ID: 912350134

View in Genome Browser
Species Human (GRCh38)
Location 1:109004726-109004748
Sequence AAACGTGCAAAAAAACAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1428
Summary {0: 1, 1: 1, 2: 3, 3: 111, 4: 1312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912350132_912350134 12 Left 912350132 1:109004691-109004713 CCTCTGTGCATCAACAGGTGTAT 0: 1
1: 0
2: 1
3: 19
4: 259
Right 912350134 1:109004726-109004748 AAACGTGCAAAAAAACAAAAAGG 0: 1
1: 1
2: 3
3: 111
4: 1312
912350130_912350134 20 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350134 1:109004726-109004748 AAACGTGCAAAAAAACAAAAAGG 0: 1
1: 1
2: 3
3: 111
4: 1312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912350134 Original CRISPR AAACGTGCAAAAAAACAAAA AGG Intronic
900824478 1:4914886-4914908 AATTGGCCAAAAAAACAAAAAGG + Intergenic
901189191 1:7395232-7395254 CACCATACAAAAAAACAAAATGG - Intronic
901874635 1:12160403-12160425 AAACTTAAAAAAAAAAAAAAAGG + Intergenic
901894571 1:12299900-12299922 AAAAGTTGAAAAAAAAAAAAAGG - Intronic
902231966 1:15033734-15033756 AAACAAACAAACAAACAAAATGG - Intronic
902767464 1:18627010-18627032 AAACCTGAATAGAAACAAAAAGG - Intergenic
902951612 1:19887859-19887881 AAATGTGCAGAAAAAGGAAAAGG - Intronic
903160900 1:21488515-21488537 AAACACACAAACAAACAAAACGG + Intergenic
903430053 1:23289820-23289842 AAACTTGAAAAAAAAAAAAAAGG + Intergenic
903480300 1:23648258-23648280 AAACAAACAAAAAAAGAAAATGG - Intergenic
903983571 1:27207869-27207891 AAAAGTAAAAAAAAAAAAAAAGG - Intergenic
905032094 1:34891992-34892014 AAACATGCAAATAAACAAGAAGG + Intronic
905057458 1:35108250-35108272 AAAGGCACAACAAAACAAAAAGG - Intronic
905068286 1:35202760-35202782 AAAGGTAAAAAAAAAAAAAATGG + Intergenic
905089913 1:35421846-35421868 AAAACTGAAAAAGAACAAAAAGG - Exonic
905517259 1:38570993-38571015 AAAAATGAAAAAAAAGAAAAAGG - Intergenic
905682933 1:39887308-39887330 AGAAGTGAAAAAAAAAAAAAAGG + Intergenic
905905371 1:41614574-41614596 AAAATTGCAAAAAGACAAAAAGG - Intronic
906453977 1:45977497-45977519 AAACAAACAAACAAACAAAAAGG + Intronic
907340714 1:53734060-53734082 TAACTTGAAAAAAAAAAAAAAGG - Exonic
907872887 1:58458823-58458845 AAACAAACAAAAAAAAAAAACGG + Intronic
908146170 1:61247001-61247023 AAACGGTCAAAAAAGTAAAATGG - Intronic
908204793 1:61835387-61835409 AAACAAACAAACAAACAAAAAGG - Intronic
908279521 1:62517294-62517316 AAACAAACAAAAAAACAAACAGG + Intronic
908280201 1:62525535-62525557 AAAAGTTAAAAAAAATAAAAAGG + Intronic
908457424 1:64317752-64317774 AAACAATCAACAAAACAAAAAGG - Intergenic
908628333 1:66073013-66073035 GAATGTACAAAAAAAAAAAAGGG - Intronic
908689152 1:66757776-66757798 ATAGGTGAAAAAAATCAAAAGGG + Intronic
908701910 1:66911365-66911387 AAACCTCCATAAAAACCAAAAGG - Intronic
908831830 1:68186495-68186517 AAAAGTTAAAAAAAAAAAAATGG + Intronic
909047261 1:70725866-70725888 AAAGGTCAAAAAAGACAAAAAGG - Intergenic
909348223 1:74617167-74617189 AAACAAACAAAAAAAAAAAAAGG + Intronic
909397051 1:75181840-75181862 AAGCAAGAAAAAAAACAAAATGG - Intergenic
909677136 1:78251235-78251257 GAGCGTCCAAAAAAAGAAAAAGG - Intergenic
909698912 1:78498712-78498734 AAACAAACAAACAAACAAAATGG + Intronic
909721317 1:78773643-78773665 GAACGGACAAAAAAACACAAAGG - Intergenic
909817896 1:80019649-80019671 AAACCTGCATAAAAATAAAAAGG - Intergenic
911375819 1:97049887-97049909 AAACTTGAAGAGAAACAAAAGGG + Intergenic
911397006 1:97322331-97322353 AAACAAACAAACAAACAAAATGG - Intronic
911542283 1:99172250-99172272 AAACGAGAAAGAAAACAATAAGG - Intergenic
911592323 1:99762477-99762499 AACAGGGCAAAAAAAAAAAAGGG - Intronic
911606170 1:99908208-99908230 TCACATGCAAAAAAAAAAAATGG - Intronic
911894898 1:103420904-103420926 AGATATGCAAAAAAAAAAAAAGG + Intergenic
911958216 1:104264216-104264238 AAACAAACAAATAAACAAAACGG + Intergenic
911965633 1:104366231-104366253 AAACAAACAAACAAACAAAAAGG + Intergenic
912178513 1:107189813-107189835 AAAAGTTAAAAAAAAAAAAAGGG + Intronic
912262973 1:108127448-108127470 AAAGGTGCAAGAAAATTAAAAGG - Intergenic
912350134 1:109004726-109004748 AAACGTGCAAAAAAACAAAAAGG + Intronic
912634595 1:111280126-111280148 AAAGGGGCAGAAAAACAAGATGG - Intergenic
912635902 1:111292538-111292560 AAACATGGAAAAAAAGATAACGG - Intronic
912915159 1:113807341-113807363 AAACAAGCAAACAAACAAAAAGG + Intronic
913044779 1:115064519-115064541 GAACCTGCAAAAGCACAAAATGG - Intronic
913071172 1:115300016-115300038 ACACGTGAAAGAAAACAAAACGG + Intronic
913537553 1:119787673-119787695 AAACTTTCAATAAAACAAAGGGG - Intergenic
914091897 1:144507972-144507994 GAAAGTTCAAAAAAAAAAAAAGG - Intergenic
914306640 1:146425892-146425914 GAAAGTTCAAAAAAAAAAAAAGG + Intergenic
914595409 1:149146908-149146930 GAAAGTTCAAAAAAAAAAAAAGG - Intergenic
914997473 1:152557654-152557676 AAATATGAAAAAAAAAAAAAAGG - Intronic
915550224 1:156628179-156628201 AAACAAACAAACAAACAAAACGG + Intergenic
915599136 1:156911592-156911614 AAAAATGCAAAAGAAAAAAAGGG - Intronic
915690814 1:157688607-157688629 AAATGTTAAAAAAAAAAAAAAGG + Intronic
916205178 1:162309561-162309583 AGACTTGGAAATAAACAAAAAGG + Intronic
916305699 1:163328973-163328995 AAATGTAAAAAAAAAAAAAAAGG + Intronic
916701986 1:167306034-167306056 GACCGTTCAAACAAACAAAAAGG - Intronic
916708486 1:167378704-167378726 AAAAACACAAAAAAACAAAAAGG - Intronic
916897458 1:169179965-169179987 AAAGTTGGAAAAAAAAAAAAAGG + Intronic
917117643 1:171618556-171618578 AAACAAACAAACAAACAAAAAGG - Intergenic
917496284 1:175543154-175543176 AACAGTGAGAAAAAACAAAATGG + Intronic
917565080 1:176205345-176205367 TAACGTACAAAAAAGCAGAAAGG + Intronic
917791968 1:178504734-178504756 AAACAAACAAAAAAAGAAAATGG - Intergenic
917794569 1:178523574-178523596 AAACATGCAGAATAACAATATGG + Intronic
917824719 1:178806136-178806158 AAACTAGCAAACAAAGAAAAAGG - Intronic
917890437 1:179432428-179432450 CAACGTCCCAAAAAAAAAAAAGG - Intronic
918348594 1:183630358-183630380 AAATGTACAACAAATCAAAATGG + Intronic
918385121 1:183998317-183998339 AAATGGGCAAAAATACAAACAGG - Intronic
918426637 1:184417237-184417259 AAAGCTGCATAAAAAGAAAATGG + Intronic
918580056 1:186115853-186115875 AAAAAAGCAAAAAAAAAAAATGG - Intronic
918767735 1:188510554-188510576 AAACTTGCAAGAAAGCAAAGGGG + Intergenic
919017233 1:192054665-192054687 AAACAAACAAAAAAACAAAGAGG - Intergenic
919043530 1:192423434-192423456 AAATGCGGAAAAAAAAAAAAGGG - Intergenic
919173584 1:193990187-193990209 AAAAGTAAAAAAAAAAAAAATGG + Intergenic
919388344 1:196950443-196950465 AAACAAACAAAAAACCAAAAAGG - Intronic
919499727 1:198322667-198322689 AAAGGTAAAAAAAAAAAAAAAGG + Intergenic
919649326 1:200130194-200130216 AATGTTGCAAAAAAGCAAAATGG - Intronic
919659378 1:200229006-200229028 AAACAAACAAACAAACAAAAAGG + Intergenic
919673938 1:200362819-200362841 AAAATTGAAAAAAAACACAAAGG + Intergenic
919834907 1:201566849-201566871 AAAAAAGCAAAAATACAAAATGG - Intergenic
919997289 1:202764645-202764667 AAACAAACAAAAAAACAAATAGG + Intronic
920072138 1:203309814-203309836 AAACAAACAAACAAACAAAACGG - Intergenic
920199974 1:204253860-204253882 AAACAAACAAACAAACAAAAAGG + Intronic
920411693 1:205766572-205766594 AAACAAACAAACAAACAAAAAGG + Intergenic
920568763 1:206999817-206999839 AAACAAACAAAAAAACAAAAAGG + Intergenic
920830269 1:209458291-209458313 AAAACACCAAAAAAACAAAAGGG - Intergenic
921421194 1:214950766-214950788 ATACCTGGAAAAAAACAGAAGGG + Intergenic
921729955 1:218566693-218566715 AAACAAACAAACAAACAAAAAGG + Intergenic
921921421 1:220674434-220674456 AAAAGGGTAAAAAAAAAAAAAGG + Intergenic
922202338 1:223416359-223416381 AAAGGTTAAAAAAAAGAAAAAGG + Intergenic
922357544 1:224790606-224790628 AAACTTAAAAAAAAAAAAAAAGG - Intergenic
922458008 1:225792376-225792398 AAACAAACAAACAAACAAAAAGG - Intergenic
922464235 1:225835703-225835725 AAATGTAAAAAAAAAAAAAAAGG - Intronic
922517588 1:226219877-226219899 AAACAAACAAACAAACAAAAAGG + Intergenic
922910177 1:229209199-229209221 AAAACTACAAAAAAAAAAAATGG + Intergenic
922947116 1:229526090-229526112 AATAGAGCAAGAAAACAAAATGG + Exonic
923184980 1:231562872-231562894 AAACATGCAGAAAAATAGAATGG + Intronic
923379624 1:233403235-233403257 AAAAGAAAAAAAAAACAAAAAGG + Intergenic
923576135 1:235160624-235160646 AAACCATCAAAAAAACGAAACGG - Exonic
923954856 1:239004853-239004875 AAAAGTATAAAAAACCAAAATGG - Intergenic
923959472 1:239060971-239060993 AAATGTCCAAAAAAAAAAAAAGG + Intergenic
924065092 1:240212924-240212946 AAAAACACAAAAAAACAAAAGGG - Intronic
924602819 1:245506538-245506560 AAACAAGCAGAATAACAAAATGG - Intronic
1063169817 10:3498211-3498233 AAATGTGTATGAAAACAAAAAGG + Intergenic
1063572885 10:7232719-7232741 AAACTTGGAAAAATACAAAGAGG - Intronic
1063654984 10:7979356-7979378 AAAAATGAAAAAAAAAAAAAAGG + Intronic
1063691457 10:8291229-8291251 AAACAGTCAAAAAAAAAAAAAGG - Intergenic
1063789657 10:9427988-9428010 AAGCAAGCAAACAAACAAAAAGG - Intergenic
1063823722 10:9869047-9869069 AAATGTGTAACATAACAAAATGG + Intergenic
1063836849 10:10024734-10024756 AAAACTGCAAATAAATAAAATGG + Intergenic
1064061180 10:12138949-12138971 AAACAAACAAACAAACAAAATGG - Intronic
1064130975 10:12709211-12709233 AAAATTAGAAAAAAACAAAAAGG + Intronic
1064251712 10:13711015-13711037 AAACAAACACAAAAACAAAAGGG + Intronic
1064778703 10:18809046-18809068 AAAAGAGAAAAAAAAGAAAAAGG + Intergenic
1064846842 10:19665253-19665275 AAACAAACAAACAAACAAAACGG + Intronic
1065051736 10:21799601-21799623 AAATGTGGAAAAGAAAAAAAAGG - Intronic
1065359183 10:24873236-24873258 AAACAAACAAACAAACAAAATGG + Intronic
1065485204 10:26230422-26230444 AAACAAACAAACAAACAAAAAGG - Intronic
1065717069 10:28581539-28581561 AAACAAACAAACAAACAAAAAGG - Intronic
1066072322 10:31831151-31831173 AAACGTGCAAATAAATAATGGGG + Intronic
1067427193 10:46219299-46219321 AAATGTTCAAAAAAAGATAAAGG - Intergenic
1067821724 10:49536899-49536921 AAACAAACAAAAAAACAGAAGGG + Intronic
1067870042 10:49950517-49950539 AAACTTAAAAAAAAAAAAAAAGG - Intronic
1067947448 10:50698945-50698967 AATCTTCCAACAAAACAAAAAGG + Intergenic
1068383366 10:56289690-56289712 AAAAAAACAAAAAAACAAAAAGG - Intergenic
1068383429 10:56290840-56290862 AAACGATCAAGAAAATAAAAAGG - Intergenic
1068427677 10:56888820-56888842 AAACAAACAAACAAACAAAATGG - Intergenic
1068559833 10:58501676-58501698 AAAAGAGCAAATAAACACAATGG - Intergenic
1068811912 10:61265475-61265497 AAGCCTGCAAAGAAATAAAAAGG + Intergenic
1068884349 10:62083307-62083329 AAAAATGAAAAAAAAAAAAAAGG + Intronic
1069114387 10:64487022-64487044 AAAGGTGTAAAAAACTAAAATGG + Intergenic
1069201464 10:65622594-65622616 AAATGTGCACAAGTACAAAAAGG - Intergenic
1069359729 10:67628243-67628265 TAAACTGCAAAAAAAAAAAAAGG + Intronic
1069380278 10:67836361-67836383 AAAATTGAAAAAAAAAAAAAAGG + Intronic
1069497287 10:68917133-68917155 AAAATTGCAAAGAAAAAAAAAGG - Intronic
1069512111 10:69050334-69050356 AAACAAACAAACAAACAAAAAGG + Intergenic
1069605968 10:69738874-69738896 TAAAGTGTAAAAACACAAAAAGG - Intergenic
1069632685 10:69906703-69906725 AAACAAACAAACAAACAAAAAGG - Intronic
1069952373 10:72027935-72027957 AAACGGGCAAAACATTAAAAGGG + Intergenic
1070078452 10:73161643-73161665 AATCTTCCAAAAAAATAAAAGGG + Intronic
1070303123 10:75219783-75219805 AAATATGGAAAAAAAAAAAAAGG - Intronic
1070437581 10:76408689-76408711 AAACCAGCAGAAAAACAAAAGGG - Intronic
1070498981 10:77052613-77052635 GAGTGTGCAAAAAAAAAAAAAGG + Intronic
1070882761 10:79863932-79863954 AATCTTCCAACAAAACAAAAAGG + Intergenic
1071073758 10:81727312-81727334 TAAAGTGGAAAAAAAAAAAAAGG + Intergenic
1071083914 10:81845789-81845811 AAACAAACAAAAAAACAACAGGG + Intergenic
1071096779 10:81984902-81984924 AACAGTGAAAAAATACAAAACGG + Intronic
1071262406 10:83932701-83932723 AAAAATGAACAAAAACAAAAAGG + Intergenic
1071320153 10:84447011-84447033 AAAACTGGAAACAAACAAAATGG - Intronic
1071461585 10:85902084-85902106 TAATGTGCAAAATAACATAAAGG + Intronic
1071649326 10:87380234-87380256 AATCTTCCAACAAAACAAAAAGG + Intergenic
