAAGTGG - Intronic
1031397288 7:121288473-121288495 TGATCTCTAAAAATAGAAATAGG + Intronic
1032017354 7:128388595-128388617 TGTGATCCTAAAAGGGAAAGAGG - Intergenic
1033440866 7:141377441-141377463 TGATTTCTTAAAATAGAAGCAGG - Intronic
1035630002 8:1099972-1099994 TGAGATCTGAAAATATTAAATGG + Intergenic
1035651072 8:1265497-1265519 TGAGAAATTAAAAAAGAATGGGG + Intergenic
1036628224 8:10490689-10490711 CAAGATATTAAAATAGAAATTGG + Intergenic
1037251648 8:16902334-16902356 TGAGATATTAAAGGAGGAAGTGG + Intergenic
1037267215 8:17076871-17076893 TCAGATCTGAAAATAGAAGTGGG + Intronic
1038238551 8:25785656-25785678 TGAAATATTAACATAGAATGGGG + Intergenic
1038557493 8:28535454-28535476 TGGGATCTTAGAACAGAAATAGG - Intronic
1038620121 8:29134678-29134700 TGATATTTTAAAGTATAAAGAGG + Intronic
1038944452 8:32342062-32342084 TGACATCATAAAAAATAAAGAGG - Intronic
1039305821 8:36261277-36261299 TGAGATCCTGGAATAGAAAAAGG + Intergenic
1039783315 8:40809669-40809691 TGAAATTTTAATATAGAAATTGG + Intronic
1039866253 8:41505827-41505849 TGAGATCTCAAAATAGGCAGTGG - Intronic
1041057332 8:54000138-54000160 TGAAATTCTAAAATAGAAACAGG - Intronic
1043031641 8:75141186-75141208 TGAGATGCTAAAACAGAAATTGG + Intergenic
1043558087 8:81457404-81457426 TGAGAAATTAAAATTGAAAAGGG - Intergenic
1043645949 8:82518775-82518797 TGAGATCTCATAATAAAATGAGG - Intergenic
1044553487 8:93537299-93537321 TGAGAGATAAAAATAGAGAGAGG + Intergenic
1045014949 8:97992998-97993020 TGGGATCTTACTATAGAGAGTGG + Intronic
1045453584 8:102353564-102353586 TGGGATCTTAGAACAGAAAAAGG + Intronic
1045478361 8:102572687-102572709 TGGGATCTTGAAACAGAAAAGGG + Intergenic
1045726470 8:105179271-105179293 GGTGATCAGAAAATAGAAAGGGG - Intronic
1046241103 8:111494772-111494794 ATATATATTAAAATAGAAAGGGG - Intergenic
1046678012 8:117133980-117134002 TGAAATCTTAAGATAATAAGAGG + Intronic
1046809682 8:118518932-118518954 TGAGCTCCTAAAAGAGAATGTGG + Intronic
1047002970 8:120591385-120591407 TTAGATCTTAACATGGATAGAGG - Intronic
1047020293 8:120768655-120768677 TGAGATGTTGAAAGAGAGAGAGG + Intronic
1048835151 8:138512330-138512352 TGTGATATTAAAGTAAAAAGAGG + Intergenic
1048971608 8:139648078-139648100 TGTGATCATAAAAAGGAAAGAGG + Intronic
1049311737 8:141937218-141937240 TGAGTCCTTAAAGGAGAAAGAGG + Intergenic
1050720794 9:8586780-8586802 CTAGATTTTAAAATATAAAGTGG + Intronic
1050885080 9:10754033-10754055 GTAGATGTTAAAATATAAAGAGG - Intergenic
1051181574 9:14417475-14417497 TGAGATTTTAAAAAATAAACTGG + Intergenic
1051514995 9:17920570-17920592 TGAGATGTCAAAAGAGAACGCGG - Intergenic
1051995515 9:23211598-23211620 TGAGATCTTAAAATGAAAAGAGG - Intergenic
1052150584 9:25110069-25110091 ATACATATTAAAATAGAAAGTGG + Intergenic
1052259823 9:26501383-26501405 AGACATCTGAAAATAGAATGTGG + Intergenic
1055411763 9:76037951-76037973 GGATATCTAAAAATAGGAAGTGG - Intronic
1055560885 9:77520523-77520545 TGCTATCCTAAAATATAAAGGGG - Intronic
1055692485 9:78847237-78847259 TTAGATATTTAAATAAAAAGGGG - Intergenic
1055770994 9:79716978-79717000 AGAGATAATAAAATAGAAAGGGG - Intronic
