ID: 912350130

View in Genome Browser
Species Human (GRCh38)
Location 1:109004683-109004705
Sequence GTTGATGCACAGAGGCCTAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912350130_912350139 30 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350139 1:109004736-109004758 AAAAACAAAAAGGCAGAGGGGGG 0: 1
1: 1
2: 86
3: 670
4: 4908
912350130_912350135 26 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350135 1:109004732-109004754 GCAAAAAAACAAAAAGGCAGAGG 0: 1
1: 1
2: 52
3: 736
4: 4224
912350130_912350134 20 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350134 1:109004726-109004748 AAACGTGCAAAAAAACAAAAAGG 0: 1
1: 1
2: 3
3: 111
4: 1312
912350130_912350136 27 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350136 1:109004733-109004755 CAAAAAAACAAAAAGGCAGAGGG 0: 1
1: 5
2: 59
3: 836
4: 6715
912350130_912350138 29 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350138 1:109004735-109004757 AAAAAACAAAAAGGCAGAGGGGG 0: 1
1: 7
2: 107
3: 949
4: 6341
912350130_912350137 28 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350137 1:109004734-109004756 AAAAAAACAAAAAGGCAGAGGGG 0: 1
1: 10
2: 166
3: 1694
4: 10247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912350130 Original CRISPR GTTGATGCACAGAGGCCTAT CGG (reversed) Exonic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
910583004 1:88848781-88848803 CATGAGGCACAGAGGCCTCTTGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
915009856 1:152675466-152675488 GTTGAGGCTCTGAGGCCTACCGG + Intronic
917583722 1:176403780-176403802 GTTGATGATCAGATGGCTATTGG + Intergenic
922288445 1:224190006-224190028 GTTGATGAACAGAGGTCGAAAGG - Exonic
1068664333 10:59657285-59657307 GTTGGTCCACAAATGCCTATGGG - Intronic
1074529583 10:114288128-114288150 GGGGATGCAGAGAGGCCTGTGGG - Intronic
1076351196 10:129816200-129816222 CCTGGTGCACAGAGGCCTCTCGG - Intergenic
1076622577 10:131801702-131801724 GTGGATACAGAGAGGCCTATGGG - Intergenic
1091600000 12:1912350-1912372 GTGTCTGCACTGAGGCCTATGGG - Intronic
1105016882 12:132791601-132791623 GTTGTTACACTGAGGACTATAGG + Intronic
1105016929 12:132791932-132791954 GTTGTTACACTGAGGACTATAGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1112663896 13:101545319-101545341 ATAGATGCACACAGGCCCATTGG + Intronic
1115572887 14:34683470-34683492 GTTGATGAACACAGGCTTAGAGG - Intergenic
1125527867 15:40389700-40389722 GTTAATGCACAGATGCCCAAGGG + Intronic
1127054292 15:55115927-55115949 GTGCATGCACAGTGGCCTCTTGG + Intergenic
1128319853 15:66685504-66685526 GGTGAAGCACAGAAGACTATGGG - Exonic
1131377085 15:91934392-91934414 GTAGAAGCACAGAGACCCATGGG + Intronic
1134900377 16:17932644-17932666 GGTGAGGCCCACAGGCCTATAGG - Intergenic
1141874896 16:86817348-86817370 CTTGCTGCACAGGGGCTTATGGG - Intergenic
1146658081 17:34646883-34646905 GTGGATGGAGAGAGGCCTGTCGG + Intergenic
1156047184 18:32889915-32889937 GTTAATGCACAGCTTCCTATTGG + Intergenic
1156864195 18:41870473-41870495 GTGGATGGACACAGGCCAATGGG - Intergenic
1160435682 18:78850659-78850681 TTTGCTGCACAGAGGCTTTTGGG + Intergenic
1160599036 18:79998541-79998563 GGTGATCATCAGAGGCCTATAGG + Intronic
1160602938 18:80028160-80028182 GGTGATCATCAGAGGCCTATAGG + Intronic
1164831563 19:31325457-31325479 GTTGATGCATGGAGGCTTCTGGG + Intronic
1164833574 19:31341373-31341395 GTAGGTGCACAGAGGCCTGATGG + Intronic
1165144075 19:33720551-33720573 GATGGTGGACAGAGGCCAATGGG - Intronic
1167567366 19:50265112-50265134 GTTGCTGCACTGCGGCCTGTGGG + Intronic
926720072 2:15953377-15953399 GTCGAAGCACACAGACCTATTGG + Intergenic