1071686597 10:87764465-87764487 AAACAAACAAACAAACAAAAAGG + Intronic
1072147745 10:92657579-92657601 AAAAGTGCAATAAAAAAAAGGGG + Intergenic
1072240181 10:93488758-93488780 TAAAGTACAAAAAAACAACAAGG - Intergenic
1072284286 10:93897914-93897936 AACAGTTCAAAATAACAAAATGG + Intronic
1072301007 10:94062275-94062297 AAAAATGAAAAAAAACAAGAAGG - Intronic
1072356157 10:94613290-94613312 AGAGATGCAAAAAAATAAAATGG - Intronic
1072875339 10:99166998-99167020 AAACAAACAAACAAACAAAAAGG - Intronic
1072999262 10:100274251-100274273 AAACAAACAAAAAAACACAAGGG + Intronic
1073168839 10:101483672-101483694 AATTCTGAAAAAAAACAAAAAGG - Intronic
1073930799 10:108573198-108573220 AAACATGCAATATAACAAAATGG + Intergenic
1074167980 10:110902920-110902942 TAACCTGGAAAAAAAAAAAAAGG - Intronic
1074284223 10:112082741-112082763 GAACTTGAAAAAAAAAAAAAAGG - Intergenic
1074439932 10:113469060-113469082 AAAAGTAAAAAAAAAAAAAAGGG + Intergenic
1074553592 10:114468266-114468288 AAACAAACAAACAAACAAAACGG - Intronic
1074631270 10:115257744-115257766 AAACATGGAAAGAAACAAACGGG - Intronic
1074662922 10:115682546-115682568 AAACGAACAAACAAACAAAAAGG + Intronic
1074670704 10:115787473-115787495 AAGCCTGCACAAAAACCAAAAGG - Intronic
1075165893 10:120067922-120067944 AAAAAAGAAAAAAAACAAAAGGG - Intergenic
1075311827 10:121420797-121420819 AAATGTGCAATAAAAAAAACTGG + Intergenic
1075355817 10:121773993-121774015 AAACGTGAAAATGAACTAAATGG + Intronic
1075475038 10:122727082-122727104 AAACAGGAAAAAACACAAAAAGG + Intergenic
1075480371 10:122776024-122776046 AAACATGCTATAAAACACAAAGG + Intergenic
1075694243 10:124421646-124421668 AAACAAACAAACAAACAAAAAGG - Intergenic
1075809544 10:125214942-125214964 AAACAAAAAAAAAAACAAAACGG - Intergenic
1076261889 10:129073280-129073302 AAACATTAAAAAAAAAAAAATGG + Intergenic
1077618132 11:3694069-3694091 AAAAATACAAAAAAAAAAAAAGG + Intronic
1077740911 11:4843964-4843986 AAATGATCAATAAAACAAAAAGG + Intronic
1077945719 11:6895706-6895728 AAACAAACAAACAAACAAAACGG + Intergenic
1078206249 11:9232016-9232038 AAACGGCCAAGAAAAAAAAATGG + Intronic
1078852911 11:15180281-15180303 AAACAAACAAACAAACAAAAAGG + Intronic
1078958436 11:16231994-16232016 AAACATACAAAAAAACAAAAAGG - Intronic
1078976336 11:16482870-16482892 AAACAAACAAACAAACAAAAAGG - Intronic
1079584867 11:22113361-22113383 AAAAGTGAAAAAAAAAACAAAGG + Intergenic
1079781116 11:24607088-24607110 AAACATTCAACAAAATAAAATGG - Intronic
1079893184 11:26083821-26083843 AAACTTAAAAAAAAAAAAAAAGG + Intergenic
1080224845 11:29949288-29949310 AAACATGCAAAAGTAAAAAATGG + Intergenic
1080342191 11:31278215-31278237 TAAAGGGCAAAGAAACAAAATGG - Intronic
1080389530 11:31831959-31831981 AAATATGAAAAAAAAAAAAATGG - Intronic
1080400459 11:31930636-31930658 AAACAAACAAACAAACAAAAAGG - Intronic
1080452327 11:32388716-32388738 AAACGAGCATAAAAAAAGAAGGG + Exonic
1080813122 11:35725868-35725890 GAACATACAAAGAAACAAAAGGG - Intronic
1080964995 11:37204098-37204120 AAAATTGTAAAAAAAAAAAAAGG - Intergenic
1081362524 11:42198170-42198192 AAATATGCAAGAAAATAAAAGGG + Intergenic
1081477066 11:43444071-43444093 AAACGTGTAAAGAAACCCAAAGG + Exonic
1081553810 11:44139119-44139141 ACACACGCAAAAAAAAAAAAAGG - Intronic
1081776402 11:45678645-45678667 AAACATATAAAGAAACAAAACGG - Intergenic
1082038904 11:47668493-47668515 AAACAAACAAAAAAACACAAAGG + Intronic
1082220723 11:49632460-49632482 AAACAAGCAACAAAATAAAAAGG + Intergenic
1082685286 11:56231221-56231243 AAACGTCCAAGAAAAAAAACAGG + Intergenic
1083355588 11:62063796-62063818 AAACAAACAAACAAACAAAAAGG + Intergenic
1083558137 11:63648815-63648837 AAAAAAGCAAAAAAACAAAAAGG + Intronic
1083561199 11:63674551-63674573 AAACAAACAAACAAACAAAACGG + Intergenic
1084783031 11:71423849-71423871 ACACGAGCATAAAAGCAAAAAGG - Intergenic
1085507813 11:77070113-77070135 ACACGTGCAAACAACCAGAATGG - Intronic
1085550674 11:77367979-77368001 AAACAAACAAACAAACAAAAAGG + Intronic
1086060426 11:82694639-82694661 AAACAAACAAACAAACAAAAAGG - Intergenic
1086086788 11:82963646-82963668 AAAGCTGGAAAAAAAAAAAAAGG - Intronic
1086353300 11:85965800-85965822 AAAAAAACAAAAAAACAAAATGG - Intronic
1086370233 11:86149061-86149083 AAACAAACAAACAAACAAAAAGG - Intergenic
1086483715 11:87273865-87273887 AAAAATGCAAATAAACAATAAGG - Intronic
1086628309 11:88986652-88986674 AAACAAGCAACAAAATAAAAAGG - Intronic
1086640121 11:89143527-89143549 AAACAATCAACAAAACAAAAAGG + Intergenic
1086815576 11:91366520-91366542 AAAACAGCAAAGAAACAAAATGG - Intergenic
1087084951 11:94208133-94208155 AAAAGTGCAAGAACACACAATGG + Intergenic
1087172914 11:95068255-95068277 AAATGTGAATAACAACAAAACGG - Exonic
1087291886 11:96329080-96329102 AAACATTAAAAAAAACAAAAAGG - Intronic
1087360230 11:97149336-97149358 AAATGTACGAAGAAACAAAAAGG - Intergenic
1087459483 11:98426946-98426968 AAAAGTGAAAACAAACAAAGGGG + Intergenic
1087502951 11:98982561-98982583 CAACAAGCAGAAAAACAAAATGG + Intergenic
1087601393 11:100320553-100320575 AAACAAACAAAAAAACCAAATGG - Intronic
1087793861 11:102434855-102434877 AAAAGTGCAAGAATACACAATGG - Intronic
1087962693 11:104371851-104371873 AACTGTTCAAAAAAAAAAAAAGG + Intergenic
1088075182 11:105839443-105839465 AAAGGTAAAAAAAAAAAAAAAGG - Intronic
1088256093 11:107904798-107904820 AAACAAACAAACAAACAAAAAGG - Intronic
1088272372 11:108047318-108047340 AAAAAGGCAAAAAAACAAAAAGG + Intronic
1088511206 11:110577465-110577487 TAACATGAAAAAAAAAAAAAAGG + Exonic
1088610244 11:111569651-111569673 GAATGTGCAACAAAACCAAAAGG - Intergenic
1088612053 11:111587265-111587287 AAACAAACAAACAAACAAAAAGG - Intergenic
1088628708 11:111752975-111752997 AAACAAACAAACAAACAAAAAGG + Intronic
1088856273 11:113757492-113757514 AAATAGGCAAAAAAACAAGAAGG + Intronic
1089225735 11:116919894-116919916 AAACATGCAAAGGAAGAAAACGG - Intronic
1089468128 11:118698951-118698973 AAAAGTGAAGAGAAACAAAAAGG - Intergenic
1089686241 11:120148530-120148552 AAAAGTGAAATAAAACAAAAGGG - Intronic
1090887695 11:130893701-130893723 AAACTGGAAAAACAACAAAAAGG + Intronic
1091118191 11:133034750-133034772 ATAAGAGCAAAAAAAAAAAAAGG - Intronic
1091348307 11:134870860-134870882 AAACGCGCTGAAAAAAAAAAAGG - Intergenic
1091348443 11:134872359-134872381 AAACCTGCAAAAAAATTAAAAGG - Intergenic
1091986552 12:4914311-4914333 AAACAAACAAACAAACAAAAAGG + Exonic
1092176238 12:6409581-6409603 AAAATTGCAAAAAAATAAAGAGG - Intergenic
1092199300 12:6570156-6570178 TAAAGTGGAAAAAAAAAAAAAGG - Exonic
1092733120 12:11553150-11553172 AAAAAAGCAAAAAAAAAAAAAGG - Intergenic
1093223484 12:16451600-16451622 AAACCTGTAAAAAACAAAAAAGG + Intronic
1093357885 12:18191549-18191571 AAAGGAGCAAAAGAAGAAAAAGG - Intronic
1093564721 12:20588916-20588938 AAACAAACAAACAAACAAAAAGG - Intronic
1094028765 12:25986915-25986937 AAACAAACAAAAAAAAAAAACGG - Intronic
1094114098 12:26891368-26891390 AAAAGTGCACAAAGACTAAAAGG + Intergenic
1094190352 12:27691568-27691590 AAATATGGATAAAAACAAAAGGG - Intronic
1094303457 12:28992072-28992094 AAACGTTCAAAAGAGGAAAATGG - Intergenic
1094594703 12:31854567-31854589 AAACAAACAAACAAACAAAAAGG - Intergenic
1095171713 12:39043793-39043815 AAAGGAGCAAGAAAACAAGAAGG + Intergenic
1095333082 12:40991837-40991859 AAACAAACAAACAAACAAAAAGG + Intronic
1095355469 12:41267846-41267868 AAACAAACAAACAAACAAAAAGG + Intronic
1095460381 12:42437473-42437495 AAAAGTGAAAAAAGAAAAAAAGG - Intronic
1095637124 12:44447910-44447932 AAAAGAGCAAAGAAAGAAAAAGG + Intergenic
1095670331 12:44852052-44852074 AAACCTGTAAAAATACAAGAGGG - Intronic
1096008909 12:48196688-48196710 AAACTTGCAAAAAAGAAAACTGG + Intergenic
1096551153 12:52372600-52372622 AAATCTGGAGAAAAACAAAATGG + Intergenic
1097091626 12:56510092-56510114 AAACAAACAAACAAACAAAAAGG - Intergenic
1097297048 12:57977821-57977843 AAAATTGCTAAAAAAAAAAAAGG - Intergenic
1097565244 12:61261020-61261042 AAATGTGCAGAAAAACACAAAGG + Intergenic
1097589580 12:61557833-61557855 AAATGATAAAAAAAACAAAAGGG + Intergenic
1098449338 12:70601697-70601719 AAATGAGAAGAAAAACAAAACGG + Intronic
1098460151 12:70723704-70723726 AATCTTTAAAAAAAACAAAAAGG - Intronic
1098671903 12:73241306-73241328 AAATGTTCTAAAAAAAAAAAAGG + Intergenic
1098752044 12:74305906-74305928 AAAGCTGCAGAAAAAAAAAAAGG - Intergenic
1099136975 12:78917614-78917636 AAAATTTCAAAAAAAAAAAAAGG + Intronic
1099519150 12:83638340-83638362 AAACGGACAAAAAATCAAGAAGG - Intergenic
1099651742 12:85437348-85437370 AAATGTCCAAATTAACAAAAGGG + Intergenic
1099732507 12:86523844-86523866 AAATATGAAAAAAGACAAAAAGG - Intronic
1099746448 12:86710208-86710230 GAATGTGCAAAAAAAGAAGAGGG - Intronic
1099809147 12:87558485-87558507 AAACGGAAAAAAAAAAAAAAAGG + Intergenic
1099879053 12:88444349-88444371 AAAAATACAAAAAAAAAAAAAGG + Intergenic
1100063603 12:90611990-90612012 AGAAGTATAAAAAAACAAAAAGG - Intergenic
1100088516 12:90940130-90940152 AAGCCTTCAAAAAAAAAAAAGGG - Intronic
1100163548 12:91890764-91890786 AGATGTGCAAAATAAGAAAAGGG + Intergenic
1100435035 12:94563293-94563315 CAACGGGAAAAAAAAAAAAAAGG + Intergenic
1100883726 12:99046337-99046359 AGACATGCAAAAAAACAGCAAGG + Intronic
1100925711 12:99545884-99545906 AAACATGCAAGAAAATAGAAAGG - Intronic
1101190201 12:102324885-102324907 AAACTTAAAAAAAAAAAAAAAGG - Intergenic
1101339770 12:103832514-103832536 AAAGGAGAAAAAATACAAAAAGG - Intronic
1101503236 12:105323957-105323979 AAAAGTGCAAATAAACACTACGG + Intronic
1102137038 12:110583675-110583697 AAACCTGCAAGAAACCAGAATGG + Intergenic
1102233005 12:111276624-111276646 AAACAAACAAACAAACAAAAAGG - Intronic
1102265363 12:111479537-111479559 AAACAAACAAACAAACAAAAAGG + Intronic
1102542546 12:113632925-113632947 AAAAGGGCAAAAGAGCAAAAGGG + Intergenic
1102673082 12:114636657-114636679 AAACAAACAAAAAGACAAAAGGG + Intergenic
1103119431 12:118368855-118368877 AAAAGTTTAAATAAACAAAAGGG + Intronic
1103289893 12:119836551-119836573 AAATATCCAAAAAAAGAAAAAGG + Intronic
1103369226 12:120405735-120405757 AAACAAGAAATAAAACAAAATGG + Intergenic
1103472445 12:121192697-121192719 AAACCTTCAAAAAGAAAAAAAGG + Intergenic
1103656263 12:122473508-122473530 AAACCAGCAGAAAAACAAAAAGG - Exonic
1104177168 12:126343988-126344010 AAACAAACAAACAAACAAAAAGG + Intergenic
1104322946 12:127769046-127769068 AAACTAACAAACAAACAAAAAGG + Intergenic
1104401168 12:128477555-128477577 AAACAAACAAACAAACAAAATGG - Intronic
1104474802 12:129062387-129062409 AAACTAGAAAAAAAAGAAAAGGG + Intergenic
1104700260 12:130897629-130897651 ACTCGTGTAATAAAACAAAATGG - Intergenic
1104996511 12:132661161-132661183 ATACCTGAAAAAAAAAAAAAAGG + Exonic
1105276139 13:18928706-18928728 AAACATTCAATAAATCAAAAAGG - Intergenic
1105340166 13:19515735-19515757 AAATGTTCAAAACACCAAAAAGG + Intronic
1105569799 13:21591134-21591156 AGACGTGCAAAAACACATACAGG + Intronic
1106171497 13:27292604-27292626 AATCCTGCAAACAAACAAGAAGG + Intergenic
1106291901 13:28371307-28371329 CAACGTGCAAAAATATTAAATGG + Intronic
1106756854 13:32830277-32830299 AAACTCGCAACCAAACAAAAGGG + Intergenic
1107135255 13:36937785-36937807 AAACTGCCAAAAAACCAAAAAGG - Intergenic
1107235711 13:38167463-38167485 AAAAGTACAAAATAACCAAATGG + Intergenic
1107672958 13:42765453-42765475 AAACTGGAAAAAAAAAAAAAAGG + Intergenic
1108183607 13:47866497-47866519 AAAAGGGGAAATAAACAAAATGG + Intergenic
1108298418 13:49049441-49049463 AAAACTGCAAACAAAAAAAAAGG - Intronic
1108874035 13:55023801-55023823 AAACGAGCAAAAATACTAAATGG + Intergenic
1109160846 13:58972011-58972033 AAACAAACCAAAAAACAAAAAGG + Intergenic
1109693425 13:65923258-65923280 AGACCTGAAAAAAAAAAAAAAGG + Intergenic
1109746635 13:66631884-66631906 AAACAAACAAACAAACAAAAAGG - Intronic
1109760215 13:66818257-66818279 AAATGTGTAAAAAAATAAGAAGG + Intronic
1109775333 13:67033406-67033428 TAAGGTACAAAAAGACAAAAGGG + Intronic
1110126581 13:71950731-71950753 AAACAAACAAACAAACAAAAAGG + Intergenic