1055980172 9:81993248-81993270 AGAAATCTTCAAATCGAAAGCGG + Exonic
1056134506 9:83618754-83618776 AGAGATCTTGAATCAGAAAGAGG + Intergenic
1056435475 9:86571659-86571681 TAAGATGTTAACATAGAAAATGG - Intergenic
1057337823 9:94170280-94170302 TAAGATCTTAAATTAGAATTAGG + Intergenic
1057811326 9:98259017-98259039 TGGGATCTTGGAATAGAAAAAGG - Intergenic
1058384291 9:104415519-104415541 AGAGATTTTAAAAAAGAAAAGGG + Intergenic
1058812166 9:108651205-108651227 GGAGAACATAAAATATAAAGTGG + Intergenic
1059510218 9:114838259-114838281 TGAGATCTTGGAACAGAAAAAGG - Intergenic
1059987499 9:119834919-119834941 GGAGTTTTTAAAATAGAGAGGGG - Intergenic
1185971080 X:4664729-4664751 TGAGATCTTAACAGAGAGTGAGG + Intergenic
1186583264 X:10843968-10843990 TGAGATCTTGGAACAGAAAAAGG + Intergenic
1186583327 X:10844823-10844845 TAACATTTTAAAATAGAAAAAGG - Intergenic
1186722201 X:12317014-12317036 TCAGATCTTAAAATGGCAATAGG - Intronic
1186825193 X:13332218-13332240 TGTTTTCTTAAAATATAAAGAGG - Intergenic
1187410259 X:19044997-19045019 TGAGTTCTTAAAAGTGGAAGAGG + Intronic
1187668016 X:21636875-21636897 TCAGATTTTAAAATGGAAAATGG - Intronic
1187686681 X:21822300-21822322 TGAGATATTAATATAAAAAATGG - Intergenic
1189174116 X:38937016-38937038 TTAGATCTTTAAGGAGAAAGTGG + Intergenic
1191658078 X:63621245-63621267 TGGGATCCTAAAACAGAAAAAGG - Intergenic
1191894998 X:65983116-65983138 TTAGTTCTTACAATAGAAACTGG + Intergenic
1192615030 X:72611042-72611064 TGGGATCTTAAGGAAGAAAGTGG - Exonic
1193054778 X:77138248-77138270 GTAGATTTGAAAATAGAAAGAGG + Intergenic
1194015972 X:88622212-88622234 AGAAATATTAAAATAAAAAGTGG + Intergenic
1195169072 X:102248421-102248443 TAAGATCCTAGAATAGAAAAAGG - Intergenic
1195189785 X:102438668-102438690 TAAGATCCTAGAATAGAAAAAGG + Exonic
1195203591 X:102573028-102573050 TGAGATGTGAAACTAGACAGTGG + Intergenic
1195889123 X:109672266-109672288 TGAGATCTTAAAAAAAAAATGGG + Intronic
1196051807 X:111313480-111313502 TAAGATATTAAAAGAGAAGGAGG + Intronic
1196322892 X:114363677-114363699 TGAGATCAGAAAAAAAAAAGTGG + Intergenic
1196921080 X:120585789-120585811 TGAGATCCTAGAACAGAAAAAGG - Intergenic
1196961665 X:121009869-121009891 TCATATCTTAAAACAAAAAGAGG + Intergenic
1198068174 X:133120681-133120703 TGAGATCTTATGATGGTAAGTGG - Intergenic
1198651736 X:138870665-138870687 TGAACTCTTAAAATAAAATGAGG + Intronic
1199363462 X:146949522-146949544 TGGTATTTTAAATTAGAAAGTGG + Intergenic
1199910065 X:152277087-152277109 TGACAGCCTAAAATAGAAAAAGG + Intronic
1200013202 X:153136495-153136517 TGAGATCATATAATTGAATGTGG - Intergenic
1200026400 X:153263428-153263450 TGAGATCATATAATTGAATGTGG + Intergenic
1200140173 X:153897087-153897109 TTACTTCTTAAAATAGAAATAGG + Intronic
1201452827 Y:14134912-14134934 GGAGATATGAAAACAGAAAGAGG - Intergenic
1201458599 Y:14198111-14198133 TGAGATTCTAAAATAGACACAGG - Intergenic
1201792320 Y:17855876-17855898 TGAAGTCTTATAATAAAAAGAGG - Intergenic
1201809234 Y:18050110-18050132 TGAAGTCTTATAATAAAAAGAGG + Intergenic
1202589366 Y:26466298-26466320 GGAGAAATTAAAATGGAAAGAGG - Intergenic