936092820 2:109511972-109511994 GTTGCTGCCCAGAGGACTCTGGG + Intergenic
937102808 2:119284495-119284517 GGTGATCCACTGAGGCCTCTTGG - Intergenic
937588774 2:123589122-123589144 GCTGAAGGACAGAGGCCAATTGG + Intergenic
938692616 2:133806229-133806251 GCTGATGCAAAGATGCTTATGGG - Intergenic
941886661 2:170535143-170535165 GTTCATGAGCAGAGGACTATTGG + Intronic
942955677 2:181770272-181770294 GTTGATGGCAAGAGGCCTTTAGG + Intergenic
947081516 2:226402377-226402399 ATTGAGGCACAGAGGGCTTTAGG - Intergenic
1172612999 20:36265735-36265757 GGTGATGGACAGAGTCCTGTGGG - Intronic
1184724051 22:46332728-46332750 GGTGATACACAGGGGCCTCTTGG + Intronic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
952688573 3:36176911-36176933 GTTTAAGCACAGAGGGCTGTAGG + Intergenic
955887285 3:63614043-63614065 GATGATCCACAGTGGCCTGTGGG - Intronic
957292839 3:78299124-78299146 GGTGATGTACAGAGAACTATGGG - Intergenic
961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG + Intronic
965872299 3:173277314-173277336 GTTGATGCATAGGGTACTATGGG - Intergenic
971054051 4:22892827-22892849 GTAGAAGAACAGAAGCCTATGGG - Intergenic
972698283 4:41469079-41469101 GTGGATGCACAGATGACTCTTGG - Intronic
985033443 4:185814869-185814891 CTTGGTGCACTGAGGCCCATTGG + Intronic
987234694 5:15930886-15930908 GTTGATGCAGAGAGGCCAGAGGG + Intronic
991618153 5:68518063-68518085 GATTCTGCACAGAGGCCTAGGGG + Intergenic
992348257 5:75902466-75902488 GTTGAAGCACAGAAACCTAGAGG - Intergenic
993152890 5:84183299-84183321 GTTGATGCTCTGAGGGGTATAGG - Intronic
997462088 5:134059589-134059611 GCTGATGCTCAGAGGCCTGTGGG - Intergenic
998486989 5:142511580-142511602 GATGAGGCTGAGAGGCCTATGGG + Intergenic
998513346 5:142731946-142731968 GTTGATGCCCAGAGACCCAAAGG - Intergenic
1003501229 6:6704554-6704576 ATTTATGCCCAGAGGCCTCTGGG - Intergenic
1005445808 6:25921397-25921419 ATTGATACACAGAGGCCTGGGGG + Exonic
1011449082 6:87473433-87473455 GTGGATGCTCAGAGGCTTAAAGG + Intronic
1012841876 6:104339279-104339301 GGTGATGGACAGAGGCCTGGAGG - Intergenic
1014186966 6:118445754-118445776 GTTCATGCCCAGGGGCCTGTGGG + Intergenic
1019051372 6:169186229-169186251 GTTCCTGCACGGAGGCCTCTAGG + Intergenic
1021360774 7:19709268-19709290 GTTTTCGCACAGAGGCTTATTGG + Intergenic
1023137466 7:37066523-37066545 TTTGAGGCACAGAGGCCTACTGG - Intronic
1032369849 7:131337662-131337684 GATGATGGAAATAGGCCTATAGG - Intronic
1039119510 8:34130122-34130144 GTAGATTCACAGAGGCCTTGAGG + Intergenic
1045203423 8:100011051-100011073 GTCAATGCATGGAGGCCTATGGG + Intronic
1046450393 8:114383090-114383112 GAAGATGCCCAGAGGCTTATGGG + Intergenic
1051334649 9:16054974-16054996 GTGGATGCAGAGAGGCCAGTTGG + Intronic
1052106094 9:24518522-24518544 TTTGATTCACAAAGGCTTATAGG + Intergenic
1055307490 9:74944662-74944684 AATGATGCACAGAGGTGTATTGG - Intergenic
1055938756 9:81628401-81628423 GTTCATTCCCGGAGGCCTATGGG - Intronic
1057083775 9:92190437-92190459 GTAGATGGACAGCTGCCTATGGG - Intergenic
1060152393 9:121296947-121296969 GTTGATGGCCAGTGGCCTCTGGG + Intronic
1061316737 9:129801098-129801120 CAGGATGCACAGAGGCCTGTGGG - Intergenic
1061344862 9:130015353-130015375 GTTCATATACAGAGACCTATTGG - Intronic
1188612182 X:32114300-32114322 GTTGAGGCACAGAGACAAATTGG - Intronic
1190456781 X:50634998-50635020 GTAGATGCTCAGAGCCCTGTTGG + Exonic
1192947620 X:75983156-75983178 GTTGAAACACAGAGGCCTATGGG + Intergenic
1195164048 X:102199781-102199803 GTTGAAGCACAGAGGTCACTTGG + Intergenic
1195194813 X:102487314-102487336 GTTGAAGCACAGAGGTCACTTGG - Intergenic
1198966572 X:142233458-142233480 GTGGCTGCTCAGAGGTCTATTGG - Intergenic