1110134360 13:72047197-72047219 TTATCTGCAAAAAAACAAAAAGG - Intergenic
1110142929 13:72153382-72153404 AGAATTGCAAAAAAAAAAAAAGG - Intergenic
1110624868 13:77642481-77642503 AAACAAACAAAAAAACACAAAGG - Intronic
1110656012 13:78000587-78000609 TCACGTGCAAAGACACAAAAAGG + Intergenic
1110667160 13:78130824-78130846 ACACGTGCGAAGAAACAAAAAGG - Intergenic
1110701668 13:78555643-78555665 AAACAACCAAAAAAAAAAAAAGG - Intergenic
1110838640 13:80114888-80114910 AAAAGTGAAAATAAACAAATGGG - Intergenic
1110859796 13:80335704-80335726 TAATCTGCAAAAAAAAAAAAGGG + Intergenic
1110873245 13:80477770-80477792 AAGCATGCAAAAAAATAAAAGGG - Intergenic
1111139734 13:84100389-84100411 AAATGTGCTAAACAACACAAAGG + Intergenic
1111259380 13:85716182-85716204 AAACAGGCAAAAAAAAAAAAAGG + Intergenic
1111435305 13:88198936-88198958 AAAAAAGAAAAAAAACAAAATGG - Intergenic
1111654433 13:91134249-91134271 AAACTAGAAAAAAAAAAAAAAGG - Intergenic
1111668367 13:91298438-91298460 AAATGTACAAAAAAACAAAAAGG + Intergenic
1111866188 13:93771567-93771589 AAATGAGGAAACAAACAAAAGGG - Intronic
1111971817 13:94924734-94924756 AAACTTCAAAAAAAAAAAAAAGG + Intergenic
1112032139 13:95467036-95467058 AAAAATACAAAAAAAAAAAACGG - Intronic
1112185249 13:97121866-97121888 AAACAAACAAACAAACAAAAAGG + Intergenic
1112309517 13:98305860-98305882 GAAAGTGCAAGAAAAAAAAAAGG - Intronic
1112398475 13:99055221-99055243 AAAAGTTCCAAAAAACAGAATGG + Intronic
1112603541 13:100880677-100880699 AAACAGGGAAAAAAATAAAAAGG + Intergenic
1112618529 13:101030904-101030926 AAAGGATCAATAAAACAAAAAGG - Intergenic
1112881591 13:104113164-104113186 AATACTGCAAAAAAAAAAAAAGG + Intergenic
1112965977 13:105194488-105194510 AAACAAACAAACAAACAAAATGG + Intergenic
1113228703 13:108188647-108188669 AAAAGTGGCAAAAAAGAAAAAGG + Intergenic
1113432005 13:110259138-110259160 AAATGTGCAAATTAACAAGATGG - Intronic
1113988279 13:114336984-114337006 AAAAGTTAAAAAAAAAAAAAAGG + Intergenic
1114106859 14:19436207-19436229 ACAAGTGCAAAAAAAAAAAAAGG + Intergenic
1114593224 14:23888766-23888788 AAAAGAACAATAAAACAAAAAGG + Intergenic
1114726028 14:24938588-24938610 AAACCAGGAAAAAAAAAAAAAGG + Intronic
1115084717 14:29500273-29500295 ACACGTGTAAATAAACAGAATGG + Intergenic
1115560460 14:34578213-34578235 AAACAAACAAAAATACAAAAGGG + Intronic
1115631556 14:35250848-35250870 AAACGAAAAAAAAAATAAAATGG - Intronic
1115766984 14:36633015-36633037 ACAAGTGCTAAAAAAAAAAAGGG - Intergenic
1115906155 14:38205438-38205460 AAACAAACAAACAAACAAAAAGG - Intergenic
1116265227 14:42679761-42679783 GCACCTGCAACAAAACAAAATGG + Intergenic
1116292198 14:43058311-43058333 AAACAAACAAAAAAAAAAAAAGG - Intergenic
1116361180 14:44000348-44000370 AAAAGAGAAAAGAAACAAAAAGG + Intergenic
1116761562 14:49021666-49021688 AAATGTGAATAAAAAGAAAAGGG + Intergenic
1116770200 14:49118569-49118591 AAAACTTCAAAAAAAGAAAAGGG + Intergenic
1117173207 14:53121916-53121938 GAACGTTAAAAAAAAAAAAAGGG + Intronic
1117187779 14:53259311-53259333 AGACGGGAAAAAAAAAAAAAAGG - Intergenic
1117301618 14:54435244-54435266 AAAAATACAAAAAAACAAACTGG + Intronic
1117345677 14:54829742-54829764 ATACATGGAACAAAACAAAAAGG - Intergenic
1117552314 14:56848542-56848564 AGAAGAGGAAAAAAACAAAAAGG + Intergenic
1117626226 14:57641561-57641583 AAACCTCCAAAACCACAAAATGG + Intronic
1117655699 14:57953660-57953682 AAAGATCCAAAAAGACAAAAAGG + Intronic
1117793920 14:59371724-59371746 AAACATGCCTCAAAACAAAAAGG - Intergenic
1117965634 14:61204404-61204426 AAAAGTATAAAAATACAAAAGGG + Intronic
1118261321 14:64249722-64249744 AAACCATCAAAAAAACAATAAGG + Intronic
1118374856 14:65167802-65167824 AAACGAGTAAATAAACAAAAGGG - Intergenic
1118379359 14:65204999-65205021 ACTCCTGCAAAAAAAGAAAAGGG + Intergenic
1118513342 14:66500635-66500657 AAACAAGAAAAAAAAAAAAAAGG - Intergenic
1118597883 14:67450068-67450090 AAACAAACAAACAAACAAAACGG + Intronic
1118599345 14:67460705-67460727 AAACAAACAAACAAACAAAAAGG + Intronic
1118827463 14:69397446-69397468 AAACAGGAAAAAAAAAAAAAAGG + Intronic
1118860523 14:69659502-69659524 AAACAAACAAACAAACAAAAAGG - Intronic
1119099207 14:71864567-71864589 AAAGGCAGAAAAAAACAAAAGGG + Intergenic
1119303471 14:73589327-73589349 AAACTTTCAAAAAAAGGAAAGGG - Intergenic
1119783109 14:77291609-77291631 AAAGATACAAAGAAACAAAAAGG - Intronic
1119922948 14:78463542-78463564 AAAAGTCAAAAAAAACAACAAGG - Intronic
1120207817 14:81604947-81604969 AAACTTGGAAATAAACAAAAGGG + Intergenic
1120542533 14:85767746-85767768 AAAAGGGCAAAAAAAAAAAATGG - Intergenic
1120784759 14:88522946-88522968 AGACGAGCCAAAAAAAAAAATGG - Intronic
1120822334 14:88923805-88923827 AAACAAACAAACAAACAAAATGG - Intergenic
1120898239 14:89553444-89553466 GAAAGTGAAAAAAAAAAAAAGGG + Intronic
1120927664 14:89814086-89814108 CAAAGTGGAAAAAAAAAAAAAGG - Intronic
1121326473 14:93023020-93023042 AAACAAGCAAAAACAGAAAAGGG - Intronic
1121401665 14:93684012-93684034 AAACAAACAAAAAAACAAATAGG - Intronic
1121613304 14:95295634-95295656 AAACATACACAAAAACAAAGGGG + Intronic
1121922643 14:97897121-97897143 AGACATCCAAAAAAAGAAAAGGG - Intergenic
1122622505 14:103067869-103067891 AAGGCTGTAAAAAAACAAAAAGG + Intergenic
1122665099 14:103324187-103324209 AAACAAACAAAAAAACAAACGGG + Intergenic
1122685945 14:103506483-103506505 AAACAAACAAACAAACAAAAAGG - Intergenic
1122995255 14:105260268-105260290 AAATGTGCCAAAAAATAAGATGG + Intronic
1123203137 14:106686258-106686280 AAACAAACAAACAAACAAAAAGG + Intergenic
1202870214 14_GL000225v1_random:155975-155997 AAAAAAGCAAAAAAAAAAAAAGG - Intergenic
1123446740 15:20336427-20336449 AAACAAACAAACAAACAAAAAGG - Intergenic
1123997154 15:25726890-25726912 AAAAATACAAAAAAAAAAAAAGG + Intronic
1124171707 15:27380077-27380099 AAATGTAGAGAAAAACAAAAGGG - Intronic
1124193478 15:27600294-27600316 AAACAAAAAAAAAAACAAAAAGG + Intergenic
1124416564 15:29477410-29477432 AAAAGTGCAAAAAAAAATAAGGG + Intronic
1124501413 15:30230287-30230309 AAATGCTCAAAAAAGCAAAAAGG + Intergenic
1124505303 15:30267395-30267417 AAACAAACAAACAAACAAAAAGG + Intergenic
1124516696 15:30372443-30372465 CAAAGTGCTAAAAAAAAAAAAGG + Intronic
1124627852 15:31319356-31319378 AAACAAACAAACAAACAAAAAGG + Intergenic
1124726222 15:32158288-32158310 CAAAGTGCTAAAAAAAAAAAAGG - Intronic
1124738249 15:32271236-32271258 AAACAAACAAACAAACAAAAAGG - Intergenic
1124742155 15:32308380-32308402 AAATGCTCAAAAAAGCAAAAAGG - Intergenic
1124842559 15:33257208-33257230 AAACTTACAAAAAAAAAGAAAGG + Intergenic
1124896461 15:33781839-33781861 AAATTAGCAAAAAAAAAAAAAGG + Intronic
1124897476 15:33790291-33790313 AAACAAACAAACAAACAAAAGGG - Intronic
1125091573 15:35799018-35799040 AAAGCTGGAAAAAAAAAAAAAGG - Intergenic
1125334599 15:38615057-38615079 AAACAAACAAACAAACAAAACGG - Intergenic
1125338477 15:38651657-38651679 AAGCGTGCAAAAGCAGAAAAGGG + Intergenic
1125800927 15:42446197-42446219 AAATGTCCAAAAAAAGTAAATGG + Intronic
1125912162 15:43450637-43450659 AAACCTGTAAAAAAGCAAGATGG - Intronic
1126350188 15:47738032-47738054 AAACTTAAAAAAAAAAAAAAGGG + Intronic
1126385587 15:48090084-48090106 AAACCTGCAGAAAAAGAAATTGG + Intergenic
1126429791 15:48570463-48570485 AAACTTTGAAAAAAAAAAAAGGG + Intronic
1126447660 15:48766786-48766808 TAAAGGGCAAAAAAAAAAAAAGG - Intronic
1126665831 15:51075741-51075763 AAATGTGCAAAACAATAAAATGG + Intronic
1126790895 15:52220343-52220365 AAACATACAAAAAAATAAACAGG - Intronic
1126886930 15:53160564-53160586 AAATGAGAAAAAAAAAAAAAGGG + Intergenic
1126979277 15:54223359-54223381 AAATGTGCCAAAAAACACATTGG - Intronic
1127185643 15:56477086-56477108 AAACCTGAAAAAAAAAGAAATGG - Intergenic
1127200283 15:56639281-56639303 AAATGAGCTAAAAAAAAAAAAGG + Intronic
1127299667 15:57640408-57640430 TAACCTGCAAAGAAAAAAAAAGG + Intronic
1127314307 15:57780006-57780028 AAACAAACAAACAAACAAAATGG + Intronic
1127322398 15:57859663-57859685 AAACATGCAAAAAATTTAAAAGG + Intergenic
1127485155 15:59411988-59412010 AAACAAACAAAAAAAAAAAACGG + Intronic
1127533044 15:59863916-59863938 AAACTAGCAAACAAACAAAAAGG + Intergenic
1128008397 15:64267489-64267511 AAATGGGCAAAAAACCAAAATGG + Intronic
1128055287 15:64694788-64694810 AAACAAACAAAAAAACAGAAAGG + Intronic
1128165623 15:65461901-65461923 AAACTTTAAAAAAAAAAAAACGG - Intronic
1128586569 15:68857056-68857078 AAACAAACAAAAAAATAAAATGG - Intronic
1128697488 15:69779538-69779560 ACTTGTGCAAGAAAACAAAATGG + Intergenic
1128865195 15:71109725-71109747 AAAAGAGAAAAAAAAAAAAAAGG + Intronic
1128946415 15:71825506-71825528 AAAGCTGCCAAAAAATAAAAAGG - Exonic
1128960254 15:71995554-71995576 AAATTTACAAAAAAAAAAAAAGG + Intronic
1129324252 15:74791688-74791710 AAAAGAGCAAAACAAAAAAAGGG - Intronic
1129494622 15:75966790-75966812 AAATGTTCAAGAAAACAACATGG + Intronic
1130384647 15:83400491-83400513 AAACAAACAAAAAAACAAAAAGG + Intergenic
1130434854 15:83887615-83887637 AAACAAACAAACAAACAAAAAGG - Intronic
1130793417 15:87181184-87181206 AAAAGTGCAAATAAATAAATGGG - Intergenic
1130977950 15:88791663-88791685 AAACAAACAAAAAACCAAAAAGG + Intergenic
1131008783 15:89000273-89000295 AAACAAACAAACAAACAAAAAGG - Intergenic
1131192743 15:90330257-90330279 AAACATTCAAAAAAAAAAAGTGG + Intergenic
1131605436 15:93898944-93898966 AAACAAACAAACAAACAAAAAGG - Intergenic
1131852390 15:96556851-96556873 AAAAGAGAAAAAAAAGAAAATGG - Intergenic
1131932309 15:97456825-97456847 AAAGGTGAGAAAATACAAAAAGG + Intergenic
1132034143 15:98466370-98466392 AAACTTGAAAACAAATAAAAAGG + Intronic
1133083283 16:3340896-3340918 AATCTTGAAAAAAAACAAAGTGG - Intergenic
1133228692 16:4355767-4355789 AAACAAACAAACAAACAAAAAGG - Intronic
1133517836 16:6527145-6527167 AAACATTCAAAAATATAAAAAGG + Intronic
1133573667 16:7066773-7066795 AAAAGTGAAAGAAAACACAAAGG + Intronic
1133670333 16:8012593-8012615 AAAAGTGCAAAAATAAAAACTGG + Intergenic
1134356633 16:13488240-13488262 CAAAATGCAAAAAAAAAAAAAGG + Intergenic
1134788840 16:16969963-16969985 AAACAAACAAACAAACAAAAAGG + Intergenic
1134892066 16:17849958-17849980 AAACGTGCAAAAAAGTTGAAAGG + Intergenic
1135353654 16:21751524-21751546 AAACGAAAAAAAAAAAAAAAAGG + Intronic
1135692319 16:24550590-24550612 ACACATGCTAATAAACAAAAAGG - Intronic
1135730970 16:24894807-24894829 AAACAAACAAACAAACAAAAAGG + Intronic
1135731477 16:24898509-24898531 AAAAATGCAAAAAAAAAAAAAGG - Intronic
1135808652 16:25567501-25567523 TAAGGTGCTAAAAAAAAAAAGGG + Intergenic
1136095126 16:27949934-27949956 AAACAAACAAACAAACAAAAAGG + Intronic
1136343476 16:29660654-29660676 AAAAGTGCAAAACACTAAAATGG + Intergenic
1137042661 16:35627620-35627642 CAAAAAGCAAAAAAACAAAATGG - Intergenic
1137245026 16:46695574-46695596 GAAAGTGGATAAAAACAAAATGG + Exonic
1137293919 16:47071710-47071732 AAACAAACAAACAAACAAAATGG + Intergenic
1137596098 16:49724913-49724935 CAACTTCCAAAAAAACAAGAGGG - Intronic
1137643818 16:50057351-50057373 AAACTTGGAAATAAGCAAAAAGG - Intergenic
1137653257 16:50138179-50138201 AAACAAACAAACAAACAAAAAGG - Intergenic
1138298387 16:55906559-55906581 AAGAGTGCAAAAATAGAAAAAGG + Intronic
1138353067 16:56356772-56356794 AAAACTGAAAAAAAAAAAAAAGG - Intronic
1138517563 16:57544764-57544786 AAACAAACAAAAAAACAGAAAGG - Intronic
1138645618 16:58422259-58422281 AAAACTGTAAAAAAACAAACAGG - Intergenic
1138665988 16:58568991-58569013 AGACTTGTAAAGAAACAAAAGGG + Intronic
1138968479 16:62115287-62115309 ATACATCCAAAAAAAAAAAAAGG - Intergenic
1139611973 16:68065641-68065663 AAACAAACAAACAAACAAAAAGG + Intronic
1139639136 16:68278451-68278473 AACACTGCAAAAAAAAAAAAAGG - Intronic
1139647856 16:68344773-68344795 AAAGGTGGGAAAATACAAAAAGG - Intronic
1140098346 16:71894267-71894289 AAACGTCTCAAAAAAAAAAAGGG - Intronic
1140199558 16:72883793-72883815 AAAAGTGCATCAAAACAAATGGG - Intronic
1140215458 16:73003709-73003731 AAACAAACAAACAAACAAAAAGG + Intronic
1140700213 16:77574690-77574712 ATATGTGGAAAAAAACAAAGAGG + Intergenic
1140773374 16:78226969-78226991 AAATAAGCAAAAAAACAAGAGGG + Intronic
1140925180 16:79575662-79575684 AGATGTGCAAAAAGAGAAAAGGG + Intergenic
1140994706 16:80247409-80247431 AAAAGTGAAAAAAAAAAAAAAGG - Intergenic
1140999234 16:80292179-80292201 AACAGTGGAAAAAAAAAAAAAGG + Intergenic
1141312786 16:82931512-82931534 AAACATCAAAAAAAAAAAAAAGG - Intronic
1142315428 16:89341759-89341781 AAACGTGCACAAACAAAAAGTGG + Intronic
1142617435 17:1144581-1144603 AATCAGGCAAAAAAAAAAAAAGG + Intronic
1143220544 17:5257779-5257801 AAACGAAAAAAAAAAAAAAAAGG + Intergenic
1143332074 17:6144853-6144875 AACCGTGGAAAAAAAAAAGAGGG - Intergenic
1143384336 17:6518444-6518466 AAAAAAGCAAAAAAAAAAAAAGG + Intronic
1143826276 17:9610529-9610551 AAACAAACAAAAAAAAAAAATGG - Intronic
1144215530 17:13051695-13051717 AAACAAACAAACAAACAAAAAGG + Intergenic
1144403566 17:14930043-14930065 AAAAGTTAAAAAAAAAAAAAAGG + Intergenic
1144483767 17:15648257-15648279 AAACAAACAAAAAAACACAAAGG + Intronic
1144569472 17:16387092-16387114 AAACACACAAACAAACAAAAAGG + Intergenic
1144747547 17:17625970-17625992 TAAAATGCAAAAAAAAAAAAAGG + Intergenic
1146009565 17:29182451-29182473 CCACATGCAAAAAAAAAAAAAGG + Intergenic
1146107876 17:30058980-30059002 AAATTTGAAAAAAAAAAAAAAGG + Intronic
1146166575 17:30594368-30594390 AAACAAGCAAAAAAAAAAGACGG - Intergenic
1147031782 17:37643895-37643917 ATAAGTGCTATAAAACAAAAAGG + Intergenic
1147380023 17:40049179-40049201 AAAAATACAAAAAAAGAAAAAGG + Intronic
1147385687 17:40080414-40080436 AAACAAACAAAAAAAAAAAACGG + Intronic
1147736803 17:42644263-42644285 AAAAATTCAAAAATACAAAAAGG + Intergenic
1147807053 17:43139227-43139249 AAAAGTTAAAAAAAAAAAAAAGG - Intergenic
1148022185 17:44560552-44560574 AAAAATGAAAAAAAAAAAAAAGG + Intergenic
1148928398 17:51107738-51107760 AAAGGTTAAAAAAAAAAAAAAGG + Intronic
1149050060 17:52293636-52293658 AGTAGCGCAAAAAAACAAAATGG + Intergenic
1149097874 17:52866324-52866346 AAACTTAAAAAAAAAAAAAAGGG + Intronic
1149130631 17:53296722-53296744 AAACAAACAAAAAACCAAAAAGG + Intergenic
1149160003 17:53681159-53681181 AAAGGAGAAAAAAAAAAAAAGGG - Intergenic
1149672237 17:58424791-58424813 AAACAAACAAACAAACAAAATGG + Intronic
1149948516 17:60958861-60958883 AAAGGTGCAAAGATACAAAGTGG + Intronic
1150010417 17:61497566-61497588 ACACTTGCAAGTAAACAAAAGGG - Intergenic
1150184926 17:63170263-63170285 AAAAATACAAAAAAAAAAAAAGG + Intronic
1150188235 17:63209415-63209437 AAACAAACAAACAAACAAAAAGG - Intronic
1150743380 17:67797406-67797428 AAGCATACAAACAAACAAAAAGG - Intergenic
1150835456 17:68559765-68559787 AAAAGTGGAAAAAAACAATGGGG - Intronic
1150952515 17:69819679-69819701 AAATGTGGAAAATAAGAAAATGG - Intergenic
1150962819 17:69933762-69933784 ACACATGCAAAAACACAAAGGGG - Intergenic
1151067171 17:71163674-71163696 AAACGTGTGCAAAAATAAAAAGG + Intergenic
1151866251 17:76805307-76805329 AATGGTGAAAAAAAAAAAAAAGG - Intergenic
1152731031 17:81970350-81970372 AAAAGAGAAAAAAAAGAAAATGG - Intergenic
1153173149 18:2339611-2339633 AAACAAACAAACAAACAAAAAGG - Intergenic
1153470471 18:5438980-5439002 AAATGTGGAAAAAAAGAAAAGGG - Intronic
1153493473 18:5673664-5673686 AAACCTGCCAAAAACCAAGATGG + Intergenic
1154008070 18:10550969-10550991 AAACAAACAAACAAACAAAAAGG - Exonic
1154023693 18:10687112-10687134 AAAGGTGAAGAAAAATAAAATGG - Intronic
1154253384 18:12763010-12763032 AAACATGTGTAAAAACAAAAAGG + Intergenic
1155027262 18:21952737-21952759 AAACAACCAAAAAAAAAAAAAGG - Intergenic
1155517783 18:26640454-26640476 AAACAAACAAACAAACAAAAAGG + Intronic
1155536827 18:26827377-26827399 AAAAGTTAAAAAAAAAAAAAAGG + Intergenic
1155838221 18:30613714-30613736 GAAACTGAAAAAAAACAAAAAGG + Intergenic
1155990554 18:32274951-32274973 AAAAATACAAAAAAAAAAAAAGG + Intronic
1156009950 18:32485513-32485535 AAATATGTAAAAAAAAAAAAGGG - Intergenic
1156038486 18:32793344-32793366 AAACAAACAAAAAAACAAAAGGG + Intergenic
1156413106 18:36855063-36855085 AAAAGTGAAAACAAACAAAAAGG - Intronic
1156624514 18:38892438-38892460 AAACAAACAAAAAAACCAAAAGG - Intergenic
1156680082 18:39578011-39578033 AAACTTGCATAAAAATAAAATGG - Intergenic
1156740409 18:40320057-40320079 AAAAGTAAAAAAAAAAAAAACGG - Intergenic
1156779144 18:40829917-40829939 AAAAGTTGAAAAAAAAAAAAAGG - Intergenic
1157336031 18:46738245-46738267 AAATGTCAAAAAAAAAAAAAAGG + Intronic
1157724038 18:49949324-49949346 AAAACTGGAAAAAAAAAAAAAGG + Intronic
1157827421 18:50824773-50824795 AAAAGTTCAAAAAAAAAAAAAGG + Intronic
1158468088 18:57709648-57709670 AAAAGGACAAAAAAAGAAAATGG - Intronic
1158616660 18:58994201-58994223 AAACAAACAAAAATACAAAAAGG - Intergenic
1158672630 18:59490386-59490408 AAATATGCAAAAAAAAAAAAAGG - Intronic
1158882696 18:61796205-61796227 AAACAAACAAACAAACAAAAAGG + Intergenic
1159240378 18:65735109-65735131 AAACTTCCAAAAGAAAAAAATGG - Intergenic
1159273510 18:66185653-66185675 GAACAAGTAAAAAAACAAAACGG - Intergenic
1159659588 18:71077442-71077464 AAATGAGCAAACAAGCAAAAAGG + Intergenic
1159673341 18:71250866-71250888 AAACAAACAAAAAAAGAAAAAGG + Intergenic
1159778798 18:72637274-72637296 GAACAAGCAAAAAAAAAAAATGG + Intronic
1159893160 18:73971963-73971985 AAACGTGGAAAAAGTCCAAAGGG - Intergenic
1159963151 18:74571482-74571504 CAATGTCCAATAAAACAAAATGG - Intronic
1160549716 18:79686336-79686358 AAAAGTGCACAAATACAAAACGG + Intronic
1161111605 19:2473994-2474016 AAACAAACAAACAAACAAAAAGG - Intergenic
1161491144 19:4562362-4562384 AAACAAGAAAAAAAAAAAAAGGG - Intergenic
1162157059 19:8685429-8685451 AAACATTAAAAAAAAAAAAAAGG - Intergenic
1162516607 19:11151906-11151928 AAAAGTTTAAAAAAAAAAAAAGG - Intronic
1162997888 19:14348072-14348094 AAACAAACAAACAAACAAAATGG + Intergenic
1163114921 19:15183381-15183403 AAACAAACAAACAAACAAAAAGG - Intronic
1163195227 19:15714674-15714696 AAACAAACAAACAAACAAAAAGG + Intergenic
1164717955 19:30407233-30407255 AAACGTCAATATAAACAAAAAGG - Intronic
1165050471 19:33138350-33138372 AAACAAACAAACAAACAAAAGGG - Intronic
1165098684 19:33425306-33425328 AAACAAACAAACAAACAAAAAGG + Intronic
1165693571 19:37883423-37883445 AAACAAACAAACAAACAAAAAGG - Intergenic
1166131114 19:40746207-40746229 AAACAAACAAACAAACAAAAAGG - Intronic
1167069762 19:47214139-47214161 AAAAATACAAAAAAAAAAAAAGG - Intergenic
1168657953 19:58145147-58145169 AAACATTTAAAAAAAAAAAATGG - Intronic
925043711 2:754542-754564 AAAGGTGAAAAAAAATAAATGGG + Intergenic
925251058 2:2438732-2438754 AAACAGACAACAAAACAAAAAGG + Intergenic
925826726 2:7856746-7856768 AAGAGGGCAAAAAAAAAAAAAGG + Intergenic
926094262 2:10070956-10070978 AAACAAACAAACAAACAAAAAGG - Intronic
926553214 2:14325597-14325619 AAAGGTAAAAAAAAAAAAAAGGG + Intergenic
926553660 2:14331445-14331467 AAACATCCAGAAAAACAATACGG - Intergenic
926843085 2:17104888-17104910 AGACTTGAAAAAAAAAAAAAAGG - Intergenic
927339771 2:21969606-21969628 AAAAGTAAAAAAAAAAAAAAAGG + Intergenic
927351358 2:22120576-22120598 AAATGTGTAAAAAAGCAGAACGG - Intergenic
927375629 2:22409672-22409694 AAATGAACAAAAAAACACAAAGG + Intergenic
927448271 2:23184910-23184932 AAACAAACAAACAAACAAAATGG - Intergenic
927460739 2:23296296-23296318 AAAAAGGAAAAAAAACAAAAGGG + Intergenic
927529900 2:23786691-23786713 AAATTTGCACAGAAACAAAAAGG + Intronic
927541294 2:23913736-23913758 AACCTTGAAAAATAACAAAAAGG + Intronic
928042110 2:27889285-27889307 GAACGTGGAACTAAACAAAAAGG - Intronic
928130384 2:28644812-28644834 AAACTTGCAGGAAAAAAAAAGGG - Intergenic
928148146 2:28800975-28800997 AAATGTGCTTTAAAACAAAACGG - Exonic
928591569 2:32821767-32821789 GAACATGGAAAAAAAAAAAAGGG - Intergenic
928698681 2:33876587-33876609 AAACAAACAAACAAACAAAAAGG + Intergenic
928709722 2:33990534-33990556 TTATGTGCAAAAAAAAAAAAAGG - Intergenic
928803282 2:35120501-35120523 AAACCTCCAGAAAAAAAAAATGG + Intergenic
929102592 2:38330919-38330941 AATCTTGAAAAAGAACAAAATGG + Intronic
929319630 2:40527025-40527047 AAACAAACAAACAAACAAAATGG + Intronic
929345703 2:40881749-40881771 AAAATGGCAAAGAAACAAAATGG - Intergenic
929500304 2:42485364-42485386 AAAGGGACCAAAAAACAAAAGGG + Intronic
929513691 2:42586420-42586442 AAAAGTGAAAAAAAAAAAAAAGG + Intronic
929945069 2:46364377-46364399 AATCAAGCAAAAAAAGAAAAAGG + Intronic
930050741 2:47214416-47214438 AGACTTTCAAAAAAAGAAAAAGG + Intergenic
930065466 2:47324397-47324419 AAACAAACAAAAAAACAAAAAGG + Intergenic
930123676 2:47780332-47780354 AAACAACCAAAAAACCAAAAAGG + Intronic
930131466 2:47855834-47855856 AACAGTTCAAAAAAAAAAAAAGG + Intronic
930135100 2:47895179-47895201 AAAAATGCAGAAAAATAAAAAGG + Intronic
930349139 2:50227156-50227178 AGACGGGAAAAAAAAAAAAAAGG + Intronic
930526605 2:52538424-52538446 AAAAGTGCAGATAAACAAGAAGG + Intergenic
930685936 2:54308188-54308210 GAATGTGAAAAAAAAAAAAAAGG + Intergenic
930926819 2:56828626-56828648 AAACAAGCAAAAAAAAAAAAGGG - Intergenic
930932507 2:56904200-56904222 AAACATTCAAATAAACAACAAGG - Intergenic
931031873 2:58185508-58185530 GAACTTACAAAAAAACTAAATGG + Intronic
931523759 2:63129186-63129208 AAAGGTGGAAACAACCAAAATGG - Intronic
931554750 2:63490099-63490121 AAATGTAAAAAAAAAAAAAAAGG + Intronic
931655318 2:64505433-64505455 AAACATTCAAAAGAGCAAAAAGG + Intergenic
931696149 2:64872246-64872268 AAACAACCAAAAAAACAAAATGG - Intergenic
931970480 2:67580103-67580125 AAATGTGCAAAAAAGTATAATGG + Intergenic
932165998 2:69507616-69507638 AAAAGTTGAACAAAACAAAAAGG + Intronic
932208924 2:69910935-69910957 AAACAAACAAACAAACAAAAAGG - Intronic
932601077 2:73126170-73126192 CAAATTGCAAAAAAAAAAAAAGG + Intronic
932661211 2:73654187-73654209 AAAAGGAAAAAAAAACAAAAAGG - Intergenic
932712373 2:74076607-74076629 TAAAGGGCAAAAAAAAAAAAAGG - Intronic
932872783 2:75420113-75420135 TAACTTAAAAAAAAACAAAAAGG + Intergenic
933335548 2:80954094-80954116 CAATGTGCATAAAAAGAAAAAGG - Intergenic
933490392 2:82978659-82978681 AAACAAACAAACAAACAAAAAGG + Intergenic
933608632 2:84410699-84410721 AAAACTGCAAAAAAAAAAAAAGG + Intergenic
933806603 2:86002894-86002916 AATTGTGCAAAAACAAAAAAAGG + Intergenic
933902232 2:86858351-86858373 AAAGGTGCAAACCAACAAGATGG - Exonic
934076323 2:88431646-88431668 ATTTGTGCAAAAAAAAAAAAAGG - Intergenic
934473552 2:94577455-94577477 AAACGTGAGAAAGAACAGAATGG + Intergenic
934585692 2:95492485-95492507 AAAAAACCAAAAAAACAAAAAGG - Intergenic
934889444 2:98054087-98054109 AAACTTACATAATAACAAAATGG + Intergenic
934973578 2:98784323-98784345 AAAAATGAAAAAAAAAAAAAAGG + Intergenic
935505679 2:103899404-103899426 AATCGTGCAAAAAAAGAACAGGG + Intergenic
935674910 2:105586370-105586392 AAACTTAAAAAAAAAAAAAAAGG - Intergenic
935778311 2:106490917-106490939 AAAGGTGCAAACCAACAAGATGG + Intergenic
935921271 2:108018094-108018116 AAACCCTCCAAAAAACAAAATGG + Intergenic
935976794 2:108586213-108586235 AAACAAACAAAAAAAGAAAATGG + Intronic
936704160 2:115051096-115051118 AGACGTGCCAACAAACAAGAAGG + Intronic
936778671 2:116005126-116005148 AAACTGCCAAAAAAACAAACAGG - Intergenic
936885359 2:117304288-117304310 AATCCTTCAAAAAAAAAAAAAGG + Intergenic
937005481 2:118508818-118508840 AAAAGTGAAAACAACCAAAATGG + Intergenic
938160046 2:128977586-128977608 AAAAATGCAAAAAAACATGAAGG - Intergenic
938913755 2:135913050-135913072 ACATGTTCAAAAAAAAAAAAAGG - Intronic
938985787 2:136574721-136574743 CCACATGCAAAAAAAAAAAATGG - Intergenic
939585305 2:143997018-143997040 AAACATGAACAAAAGCAAAAAGG - Intronic
939682748 2:145158939-145158961 AAACCAACAAAACAACAAAAAGG + Intergenic
939791005 2:146577325-146577347 AAAAATGCAAAAAATAAAAATGG + Intergenic
940042578 2:149376052-149376074 GAAGCTGCAAAAACACAAAAGGG + Intronic
940124744 2:150310961-150310983 AACAGAGCAAAAAAATAAAAAGG + Intergenic
940295176 2:152115199-152115221 AAACATTAAAAAAAAAAAAAAGG + Intergenic
940519357 2:154723468-154723490 AAACAAACAAACAAACAAAAAGG + Intronic
940585673 2:155645590-155645612 AAAAGTACAAAAAAACACAAAGG - Intergenic
940622364 2:156127883-156127905 AGATGTACAAAAAACCAAAATGG - Intergenic
940647397 2:156406043-156406065 ACAGGTGAAAAAAAAAAAAAAGG - Intergenic
940685724 2:156848327-156848349 AAACATGCGAAAAACCAAGATGG + Intergenic
940747410 2:157584050-157584072 ATACCTTCAAGAAAACAAAATGG + Intronic
940901898 2:159133343-159133365 AAAAGAGAAAAAAAAAAAAAAGG - Intronic
940945477 2:159612875-159612897 AAACATGCAAACAAAGAAATGGG + Intronic
941830591 2:169954569-169954591 AAACGAAAAAAAAAAAAAAAAGG - Intronic
941853490 2:170207380-170207402 AAACATGTATTAAAACAAAATGG + Intronic
941909770 2:170753075-170753097 AACAGTGAAAAAAAAGAAAAGGG + Intergenic
942254264 2:174078000-174078022 ACTCTTTCAAAAAAACAAAATGG + Intronic
942424124 2:175841404-175841426 AAAAATGCATAAAAATAAAATGG + Intergenic
942624731 2:177887758-177887780 AAACAAGCAAACAAACAAAAAGG + Intronic
942648723 2:178144553-178144575 ATACGTGGAAAAAAAAAAAAAGG - Intergenic
942853013 2:180512767-180512789 ACACGTCCAGAAAAAGAAAAGGG + Intergenic
942874433 2:180777147-180777169 AAATGTGCATAAAACCACAAAGG + Intergenic
942888191 2:180954415-180954437 AAAACTGGCAAAAAACAAAAAGG - Intergenic
942925508 2:181427123-181427145 AAATATGCAAAAAATAAAAAGGG - Intergenic
943041351 2:182809075-182809097 AAATGTGGAAAAAAATGAAAAGG + Intergenic
943165801 2:184324302-184324324 AAATGAACAAACAAACAAAAAGG - Intergenic
943165909 2:184325678-184325700 AAATGAACAAACAAACAAAAAGG + Intergenic
943429457 2:187780127-187780149 GAAAGTGCAAAAAAAAAAAATGG + Intergenic
943710229 2:191085047-191085069 AAACTACCAAAAAAAAAAAATGG + Intronic
943763462 2:191634660-191634682 AGATATGCAAAAAAAAAAAAGGG - Intergenic
943811044 2:192189548-192189570 AAAATTCCAAAAAAAAAAAAAGG + Intronic
943843486 2:192609641-192609663 AAAGGTGGTAAAAAAAAAAAAGG + Intergenic
944126349 2:196297517-196297539 AAACCTGCAAAAAAAGGAGAGGG - Intronic
944138366 2:196426625-196426647 AAAACTGCAAAAAATCAAGAAGG + Intronic
944233172 2:197416126-197416148 AAATGTTTAAAAAAAAAAAAAGG + Intronic
944271688 2:197790662-197790684 AAACAAGAAAAAAAATAAAATGG - Intergenic
944289057 2:197983841-197983863 AGACCTGCAAAAATACACAAAGG + Intronic
944550866 2:200843722-200843744 AAACTTGCACCAAAAAAAAAAGG - Intergenic
944731253 2:202520052-202520074 AAAAATGCGAAAAAAAAAAAAGG - Intronic
944733864 2:202542629-202542651 AAGCTTGGAAAAAAACAAAATGG - Intronic
944751305 2:202713467-202713489 AAAAGATCAACAAAACAAAAAGG - Intronic
944774114 2:202944594-202944616 AAACCTGAACATAAACAAAAAGG - Intronic
945267572 2:207905922-207905944 AAAGGAGGAAAAAAAGAAAAGGG + Intronic
945290337 2:208120511-208120533 AAAAGTTGAAAAAAAAAAAAGGG - Intergenic
945410828 2:209504446-209504468 AAACTTGCAAGCAAACAAATGGG + Intronic
945663970 2:212719566-212719588 AAACATGCATAAAAAAATAAAGG + Intergenic
945668067 2:212766821-212766843 AAATGAATAAAAAAACAAAAAGG + Intergenic
945816261 2:214608654-214608676 AAACAAACAAACAAACAAAAAGG - Intergenic
945826478 2:214726030-214726052 GCAGGTGCAAAAAAAAAAAAAGG + Exonic
945896252 2:215485779-215485801 AAATGTGCAAAGAAACAAGTAGG + Intergenic
946438206 2:219673241-219673263 AAAAGTAAAAACAAACAAAAAGG - Intergenic
946580784 2:221126404-221126426 AAATTTACAAAAAAACAAATCGG + Intergenic
946587874 2:221210548-221210570 AAAAGTTAAAAAAAAAAAAACGG + Intergenic
946620946 2:221562206-221562228 AAAAATTCAAAAAAAAAAAAAGG - Intronic
946811113 2:223526786-223526808 AGAGGTACAAAAAAAAAAAAAGG + Intergenic
946897741 2:224341761-224341783 AAACATGCAAGAAAACAAAGAGG + Intergenic
946980026 2:225201280-225201302 AATCGTGCAGAAAATCAAAGAGG - Intergenic
947010208 2:225557724-225557746 AAAAATGAAATAAAACAAAAGGG - Intronic
947073213 2:226314688-226314710 AAACATGCCAACAAAGAAAAAGG + Intergenic
947172666 2:227326220-227326242 AAAGGGGAAAAAAAAAAAAAAGG + Intronic
947219121 2:227776134-227776156 AAACAAACAAACAAACAAAAAGG + Intergenic
947269410 2:228317402-228317424 AAACATTAAAAAAAAAAAAAAGG - Intergenic
947275981 2:228392858-228392880 AAAAGTTCAAAAAGAAAAAAAGG - Intergenic
947689209 2:232119275-232119297 AAAACTGCAAAAAATAAAAAAGG - Intronic
948156032 2:235782254-235782276 AAAAATACAAAAAAAAAAAATGG - Intronic
1168839761 20:902330-902352 AAACTTGCATTAAAAAAAAAAGG + Intronic
1169342085 20:4804305-4804327 TAACGCGCAAAAAGAAAAAAAGG + Intronic
1169362630 20:4963849-4963871 AAAAAAGCAAAAAATCAAAAAGG + Intronic
1169600701 20:7257224-7257246 GAAAGAGCAAAAAAAAAAAAAGG + Intergenic
1169733971 20:8816744-8816766 ACACATGCAAACAAACAATATGG - Intronic
1169892070 20:10464173-10464195 AAACAAACAAAAAAACAAAATGG - Intronic
1170038093 20:12011327-12011349 AAACAAACAAAAAAAAAAAACGG - Intergenic
1170082246 20:12489955-12489977 AAATCTGTGAAAAAACAAAATGG + Intergenic
1170156931 20:13277641-13277663 AAAAGTAAAAAAAAAAAAAAGGG - Intronic
1170461769 20:16583960-16583982 ATACATGCAAAAGGACAAAAAGG + Intergenic
1170608593 20:17893528-17893550 AAAAATACAAAAAAAAAAAAGGG + Intergenic
1170668603 20:18408328-18408350 AAACAAACAAAAAAACCAAATGG + Intronic
1170751399 20:19149876-19149898 AACCGAACAAAAAAACAAAAAGG + Intergenic
1170851232 20:20006291-20006313 AAAAGTTAAAAAAAAAAAAACGG + Intergenic
1171064233 20:21997344-21997366 AAAGCTTCAATAAAACAAAAGGG + Intergenic
1171473936 20:25393087-25393109 AAACGTAAAAAAAAAAAAAGAGG + Intergenic
1171877603 20:30593199-30593221 AAACAAACAAAAAAACAAAGAGG + Intergenic
1172306603 20:33885132-33885154 AAACAAACAAACAAACAAAAAGG - Intergenic
1172399542 20:34637983-34638005 AAACTAGAAAAAAAAAAAAAAGG + Exonic
1172888732 20:38248859-38248881 AAACAAACAAACAAACAAAAAGG - Intronic
1173092766 20:39989916-39989938 CAATGTGCTAAAAAAAAAAAAGG - Intergenic
1173393688 20:42657923-42657945 AAAGGTAAAAAAAAAAAAAAAGG - Intronic
1173483831 20:43425539-43425561 AAATGTGCCAAAAAATAAGATGG + Intergenic
1173681756 20:44886641-44886663 AAACGTGCTAACACACAATATGG - Intronic
1173828540 20:46063080-46063102 AGAACTGCTAAAAAACAAAAGGG + Intronic
1174385013 20:50182656-50182678 AAAAAAGGAAAAAAACAAAATGG - Intergenic
1174483670 20:50848265-50848287 AAATGTACAAAAAATTAAAAGGG + Intronic
1174822685 20:53740900-53740922 AAATGTCCAAAAGAAAAAAAAGG + Intergenic
1174993270 20:55536915-55536937 AAAAATGCAAGAAAACATAAAGG + Intergenic
1175105874 20:56614552-56614574 AAAAGTGAAAAAAAAAAAAAAGG + Intergenic
1175214702 20:57385829-57385851 AAACAAACAAACAAACAAAATGG - Intergenic
1176175123 20:63718246-63718268 AGTCGAACAAAAAAACAAAAGGG - Intronic
1176732659 21:10516133-10516155 AAACAACCAAAAAAAAAAAAAGG - Intergenic
1176734044 21:10526032-10526054 AAATGTTCAAAACACCAAAAAGG - Intronic
1176872638 21:14096076-14096098 AAACGAACAAAAAAACCAGAAGG + Intergenic
1176894344 21:14358734-14358756 AAACAAGCAAAGAAACAAATAGG - Intergenic
1176930751 21:14807092-14807114 AAACAATCAACAAAACAAAAAGG + Intergenic
1176959174 21:15140171-15140193 GAACGTGCAGAAAAAAAATAAGG + Intergenic
1177341128 21:19801786-19801808 AAACAAGCAAACAAAAAAAACGG - Intergenic
1177679100 21:24341058-24341080 AAAGGTCCAAAAAAAAAAAAAGG - Intergenic
1177696061 21:24572959-24572981 AAATATGAAAAAAAAAAAAATGG - Intergenic
1177771850 21:25525804-25525826 AAACCTGGAAAAAGAGAAAAAGG - Intergenic
1177926167 21:27218205-27218227 AAACAAACAAACAAACAAAATGG + Intergenic
1178133465 21:29599797-29599819 AAACAAACAAACAAACAAAAAGG + Intronic
1178161695 21:29924657-29924679 AAAGGTGAAAAAAACAAAAAAGG - Intronic
1178617881 21:34149504-34149526 ACAAATGCAAAAAAAAAAAATGG - Intergenic
1178763883 21:35431016-35431038 AAAAGGGCAATAAAATAAAAAGG + Intronic
1178842545 21:36149373-36149395 AAAGATGGAAAAAAACCAAAGGG + Intergenic
1179216458 21:39371299-39371321 AAAGTTGCAAAAAATAAAAATGG - Intergenic
1179271592 21:39855580-39855602 AGGCATGCAAAAAAAAAAAAAGG - Intergenic
1180418178 22:12788620-12788642 AAATGTTCAAAAAACCAGAAGGG + Intergenic
1180474166 22:15688108-15688130 ACAAGTGCAAAAAAAAAAAAAGG - Intergenic
1180513205 22:16113961-16113983 AAAGGTGCAGTAAAAAAAAAAGG + Intergenic
1180539859 22:16434536-16434558 AAAAGTGAAAAAAAAAAAAATGG - Intergenic
1180561789 22:16621509-16621531 AAATGTTCAAAACACCAAAAAGG - Intergenic
1180696716 22:17755851-17755873 AAACAAACAAAAAACCAAAAAGG - Intronic
1180809395 22:18747918-18747940 AAAAGTTAAAAAAAAAAAAAAGG - Intergenic
1180873522 22:19162239-19162261 AAACAAACAAACAAACAAAAAGG - Intergenic
1181259852 22:21589720-21589742 AAACAGGCAAACAAACAAACAGG - Intronic
1181350025 22:22248260-22248282 AAACAAACAAACAAACAAAAAGG + Intergenic
1181520593 22:23447205-23447227 AAAAGTGCATACAAACAAAAAGG - Intergenic
1181524507 22:23472572-23472594 AAAAGTTAAAAAAAAAAAAAAGG + Intergenic
1181861331 22:25821302-25821324 AAGGATGCAAAAAAAAAAAAAGG - Intronic
1181903311 22:26172862-26172884 AAAACTGCAAAAATACAAAAAGG - Intronic
1182045908 22:27273993-27274015 AAACGTGCAGAAAATCTGAATGG - Intergenic
1182065098 22:27425316-27425338 AAACAAACAAACAAACAAAAAGG - Intergenic
1182319795 22:29471162-29471184 AAACGTGGAAAAACACATAAAGG + Intergenic
1182334691 22:29576012-29576034 AAAAATACAAAAAAAAAAAAAGG - Intronic
1182414978 22:30215652-30215674 AAACAAACAAACAAACAAAAAGG + Intergenic
1183084121 22:35475907-35475929 GAAAGGGCAAAAAAAAAAAAAGG - Intergenic
1183218206 22:36494935-36494957 AAACAAACAAACAAACAAAAAGG - Intronic
1183783284 22:40012771-40012793 AAACAAACAAACAAACAAAAGGG + Intronic
1184763482 22:46558932-46558954 AAAGGTAAAAAAAAAAAAAAAGG - Intergenic
1185010561 22:48310578-48310600 AAACTGTCAAAAATACAAAAGGG + Intergenic
1203231493 22_KI270731v1_random:113301-113323 AAAAGTTAAAAAAAAAAAAAAGG + Intergenic
949748343 3:7322369-7322391 AAAAGTTTAAAAAAACAAAAAGG - Intronic
950594950 3:13971778-13971800 AAAGGTAGAAAAAAAAAAAAGGG - Intronic
950805288 3:15597625-15597647 AAATGTGGAAAAAAAAAAAAAGG + Intronic
950946058 3:16947508-16947530 AAAAGTGCAAAACACCAAACAGG - Intronic
951210895 3:19973380-19973402 AGACTTGCAAAAAAAAAAAAAGG - Intronic
951288604 3:20847101-20847123 AAGTGTGCAGAAAAAAAAAAAGG - Intergenic
951356697 3:21675992-21676014 AAATGTGGAAAAAATCACAACGG - Intronic
951426945 3:22557391-22557413 CAACCTGCAGAAAAACATAAGGG + Intergenic
951514213 3:23540385-23540407 AAACAAACAAACAAACAAAAGGG - Intronic
951892478 3:27580113-27580135 AAAGGTAAAAAAAAAAAAAAAGG + Intergenic
952223129 3:31345118-31345140 AAAAGTACAAAAAAACAGGAAGG + Intergenic
952994497 3:38866205-38866227 AAAAGAGAAAAAAAAAAAAAAGG - Intronic
953453901 3:43026625-43026647 AAAAGTGGAAAATAACAGAAAGG + Intronic
953698076 3:45175234-45175256 AAATGTAAAAAAAAAAAAAAAGG + Intergenic
953832132 3:46308548-46308570 AAACATGGAAAAAAAATAAAAGG - Intergenic
953941234 3:47099949-47099971 AAAAAAGCAAAAAAAAAAAAAGG - Intronic
954466982 3:50661198-50661220 AAACAAACAAACAAACAAAACGG - Intergenic
954515078 3:51166916-51166938 AAACAATCAACAAAACAAAAAGG - Intronic
954565127 3:51593324-51593346 AAACATAAAAAAAAAAAAAAAGG - Intronic
954592074 3:51791544-51791566 AAAGGTTAAAAAAAACAGAAAGG - Intergenic
954735136 3:52701341-52701363 TAACTAGCAAAAAAAAAAAAAGG + Intronic
954786358 3:53095719-53095741 AAAAGTTAAAAAAAAAAAAAAGG + Intronic
955254470 3:57316131-57316153 AAACAAGCAAAAAAAAAAAAGGG - Intronic
955367053 3:58319792-58319814 AAACGGGAAACAAAAAAAAATGG - Intergenic
955515279 3:59720359-59720381 AAAGGGGGAAAAAAAAAAAAGGG - Intergenic
955608996 3:60737741-60737763 GAGCTGGCAAAAAAACAAAAAGG + Intronic
955612281 3:60770264-60770286 AAACATGGAGAAAAAAAAAAAGG + Intronic
955690711 3:61587958-61587980 AAAAGTTTAAAAAAAAAAAATGG - Intronic
955706071 3:61729070-61729092 AAACAAACAAACAAACAAAAAGG + Intronic
955889383 3:63633761-63633783 ATTCTTGCAAAAAAAAAAAAAGG + Intergenic
956542453 3:70356684-70356706 CAACCTACAAAAAAACAAAAAGG - Intergenic
956618933 3:71200845-71200867 AGACTTGCACAAAAACCAAATGG + Intronic
956934591 3:74085869-74085891 AAACATTAAATAAAACAAAAGGG - Intergenic
956952496 3:74298594-74298616 AAAACTGGAAAAAAAAAAAAAGG + Intronic
957337906 3:78856050-78856072 AAGCTTGAAAAAAAAGAAAAAGG - Intronic
957688511 3:83536945-83536967 AAACCTGAAAAAAAAAGAAATGG + Intergenic
958652788 3:96959792-96959814 AAACATAGAAAAAGACAAAAAGG + Intronic
958674765 3:97254182-97254204 AAACAAACAAATAAACAAAAAGG - Intronic
959012237 3:101091246-101091268 AAAGGTAAAAAAAAAAAAAATGG + Intergenic
959043509 3:101445777-101445799 AAACTTACAAAGAAACAAAAAGG + Intronic
959068585 3:101681856-101681878 AAACAAACAAACAAACAAAAAGG + Intronic
959078016 3:101771448-101771470 AAAAGTACAAAAAAATAAAGCGG + Intergenic
959501603 3:107113154-107113176 AAATGTAAAACAAAACAAAAGGG + Intergenic
959801114 3:110496091-110496113 AAAATTCCAAAAAAACAGAATGG + Intergenic
959877607 3:111403770-111403792 AAGGATGCAAAAAAAAAAAAAGG - Intronic
960137625 3:114121833-114121855 AAAAATACAAAAAAAAAAAAAGG + Intergenic
960603997 3:119486378-119486400 AAAAATGCACAAAAACCAAAGGG - Intronic
960742408 3:120849636-120849658 AAACTAGAAAAAAAAAAAAAAGG - Intergenic
960873018 3:122269148-122269170 AAACAAGCAAACAAATAAAAAGG - Intronic
961193386 3:124981232-124981254 AAACTTTAAAAAAAAAAAAAAGG - Intronic
961237215 3:125377180-125377202 AAAAGTTAAAAAAAAAAAAAAGG - Intergenic
961287026 3:125814171-125814193 AAACAAACAAACAAACAAAAAGG + Intergenic
961401971 3:126654018-126654040 AAAAATGTAAAAAAAAAAAAAGG + Intronic
961541539 3:127603460-127603482 AAACAAACAAACAAACAAAAGGG - Intronic
961758397 3:129145867-129145889 AAACCAGCTAGAAAACAAAAAGG + Exonic
962226626 3:133616446-133616468 AAACAAACAAAAAAACAAGAGGG + Intronic
962426853 3:135277861-135277883 AAAAATGGAAAAAAAAAAAAAGG + Intergenic
962519443 3:136184731-136184753 AAAGGTTAAAAAAAAAAAAAGGG + Intronic
962632381 3:137291689-137291711 AAACCAGAACAAAAACAAAAAGG + Intergenic
962806526 3:138931361-138931383 AAAAATGAAAAAAAAAAAAATGG - Intergenic
962860085 3:139391198-139391220 AAACATAAAAAAAAAAAAAATGG - Intergenic
962968409 3:140375499-140375521 AATTGGGCAATAAAACAAAATGG - Intronic
963138127 3:141926287-141926309 AAACATGTAAAAAAAAAAACTGG + Exonic
963240043 3:142993981-142994003 AAACGTGCTAAAAAATAGAGAGG - Intronic
963245800 3:143060492-143060514 AAAAGTCAAAAACAACAAAAGGG - Exonic
963309808 3:143697357-143697379 AAAAATGCAGAAAAGCAAAAAGG - Intronic
963374682 3:144449295-144449317 AAACAAGCAAACAAACAATATGG + Intergenic
963376591 3:144474128-144474150 AAAGGAGCATCAAAACAAAAGGG + Intergenic
963463245 3:145644433-145644455 AAACATTCAAACAAAAAAAATGG - Intergenic
963486096 3:145935910-145935932 TAACATGCTATAAAACAAAAAGG - Intergenic
963524836 3:146404802-146404824 AAATAGGCAAAAAAAAAAAAGGG + Intronic
963582575 3:147144756-147144778 TCACCTGCAAAAAAAAAAAAAGG + Intergenic
963713205 3:148771344-148771366 AAATCTTCAAAAAAAAAAAAAGG + Intergenic
964172217 3:153784344-153784366 TAACGTGCAAACAAATGAAATGG + Intergenic
964220752 3:154341769-154341791 AAACTTGGAAACAAACAACAAGG + Intronic
964301436 3:155290036-155290058 ACATGAGCAAAAATACAAAATGG - Intergenic
964306060 3:155341322-155341344 AAAAGTGAAGAAAAAGAAAATGG + Intergenic
964453306 3:156833906-156833928 TAAACTGCAAAAAAAAAAAAAGG - Intronic
964638509 3:158884004-158884026 AAACAAACAAACAAACAAAAAGG + Intergenic
964663352 3:159145802-159145824 AAACATGCAAGAAAACATATAGG + Intronic
964665804 3:159170641-159170663 AAACAAGAAAAAAAAAAAAAGGG - Intronic
964976720 3:162630227-162630249 AAAACAACAAAAAAACAAAAAGG - Intergenic
965059789 3:163770793-163770815 AAACAAACAAAAAAACAAAATGG - Intergenic
965420666 3:168454480-168454502 AAATGTGGAAAGAAATAAAAAGG - Intergenic
965712634 3:171571334-171571356 AAACAAGAACAAAAACAAAAAGG - Intergenic
965714770 3:171591145-171591167 AAATCTGGAAAAAAAAAAAAAGG + Intergenic
965816142 3:172638870-172638892 AAACATGCTTAAAAACAAACAGG + Intronic
966288720 3:178329211-178329233 AAAAATGCAAAAAAATAAAGGGG + Intergenic
966394152 3:179484591-179484613 AAAAATGCAAAAAAAAAAAATGG - Intergenic
966404419 3:179580794-179580816 AAACTTGTAAAAAAAAAAAAGGG - Intronic
966588898 3:181657749-181657771 AAATTTGGAAAAAAATAAAAAGG + Intergenic
966747327 3:183289864-183289886 AAACAGACAAACAAACAAAAAGG + Intronic
966958778 3:184912055-184912077 AAACATGCAAAAAAATTAAAAGG - Intronic
967058775 3:185853054-185853076 ATTTTTGCAAAAAAACAAAAAGG - Intergenic
967548647 3:190763291-190763313 AATGGTGAAAAAAAAAAAAAAGG - Intergenic
967589483 3:191256626-191256648 TAAGCTGCAAAAAAAAAAAAAGG - Intronic
967590596 3:191269482-191269504 AAACCTGAAAAAAAAGAAGAAGG - Intronic
967683543 3:192393615-192393637 AAATGGGAAAAAAAAGAAAAAGG + Intronic
967818484 3:193818466-193818488 AAACAAAAAAAAAAACAAAACGG + Intergenic
968013967 3:195310409-195310431 ATACCTACAAACAAACAAAATGG + Intronic
968223634 3:196958278-196958300 AAAAGTGCAATAAGCCAAAAAGG + Intronic
968394052 4:216905-216927 AAACTTACAAAATAACAAAAGGG - Intergenic
968548584 4:1210970-1210992 AAATGGGCAAAAAAGCCAAAAGG - Intergenic
968567324 4:1320599-1320621 AAACGTGCAAGAAAACGCTATGG + Intronic
968727399 4:2254176-2254198 AAAAATGCAAATCAACAAAAAGG + Intronic
970016325 4:11516626-11516648 AAAAGTAAAAAAAAAAAAAAAGG + Intergenic
970216815 4:13767400-13767422 AAAAGTGCATAAACCCAAAATGG - Intergenic
970798319 4:19941991-19942013 AAAGGTAAAAAAAAAAAAAAAGG + Intergenic
970961477 4:21876769-21876791 GAAAGTTCAAAAAAAGAAAATGG + Intronic
971611215 4:28729503-28729525 AAACAAACAAAAAAACAAATAGG - Intergenic
971741757 4:30530272-30530294 AAAGGAGCGAAAAAACAAAAGGG + Intergenic
971813113 4:31453302-31453324 AAGCAAGCAAAAAAAAAAAAAGG - Intergenic
971832012 4:31706372-31706394 AAACCTGCTATAAAGCAAAATGG + Intergenic
971834273 4:31742246-31742268 AAAGGTGGAAAAAAATAAAGAGG + Intergenic
971860549 4:32097557-32097579 AAACAAACAAACAAACAAAAGGG + Intergenic
971900107 4:32648647-32648669 AAACAAACAAACAAACAAAATGG - Intergenic
971938178 4:33180807-33180829 AAACAAGCAGAAACACAAAATGG - Intergenic
972068813 4:34987679-34987701 AAACAAACAAACAAACAAAATGG + Intergenic
972210923 4:36836278-36836300 AAATATGCAAGAAAACATAATGG + Intergenic
972407472 4:38760714-38760736 CCCCGTGCAAAAAAAAAAAAAGG + Intergenic
972575495 4:40347560-40347582 TAACTTGCAAAAAAATAAAAGGG - Intronic
972613683 4:40678311-40678333 AGACATGCAAAAAAAAAAAAAGG - Intergenic
972697610 4:41463563-41463585 AAAAGTTAAAAAAAAAAAAAAGG - Intronic
972761994 4:42115461-42115483 AAACTTCCAGAAAAACAAGAAGG + Exonic
972830710 4:42810669-42810691 AAATGAGTAAAAAAAAAAAATGG + Intergenic
972995559 4:44874696-44874718 AAAATTGAAAAAAAACACAAGGG - Intergenic
973363609 4:49188667-49188689 AAATGTTCAAAAAACCAGAAGGG - Intergenic
973537658 4:51900191-51900213 AAAAGTGAAAAAAATCAATATGG - Intronic
973561609 4:52142606-52142628 AAACAAACAAAAAAACAAAAAGG + Intergenic
973943190 4:55931247-55931269 AAACGTGCAAAATATTACAAAGG - Intergenic
973979968 4:56299839-56299861 AAACGAGCAAAAAAAAAAAAAGG + Intronic
974229156 4:59087344-59087366 AAATGTGCAAAGGAAGAAAAAGG + Intergenic
974319040 4:60320576-60320598 AAACTAGAAAAAGAACAAAATGG + Intergenic
974411991 4:61554098-61554120 AAATGTAAAAAAAAAAAAAATGG - Intronic
974454033 4:62102953-62102975 AAACAAGCAAAAAGACAAGAGGG + Intergenic
974685358 4:65220186-65220208 AAAAGTTGAAAAAAACAAAAAGG + Intergenic
974762534 4:66296538-66296560 AAAAGTAAAAAAAAAAAAAAAGG + Intergenic
974797978 4:66778986-66779008 CACGGTGCAAAAAAAAAAAAAGG + Intergenic
974825904 4:67130347-67130369 AAACTTGGAAAATATCAAAAAGG - Intergenic
974924085 4:68276228-68276250 AAAGTTGCAAAAATAGAAAAAGG - Intergenic
974957163 4:68656104-68656126 AAACTCCAAAAAAAACAAAAAGG - Intronic
975052756 4:69885904-69885926 AAACGTGATAAGAAACAAATGGG - Intergenic
975332056 4:73127404-73127426 AAATGTGAAAAGAAACAAATGGG - Intronic
975390338 4:73808994-73809016 AAACTTGCCAAAAAACTGAAAGG + Intergenic
975601403 4:76103828-76103850 CAACTTTCAAAAAAAAAAAAAGG - Intronic
975757701 4:77587438-77587460 ACACGTGCAAAAATAAACAATGG + Intronic
975951772 4:79782296-79782318 AAATGAGCAAAAAAAGTAAAAGG - Intergenic
976782533 4:88776982-88777004 AAACAAACAAACAAACAAAAAGG + Intronic
977269160 4:94893779-94893801 AAACAAACAAACAAACAAAAAGG + Intronic
977377631 4:96227202-96227224 AAGACTGCAAAAAAAAAAAAAGG - Intergenic
977476398 4:97515664-97515686 AAAAGTTAAAAAAAACAATATGG - Intronic
977537815 4:98276482-98276504 CAATATGCAAAAAAAAAAAAGGG - Intronic
977542589 4:98335787-98335809 AAAAGTTAAAAAAAAAAAAAAGG - Intronic
977602489 4:98949137-98949159 AAACAAACAAACAAACAAAAAGG + Intergenic
978289599 4:107121447-107121469 AAAACTGCAAGAAAAAAAAATGG + Intronic
978415864 4:108475270-108475292 AAAAGTGAAAGAACACAAAATGG + Intergenic
978456920 4:108904592-108904614 AAAGGTACAAACAAAAAAAATGG + Intronic
978535700 4:109759931-109759953 AAACATACAAACAAACAAACTGG + Intronic
978691789 4:111522422-111522444 ACACAAACAAAAAAACAAAATGG + Intergenic
978894596 4:113871826-113871848 AAAGGAGCAAAAAGAAAAAAAGG - Intergenic
979014549 4:115417091-115417113 AAGTGTCCAAAAAAATAAAATGG + Intergenic
979353151 4:119669656-119669678 AAACAAAAAAAAAAACAAAAAGG + Intergenic
979574250 4:122267909-122267931 CACCTTGCAAAAACACAAAAAGG - Intronic
979796173 4:124849558-124849580 AAACAAACAAACAAACAAAAAGG + Intergenic
979869375 4:125798782-125798804 AAAGGTGTAAAAAACGAAAAAGG + Intergenic
980030176 4:127818876-127818898 AAAAGTTTAAAAAAAAAAAAAGG + Intronic
980244406 4:130220475-130220497 AAACATGGAAACAAAAAAAAGGG - Intergenic
980285564 4:130774707-130774729 ATACTTGCAAAAAAAAAAAAAGG + Intergenic
980706419 4:136502131-136502153 AAACTTAAAAAAAAACAAAAAGG + Intergenic
981129269 4:141140267-141140289 AAAGGAGCAAAAAAGAAAAAAGG - Intronic
981142736 4:141288790-141288812 AAAGGGTCAACAAAACAAAAGGG - Intergenic
981216903 4:142180352-142180374 TAACATGGAAAAAAATAAAATGG - Intronic
981276720 4:142908334-142908356 AGAGTTGCAAAAAAAAAAAAAGG - Intergenic
981499790 4:145437799-145437821 AAAAATGCATACAAACAAAAAGG + Intergenic
981506391 4:145504959-145504981 AAAAATGCATAAAAACACAAAGG - Intronic
981542363 4:145859313-145859335 ATAAGTGAAATAAAACAAAAAGG + Intronic
981714861 4:147742903-147742925 AAACTTTAAAAAAAAAAAAAAGG - Intronic
981912232 4:149995288-149995310 AAAAGAGCAAAAAAGAAAAAAGG + Intergenic
981982604 4:150812337-150812359 AGACATTCAAAAGAACAAAAAGG + Intronic
982152557 4:152477048-152477070 AAAGCGGCAAAAAAAAAAAAAGG + Intronic
982477605 4:155872572-155872594 AAACATGTATCAAAACAAAATGG + Intronic
982486553 4:155973323-155973345 AAACGAGCAAATAAATAAAATGG + Intergenic
982715770 4:158806039-158806061 AAAGGTTTAAAAAAAAAAAAAGG - Intronic
983248911 4:165323200-165323222 AAAAGAGCAAAAAAACTAACAGG - Intergenic
983269445 4:165544067-165544089 AAACAAACAAACAAACAAAACGG + Intergenic
984036288 4:174672267-174672289 AAATGTTCAGAAAAACAAGAGGG - Intronic
984175827 4:176415700-176415722 AAACAAACAAACAAACAAAAAGG - Intergenic
984334893 4:178378546-178378568 AAACGTGCAATAAAAAACTAAGG - Intergenic
984419752 4:179505642-179505664 AAAGGTCTAAATAAACAAAATGG - Intergenic
984547262 4:181121112-181121134 AAACGTGTGAATAAGCAAAAGGG - Intergenic
985149943 4:186936538-186936560 AAACCTGCAACAAAACTAAATGG - Intergenic
1202758883 4_GL000008v2_random:91198-91220 AAACTACCAAAAAAAAAAAAAGG - Intergenic
985909157 5:2865529-2865551 AAACAAACAAACAAACAAAATGG - Intergenic
985922411 5:2987950-2987972 AAATGTGAAATAAAATAAAAAGG - Intergenic
987008725 5:13738081-13738103 AAATGTTAAAAAAAAAAAAAAGG + Intronic
987064228 5:14272318-14272340 AAACGTTCAGAAACACAAGAGGG - Intronic
987208569 5:15654412-15654434 AAAACTGAAAAAAAAAAAAAAGG + Intronic
987289238 5:16492463-16492485 AAACTTAAAAAAAAAAAAAAAGG + Intronic
987314452 5:16711249-16711271 AACCATGCAAAAAAAAAAGATGG + Intronic
987345567 5:16975814-16975836 AAAAAAACAAAAAAACAAAATGG + Intergenic
987605277 5:20126500-20126522 AAACAATCAACAAAACAAAAGGG + Intronic
987646993 5:20686284-20686306 AAATGTGAAGAAAAACAAATAGG - Intergenic
987765662 5:22226073-22226095 AAATGTTAAAAAAAAGAAAAGGG - Intronic
987834504 5:23144482-23144504 TAGCGTGCAAAATAACCAAAAGG - Intergenic
987990650 5:25207200-25207222 AAAAATGAAAACAAACAAAAAGG - Intergenic
988039435 5:25870786-25870808 AAACAAACAAACAAACAAAAAGG - Intergenic
988132705 5:27125559-27125581 AAATGTTCAAGAAAACATAATGG + Intergenic
988787833 5:34580533-34580555 TAACGTGCTAAAAACCAAATGGG + Intergenic
988946059 5:36201202-36201224 AAACATGCTAAAAATCAAAAAGG + Intronic
989574442 5:42976893-42976915 AAACAAACAAACAAACAAAAAGG - Intergenic
989974599 5:50569279-50569301 AAAAGGTCAACAAAACAAAAAGG + Intergenic
990119926 5:52438580-52438602 AAAGGTGCAAAAAAAAAAATTGG + Intergenic
990752219 5:59029250-59029272 AAAAATACAAAAAAAAAAAAAGG + Intronic
990756021 5:59071417-59071439 AATGGAGCAAAAATACAAAAAGG - Intronic
990880966 5:60538599-60538621 AAACATGAAATAAGACAAAAGGG - Intergenic
990891666 5:60657353-60657375 AACAGTGAAAAAAAACAACAAGG - Intronic
991095182 5:62732275-62732297 AAACAAACAAACAAACAAAAAGG - Intergenic
991365321 5:65861824-65861846 AAATGTGAAAAAAAAAAAAAAGG + Intronic
991717569 5:69465969-69465991 AAACAAACAAACAAACAAAAAGG - Intergenic
991988941 5:72318783-72318805 AAACCCGAAAAAAAAAAAAAAGG + Intronic
992461291 5:76962616-76962638 AAAATTGAAAAAAAAAAAAAAGG + Intronic
992499268 5:77325520-77325542 AAACCTGAAACACAACAAAAAGG - Exonic
992601682 5:78407475-78407497 AAAACTGCAAGAAAAAAAAAAGG - Intronic
992677953 5:79124455-79124477 TAAAATGCAAAAAAAAAAAAAGG + Intronic
992794330 5:80242149-80242171 AAAAGTGAAACAAAACAAAAAGG + Intronic
992871635 5:81011745-81011767 AAACAAACAAAAAAAAAAAAAGG + Intronic
993062722 5:83059159-83059181 TAACAAGCAAAAAAAAAAAAAGG + Intronic
993103428 5:83570025-83570047 AAATGAGCAAAGAAAAAAAAAGG + Intronic
993248636 5:85485813-85485835 AAATGTTAAAAAAAAAAAAAAGG - Intergenic
993457451 5:88142402-88142424 ACACGGGCAAGAAAAAAAAAAGG + Intergenic
993472104 5:88318751-88318773 AAACAAACAAACAAACAAAAAGG - Intergenic
993537192 5:89101424-89101446 AAACTTTCTAAAAAGCAAAATGG - Intergenic
993748891 5:91641223-91641245 AATCGTGCAAAAATCCAAATTGG + Intergenic
994580017 5:101629752-101629774 AAAAGAAAAAAAAAACAAAATGG + Intergenic
994767468 5:103936935-103936957 AAGGGTGAAAAAAAACAATAAGG + Intergenic
994807160 5:104463574-104463596 AAAAGTGTAAAAAAAGACAAAGG - Intergenic
994814226 5:104563723-104563745 CAATGTGAAAAAAAACAAGAGGG - Intergenic
995073025 5:107946936-107946958 TGAATTGCAAAAAAACAAAAAGG - Intronic
995227183 5:109713805-109713827 AAAAGAACAAAAAAAAAAAAAGG - Intronic
995488771 5:112667470-112667492 AAAAGTTAAAAAAAAAAAAAAGG - Intergenic
995559365 5:113364258-113364280 AAACCAGAAAAAAAAAAAAAAGG + Intronic
995597551 5:113764160-113764182 TAATGTGAAAAAAAAAAAAAAGG - Intergenic
995886563 5:116901180-116901202 AAACTTCCACAAAAACTAAATGG - Intergenic
996116939 5:119630148-119630170 AAACGAAAAAAAAAAAAAAAAGG - Intronic
996305523 5:122042597-122042619 AAATATGCAAAATAAGAAAAAGG - Intronic
996387882 5:122928009-122928031 AAAAGTACATAAAAATAAAAGGG - Intronic
996577637 5:124993817-124993839 AAACAAACAAACAAACAAAAAGG - Intergenic
997141935 5:131390958-131390980 AAAAATACAACAAAACAAAATGG - Intronic
997605382 5:135172214-135172236 AAAGGTGCAAAAACACACATTGG - Intronic
998087607 5:139339651-139339673 AAACAAACAAATAAACAAAAAGG - Intergenic
998310573 5:141125826-141125848 AAACGTGTAATGAAATAAAAAGG + Intronic
999170260 5:149588195-149588217 AAACAAACAAACAAACAAAAAGG - Intronic
999652994 5:153785412-153785434 AAAATTACAAAAAAATAAAATGG + Intronic
999804012 5:155065427-155065449 AAAAGTAAAAAAAAAAAAAAGGG - Intergenic
999883977 5:155899594-155899616 AAACGTCAAGAAAAATAAAATGG + Intronic
999976282 5:156915238-156915260 AAACAAACAAACAAACAAAAAGG - Intergenic
1000112461 5:158122095-158122117 AAAGATGCAAAAAAAAAAAAAGG - Intergenic
1000264248 5:159619614-159619636 AAACGTAAATAAAAATAAAAAGG - Intergenic
1000465023 5:161565556-161565578 AAACCAACAAAAAAACAAAACGG + Intronic
1000470093 5:161630237-161630259 AAACAAACAAACAAACAAAAGGG + Intronic
1000522456 5:162313779-162313801 AATCCTGCAAAAAAACACTATGG + Intergenic
1000615827 5:163425539-163425561 AAACAAACAAAAAAACAAACTGG + Intergenic
1000658743 5:163914128-163914150 CAATGTGGAAAAAAACAAAAAGG - Intergenic
1001339484 5:170830239-170830261 AAACCCACCAAAAAACAAAATGG + Intergenic
1001360292 5:171077377-171077399 AATCTTGCCATAAAACAAAAAGG + Intronic
1001399365 5:171437539-171437561 AGAGGTGGACAAAAACAAAACGG - Intronic
1001418734 5:171570417-171570439 AAAGGTGCAGACAAAGAAAAAGG - Intergenic
1001897053 5:175391504-175391526 AAACAAACAAACAAACAAAAAGG - Intergenic
1003041541 6:2692622-2692644 ACACAAGCAAAAAAAAAAAAAGG + Intronic
1003096937 6:3149623-3149645 AAACAAACAAACAAACAAAAAGG - Intronic
1003212669 6:4080904-4080926 AAAAATACAAAAAAAAAAAAAGG + Intronic
1003368018 6:5495523-5495545 AAAGGTGCAAAAAAAGAATCTGG + Intronic
1003789949 6:9534763-9534785 AAAAATACAAAAAAAAAAAAAGG - Intergenic
1004553944 6:16677149-16677171 AAACATGTAAACAAACAATACGG + Intronic
1004594376 6:17085473-17085495 AAACAAACAAAAAAACAAATGGG - Intergenic
1004651817 6:17617286-17617308 AAAAGTGCATTAAAACAACAAGG + Intronic
1004654095 6:17641550-17641572 AAACAAACAAACAAACAAAAAGG + Intronic
1004974697 6:20951851-20951873 ATACATGCAAAAAAAGAAAGTGG - Intronic
1005025063 6:21454632-21454654 AAACGAGCAAAAATAGATAAAGG + Intergenic
1005113612 6:22313253-22313275 AAATTGGCAAAAAAAAAAAAGGG + Intergenic
1005287912 6:24348677-24348699 AAGCAGGCTAAAAAACAAAAGGG + Intronic
1006016643 6:31086475-31086497 AAACAAACAAACAAACAAAAAGG + Intergenic
1006495736 6:34422013-34422035 AAATCTGAAAAAAAAAAAAAAGG + Intronic
1006926916 6:37661552-37661574 AAACAAGCAAAAAAACTAGAAGG + Intronic
1006957575 6:37888547-37888569 CACCGTGGAAAAAAAGAAAAGGG - Intronic
1007043081 6:38743365-38743387 AGACTTGCAAAAAAAGAAAGGGG - Intronic
1007345612 6:41227673-41227695 AAATGTACAGAAAAAGAAAATGG - Intergenic
1007617775 6:43191909-43191931 AAGCCAGCAAAAAAAAAAAAAGG - Intronic
1007959121 6:45942642-45942664 AAACATCAAAACAAACAAAAAGG - Intronic
1008994843 6:57646509-57646531 AAAGGTTAAAAAAAAAAAAAAGG - Exonic
1009244010 6:61212721-61212743 AAATGTGCAAATAAACAAGTAGG + Intergenic
1009399318 6:63235534-63235556 AAACATCAAAAAAGACAAAAAGG - Intergenic
1009703477 6:67214204-67214226 AAAACTGCAAAAGAAGAAAAGGG - Intergenic
1009706742 6:67261834-67261856 AAACCTGACAAAAAACAAATGGG - Intergenic
1009990194 6:70833705-70833727 AAATGTGCAAAACAACAATCTGG + Intronic
1010100961 6:72107978-72108000 AAACAAACAAAAAAACAGAATGG - Intronic
1010174110 6:73006818-73006840 AAATGTTAAAAAAACCAAAAGGG - Intronic
1010376755 6:75179535-75179557 AACCATGCAAAAAAAAAAAAAGG + Intronic
1010809159 6:80279122-80279144 AAACAAACAAACAAACAAAAAGG - Intronic
1010867336 6:80995249-80995271 AAAAGTACAAAAATATAAAATGG - Intergenic
1011232239 6:85175331-85175353 AAACCTTCAAAAAAAAAAACTGG - Intergenic
1011567948 6:88699668-88699690 AAACAAACAAAAAAACACAATGG + Intronic
1011938238 6:92809502-92809524 AAATGTTAAAAAAAAAAAAAAGG + Intergenic
1011988187 6:93476453-93476475 AAAAGAGAAAAAAAAAAAAAAGG + Intergenic
1012207690 6:96480907-96480929 AAACATACCAAAAAAAAAAAAGG + Intergenic
1012408842 6:98932794-98932816 AAACATGGAAAAACACAAAAAGG + Intronic
1012657049 6:101837547-101837569 AAAGCTGGAAAAAAAGAAAAAGG + Intronic
1012787762 6:103654616-103654638 AAACATTAAAAAAAAAAAAAAGG - Intergenic
1013255133 6:108377817-108377839 AAATGTCAAAAAAAAAAAAAAGG - Intronic
1013314772 6:108930902-108930924 AAAAGTTAAAAAAAAAAAAAAGG - Intronic
1013337195 6:109175754-109175776 AAAAATACAAAAAAAAAAAAAGG + Intergenic
1013583320 6:111557130-111557152 AAAAGAAAAAAAAAACAAAACGG + Exonic
1013632000 6:111994890-111994912 AAACGTGGAAACAACCTAAATGG + Intergenic
1013834228 6:114313921-114313943 AAACAAACAAACAAACAAAATGG - Intronic
1013976048 6:116080162-116080184 AAACAAACAAACAAACAAAAAGG - Intergenic
1014023495 6:116617511-116617533 AAAAGGACAAAAAAAAAAAAAGG - Intronic
1014122511 6:117741288-117741310 AAAAGTGAAAAAGAATAAAAGGG + Intergenic
1014391129 6:120866208-120866230 AAATGTGCAAAAAAAAAGATGGG + Intergenic
1014478664 6:121907607-121907629 AAAGGTACAAAAACACAAATTGG - Intergenic
1014513748 6:122356605-122356627 AAACAAACAAACAAACAAAAAGG + Intergenic
1014815448 6:125930892-125930914 TAAAATGGAAAAAAACAAAATGG + Exonic
1015037910 6:128679439-128679461 AATCAGGCAAAAAAAAAAAAAGG + Intergenic
1015321695 6:131882509-131882531 AAACAAGAAAGAAAACAAAAAGG - Intronic
1015348782 6:132192446-132192468 AAACAAACACAAAAACAAAAAGG - Intergenic
1015361354 6:132343231-132343253 AAACAAGTCAAAAAACAAAATGG + Intronic
1015582605 6:134742056-134742078 AAAAAACCAAAAAAACAAAAAGG + Intergenic
1015642317 6:135348597-135348619 AACAGTGCACAAAATCAAAATGG - Intronic
1015652834 6:135481704-135481726 AAAAGTGTTAAAAAAAAAAAAGG - Intronic
1015680757 6:135805765-135805787 AAACGTGCATATACACAAATGGG - Intergenic
1015736610 6:136406864-136406886 AATAGGGCAGAAAAACAAAAGGG + Intronic
1015928029 6:138329671-138329693 AAACAAACAAAAAAACAAACTGG + Intronic
1016295142 6:142565760-142565782 AAAGGAGAAAAAAAAAAAAAAGG + Intergenic
1017774139 6:157667610-157667632 AAAGGTTTAAAAAAAAAAAAAGG + Intronic
1017988732 6:159467951-159467973 AAACATACAAAAAAGCCAAAAGG + Intergenic
1018278134 6:162154518-162154540 AAAGGAGAAAAAAAAAAAAAAGG + Intronic
1018529811 6:164750683-164750705 AAATGTGAAAAAAAAAAAAAGGG + Intergenic
1019358450 7:593036-593058 AAAAATTAAAAAAAACAAAAAGG + Intronic
1019590649 7:1829038-1829060 AAAAGCGCATACAAACAAAAAGG + Intronic
1019862753 7:3675556-3675578 AAACAAACAAACAAACAAAAAGG - Intronic
1021281750 7:18728139-18728161 AAACAAACAAAAAAACAAACTGG - Intronic
1022296895 7:29063960-29063982 AAAAGTTAAAAAAAAAAAAAAGG + Intronic
1022496518 7:30856322-30856344 AAAAGTTTTAAAAAACAAAATGG + Intronic
1022586170 7:31614664-31614686 AAAGGTTATAAAAAACAAAATGG + Intronic
1022724583 7:32969324-32969346 AAACTAGGAAAAAAACACAAGGG - Intronic
1022865344 7:34412461-34412483 AAAAGTTAAAAAAAAAAAAAAGG + Intergenic
1023230310 7:38020960-38020982 AAACATGCAAAATAACCATAAGG - Intronic
1023385579 7:39653679-39653701 AAAGGTCCTAAAAAATAAAATGG - Intronic
1023688398 7:42760946-42760968 AAATGTAAAAAAAAAAAAAAAGG + Intergenic
1023854005 7:44169756-44169778 AAACAAACAAACAAACAAAAAGG + Intronic
1024003470 7:45207519-45207541 AAACATGAAAAAATACACAAAGG - Intergenic
1024354923 7:48404806-48404828 AAAGGAGAAAAATAACAAAAGGG + Intronic
1024525227 7:50342982-50343004 AAAGGAGGAAAGAAACAAAAGGG - Intronic
1024687460 7:51762064-51762086 AAAAGGACACAAAAACAAAATGG - Intergenic
1024844648 7:53628412-53628434 AAGGGTGCAAAAACACACAATGG + Intergenic
1024909002 7:54422940-54422962 AAACTTTACAAAAAACAAAATGG + Intergenic
1025049017 7:55718508-55718530 AAACTAGGAAAAAAACACAAGGG + Intergenic
1025618110 7:63141835-63141857 AAAAATACAAAAAAAAAAAAAGG + Intergenic
1026057926 7:67000980-67001002 AAACCTGAAAAAAAGCAAAAAGG + Intronic
1026152710 7:67801936-67801958 AAACATGCAGAGAACCAAAAAGG - Intergenic
1026318626 7:69249583-69249605 AAAAATCCAAAAACACAAAAAGG - Intergenic
1026575530 7:71568181-71568203 AAGCGTGCAGTAAAGCAAAAGGG + Intronic
1026720171 7:72824055-72824077 AAACCTGAAAAAAAGCAAAAAGG - Intronic
1026995866 7:74615988-74616010 AAAAATGTAAAAAAAAAAAAAGG - Intergenic
1027046659 7:74995505-74995527 AAAAATGAAAAAAAAAAAAAAGG + Intronic
1027135183 7:75618850-75618872 AAACTTGGAAGAAAAAAAAAAGG - Intronic
1027364897 7:77447193-77447215 AAACAAGCCAACAAACAAAAAGG - Intergenic
1027554450 7:79646288-79646310 AAACAAACAAACAAACAAAAAGG - Intergenic
1027663205 7:81012473-81012495 AAACAAACAAACAAACAAAAAGG - Intergenic
1027700187 7:81460035-81460057 ACCCTTGCAATAAAACAAAAGGG + Intergenic
1027786706 7:82589322-82589344 AAAGGTGAAAAAGAAAAAAATGG - Intergenic
1027812854 7:82927534-82927556 AAACCTGGAGAAAAAGAAAAAGG - Intronic
1028171955 7:87608658-87608680 AAACGATAAAAAAAACTAAAAGG - Intronic
1028415538 7:90576437-90576459 AAAAGTGAAAATAAACAAATGGG + Intronic
1028501338 7:91521522-91521544 AAACAAACAAACAAACAAAAAGG - Intergenic
1028731538 7:94156768-94156790 AAAGGTGGGAGAAAACAAAAAGG + Intergenic
1028952513 7:96652845-96652867 AAAAGTGGAAACAAAGAAAAGGG - Intronic
1029264827 7:99330304-99330326 AAACAAACAAACAAACAAAAAGG - Intronic
1029480741 7:100811370-100811392 AAATGTGAAAAAAAGCAAACGGG - Intronic
1029567342 7:101347816-101347838 ATACGTGCATAAATATAAAAAGG - Intergenic
1029818179 7:103118426-103118448 AAACTAGCAAAAAACAAAAAGGG + Intronic
1030005692 7:105117508-105117530 AAACCTGCCAAAACACAAAGGGG + Exonic
1030033862 7:105391934-105391956 AAAGGTGGAAAAAACCTAAATGG + Intronic
1030265516 7:107616731-107616753 AAACAAACAAACAAACAAAATGG - Intronic
1030432074 7:109462451-109462473 AAAGGTGGAAAAAGGCAAAATGG - Intergenic
1030476417 7:110038924-110038946 AAACAAACAAAAAAACAAACTGG - Intergenic
1030654542 7:112151756-112151778 AGATGTGGAAAAAAAAAAAAAGG + Intronic
1030874634 7:114798223-114798245 AAAATTGCAAAAAAAAAAAAAGG - Intergenic
1031146077 7:117998486-117998508 AAAATTGGAAAAAAATAAAATGG + Intergenic
1031406141 7:121389755-121389777 AAAGTGGCAAAAAAAAAAAAAGG + Intronic
1031476954 7:122234941-122234963 AAAATTGCAAAAAAAAAAAGAGG + Intergenic
1031506415 7:122590171-122590193 AAACAAACAAAAAAACAAAGTGG + Intronic
1031602731 7:123731792-123731814 AAATGTGCTAGAAAAGAAAAAGG + Intronic
1031660290 7:124415963-124415985 AAACAAACAAAAAAACAGAAGGG + Intergenic
1031667444 7:124502406-124502428 AAAATAGCAAAAAAAGAAAACGG + Intergenic
1032352244 7:131175599-131175621 AAACATACAAAAATACAAATAGG + Intronic
1032620138 7:133521601-133521623 AAACGAACAAAAAAAAAACACGG - Intronic
1032682993 7:134204534-134204556 AAACATGCCAAAAAAACAAAGGG - Intronic
1032746757 7:134793817-134793839 AAAGGTTTAAAAAAAAAAAATGG - Intronic
1032761367 7:134946669-134946691 AAAAGAGAAAAAAAAAAAAAAGG - Intronic
1032869605 7:135969467-135969489 TAACGTGCAAAAAAAAAAAGAGG + Intronic
1032918018 7:136512814-136512836 AAACATGAAAAAATAGAAAAGGG - Intergenic
1033454245 7:141488198-141488220 AAATGGTCATAAAAACAAAATGG + Intergenic
1033508732 7:142033090-142033112 AAACATGCACAAATTCAAAAGGG + Intronic
1033763450 7:144461911-144461933 AAACCTACAAAAAAACTGAAGGG - Intronic
1033837248 7:145330245-145330267 AAATGTGCCAAATACCAAAAAGG - Intergenic
1033933153 7:146549057-146549079 CCACATGCAAAAAAAAAAAAAGG - Intronic
1034317625 7:150148176-150148198 AAAAGGGGAAAAAAAAAAAAAGG + Intergenic
1034775132 7:153819048-153819070 AAAGGGGAAAAAAAAAAAAAAGG - Intergenic
1034912503 7:155008842-155008864 ACACGTCCAAGAAAAGAAAATGG + Intergenic
1035096863 7:156362862-156362884 AAACATGTAGAAATACAAAAAGG + Intergenic
1035425893 7:158772888-158772910 AAAAGTTAAAAAAAAAAAAAAGG + Intronic
1035463524 7:159061342-159061364 AAAGTTGAAAAAAAAAAAAAAGG + Intronic
1035736469 8:1890804-1890826 AAAAGTGCCATACAACAAAAAGG - Intronic
1035974297 8:4290092-4290114 AGATGTGCAACAAAACCAAACGG + Intronic
1036004997 8:4652376-4652398 AAACAGACAAAAAAACAGAATGG - Intronic
1036162167 8:6399347-6399369 AAACAAACAAAAAAACCAAAGGG + Intergenic
1036683345 8:10892164-10892186 AAACATGTAAAAAGGCAAAAAGG - Intergenic
1036761454 8:11512074-11512096 AAACAACCAAACAAACAAAATGG + Intronic
1036972438 8:13369908-13369930 AAACTTAAAAAAAAAAAAAATGG + Intronic
1037057617 8:14462267-14462289 AGAGGTGCAAGAAAAAAAAATGG + Intronic
1037141221 8:15522540-15522562 CAAGGTGAAAAAAAAAAAAAAGG - Intronic
1037166449 8:15835446-15835468 AAACTAGCAAATAAACATAAAGG - Intergenic
1037511721 8:19589880-19589902 ATATGTGAAAAAAACCAAAAAGG + Intronic
1038030098 8:23630744-23630766 AAACGTAACAAAAAACAATAAGG + Intergenic
1038126378 8:24677852-24677874 AGGCATGCAAAGAAACAAAATGG + Intergenic
1038136280 8:24789805-24789827 AAACAATCAATAAAACAAAAAGG - Intergenic
1038496878 8:28009738-28009760 AAACAAACAAACAAACAAAATGG + Intergenic
1038704883 8:29884343-29884365 AAAGGAGAAAAAAAAAAAAAGGG + Intergenic
1038986368 8:32815819-32815841 AACTTTGCAAAAAAAGAAAAGGG + Intergenic
1039080025 8:33724907-33724929 AAAAGTGCAGAAAAATAATAGGG - Intergenic
1039134086 8:34299827-34299849 ACACGTGCAAAGAAACATATAGG + Intergenic
1039152365 8:34520795-34520817 AAATGTGCTATAAACCAAAAAGG - Intergenic
1039346331 8:36709739-36709761 AAGGGTGCAAAAAAATAAAATGG + Intergenic
1039353814 8:36793553-36793575 ATAGGTGCAAGAAACCAAAAAGG - Intronic
1039415777 8:37392879-37392901 AAAAGTGCCAAACAATAAAAAGG + Intergenic
1039661621 8:39473925-39473947 ATACGTACAAAAAATCACAACGG + Intergenic
1039823360 8:41153312-41153334 AAATGTGTCAAACAACAAAATGG - Intergenic
1039883187 8:41639568-41639590 CAATGTGCAGATAAACAAAATGG - Intergenic
1040123030 8:43703155-43703177 CAACGTGCTAAATAAAAAAAAGG - Intergenic
1040483464 8:47848647-47848669 AAAAATGAAAAAAAAAAAAAAGG + Intronic
1040716411 8:50258393-50258415 AAACATGCAAAGAGACAAGAAGG + Intronic
1040774494 8:51023383-51023405 AAATGTAAAAAAAAAAAAAAAGG - Intergenic
1041057462 8:54001621-54001643 AAACGTGCAAAAAAATAAAATGG + Intronic
1041648949 8:60281954-60281976 AAACGTTTAAGAAAAGAAAATGG + Intergenic
1041756471 8:61318765-61318787 AAACAAACAAACAAACAAAAAGG - Intronic
1041890798 8:62866066-62866088 AAATATGCAAAAATACAAATGGG - Intronic
1042353314 8:67800080-67800102 AAACAGGCAAACAAACAAAAAGG + Intergenic
1042358376 8:67854547-67854569 AAACAAACAAACAAACAAAAAGG + Intergenic
1042517895 8:69678794-69678816 AAAACTGAAAAAAAAAAAAAGGG + Intronic
1042588359 8:70368446-70368468 AAAAGACCAAAAAAGCAAAATGG + Intronic
1042777996 8:72456303-72456325 AAAGGCTCAACAAAACAAAAAGG - Intergenic
1043137983 8:76551675-76551697 ACACGTGCAGAAACACACAATGG + Intergenic
1043347169 8:79312017-79312039 AGAAGTGCAAAAAAAGAAAAAGG + Intergenic
1043679632 8:83006781-83006803 TAACATGCAAAAATATAAAATGG + Intergenic
1043756256 8:84007340-84007362 AACCAAGCAAATAAACAAAATGG + Intergenic
1043875149 8:85477543-85477565 TAACTGGCAAAAAAAAAAAAAGG - Intronic
1044153932 8:88818854-88818876 AAACAAACAAACAAACAAAAAGG - Intergenic
1044154335 8:88824461-88824483 AACCATGAAAAGAAACAAAAAGG + Intergenic
1044157357 8:88864017-88864039 AAATGAGAAAAAAAAAAAAATGG - Intergenic
1044324270 8:90842197-90842219 AAAGGTGGAAAATAATAAAAAGG + Intronic
1044354568 8:91206067-91206089 AAAGGTGAACAAAACCAAAATGG - Intronic
1044568250 8:93688799-93688821 AAACAAACAAACAAACAAAAAGG + Intergenic
1044639439 8:94363070-94363092 AAAACTGCAAAAAAAAAAAATGG + Intergenic
1044718939 8:95127177-95127199 AAACAAACAAACAAACAAAAAGG + Intergenic
1044802201 8:95968740-95968762 AAAGGAGGAAAAAAACAAGAGGG + Intergenic
1044829649 8:96234779-96234801 AAACAAACAAACAAACAAAACGG + Intronic
1045066413 8:98450486-98450508 AAAAGTGCAAAAGAACAACTGGG + Intronic
1045298250 8:100890941-100890963 AAAAGTTCAAAAGAAGAAAAGGG + Intergenic
1045303610 8:100936806-100936828 AAACAAACAAACAAACAAAAAGG + Intronic
1045441504 8:102217820-102217842 AAAGGTTTAAAAAAAAAAAAAGG + Intronic
1045720252 8:105101498-105101520 AAGCGTGGAAACAAACAATAGGG + Intronic
1045766671 8:105680216-105680238 AAACATCCTAAAAAAGAAAATGG - Intronic
1046078583 8:109342163-109342185 ATAAATGCAAAAAAAAAAAAAGG - Intronic
1046123290 8:109871751-109871773 AAAAGTGAAAAAAATTAAAAGGG + Intergenic
1046267955 8:111856609-111856631 AAAAGATCAATAAAACAAAAAGG + Intergenic
1046434824 8:114174014-114174036 AAGCATGCAAAAAAACTACATGG - Intergenic
1046536721 8:115523685-115523707 CAACCTGAAACAAAACAAAAAGG + Intronic
1046645707 8:116783261-116783283 AAATTTGCAAAAAAACAAAGGGG - Intronic
1047168784 8:122469106-122469128 AAACCAGCAAAAAACAAAAAAGG + Intergenic
1047198509 8:122743500-122743522 GTATGTGCAAAAAAAAAAAAAGG + Intergenic
1047312380 8:123703519-123703541 AAATGTTTTAAAAAACAAAAAGG + Intronic
1047484108 8:125313095-125313117 TAAAGTGGAAAAAAAAAAAAGGG + Intronic
1047643312 8:126843926-126843948 TTACGTCCAAAAAAATAAAAGGG + Intergenic
1048126539 8:131641663-131641685 AAAAATGTAAAAAAACAAATTGG + Intergenic
1048167124 8:132072635-132072657 AAACCTGGAAATAAACAAAAAGG + Intronic
1048501402 8:134978752-134978774 AAAGGAGAAAAAAAAAAAAAAGG - Intergenic
1048524163 8:135186228-135186250 AAAAGTGGATAAAATCAAAAAGG + Intergenic
1048583709 8:135752719-135752741 AAACCTGAGAAGAAACAAAATGG - Intergenic
1048754449 8:137721158-137721180 CAACATGTAAAACAACAAAAAGG - Intergenic
1048779687 8:137987551-137987573 AAAGGGGGAAAAAAACTAAAAGG + Intergenic
1049826027 8:144668871-144668893 AATCTTGAAAAAGAACAAAATGG + Intergenic
1050053505 9:1627649-1627671 AAACGGGCAAAAGACCCAAATGG + Intergenic
1050270572 9:3940268-3940290 AAACGTGAAAAAAAATAAGAAGG - Intronic
1050368813 9:4900214-4900236 AAACATGGAAAGAAACAACAAGG - Intergenic
1050379957 9:5018318-5018340 AAACAAACAAACAAACAAAAAGG - Intronic
1050419575 9:5449595-5449617 AAAAGAGAAAAAAAAGAAAAGGG + Intergenic
1050579778 9:7040973-7040995 AAAGGTGAAAAAAGAGAAAAGGG - Intronic
1050639327 9:7650323-7650345 CCACATGCAAAAAAAAAAAATGG + Intergenic
1050661411 9:7886904-7886926 AAACATGGAAAAAAATAAAGTGG + Intronic
1050851546 9:10293461-10293483 AAACAAACAAACAAACAAAAAGG + Intronic
1050856734 9:10367074-10367096 AAACATAAAAAAAAAAAAAAAGG + Intronic
1051074901 9:13221796-13221818 AAAAGTTCAAAGAAAAAAAAAGG + Intronic
1051537096 9:18171946-18171968 AAACGTGAAAAAACAAGAAATGG - Intergenic
1051563120 9:18465504-18465526 ACACGTGGAAAAAAGGAAAAAGG + Intergenic
1052101834 9:24456360-24456382 AAAAATTCAAAAAAATAAAATGG - Intergenic
1052510915 9:29418928-29418950 AAACGGGAAAAAAAAGCAAAAGG - Intergenic
1052768256 9:32663577-32663599 CAATGTGCAAAAACAAAAAAAGG + Intergenic
1052818465 9:33120187-33120209 AAACAAACAAAAAAAAAAAAGGG + Intronic
1052822841 9:33152549-33152571 AAAAGGGTAAAAAAAAAAAAGGG + Intronic
1053153804 9:35759916-35759938 AAAAATGAAAAAAAAAAAAAAGG - Intergenic
1053260406 9:36658689-36658711 AAACAAACAAACAAACAAAAAGG - Intronic
1053684780 9:40511047-40511069 AAACGTGAGAAAGAACAGAATGG - Intergenic
1053934744 9:43139330-43139352 AAACGTGAGAAAGAACAGAATGG - Intergenic
1054278947 9:63113909-63113931 AAACGTGAGAAAGAACAGAATGG + Intergenic
1054395889 9:64651028-64651050 AAACGTGAGAAAGAACAGAATGG - Intergenic
1054412966 9:64840696-64840718 AAACTTGAAAAAAAAGAAAGAGG - Intergenic
1054430533 9:65156223-65156245 AAACGTGAGAAAGAACAGAATGG - Intergenic
1054499847 9:65865298-65865320 AAACGTGAGAAAGAACAGAATGG + Intergenic
1055018416 9:71643955-71643977 ACATTTGCAAAAAAACAGAAAGG + Intergenic
1055083926 9:72295032-72295054 AAACTAGGAAAAAAACAAATAGG + Intergenic
1055171688 9:73266504-73266526 AAATGGGCAAAAAAAAAAAAAGG - Intergenic
1055220871 9:73929584-73929606 AAACCTCCAAACAAAGAAAAGGG + Intergenic
1055526509 9:77139206-77139228 AAATGTGCATAAGAACAAACAGG + Intergenic
1055624238 9:78157655-78157677 AAACAAGCAAAATATCAAAAAGG - Intergenic
1056180635 9:84079081-84079103 AAAAATACAAAAAAACAGAACGG - Intergenic
1056201728 9:84283568-84283590 AAAGGTCCAAAAAAAGATAAAGG - Intronic
1056373024 9:85977813-85977835 ATTAGTGCAAAAATACAAAAAGG - Intronic
1056824596 9:89868062-89868084 CAACGTGCACAAAAACATCAAGG + Intergenic
1056918297 9:90763192-90763214 AAAAGTGCAAACAAACACAGGGG - Intergenic
1057116956 9:92533409-92533431 AAACAAACAAACAAACAAAATGG - Intronic
1057375453 9:94517525-94517547 AAAAACCCAAAAAAACAAAATGG + Intergenic
1057403770 9:94748604-94748626 AAACAAACAAACAAACAAAAAGG - Intronic
1057452965 9:95182212-95182234 AAATATACAAAAAAAAAAAAAGG + Intronic
1057586794 9:96335618-96335640 AAAGGTGCAAAAGAATAAATAGG - Intronic
1057598778 9:96439216-96439238 AAATGTGTAAGAAAACAAAAGGG + Intergenic
1057741222 9:97713196-97713218 AAACATGCAAAAAATCATAGGGG + Intergenic
1057989065 9:99748782-99748804 AAACGGAAAAAAAAAAAAAAAGG + Intergenic
1058138379 9:101332892-101332914 AAACATGCATATAAACAATAGGG + Intergenic
1058260323 9:102820428-102820450 TAATGTGCAATCAAACAAAAGGG + Intergenic
1058268005 9:102931592-102931614 AAAAAAACAAAAAAACAAAAAGG - Intergenic
1058399256 9:104594801-104594823 AAATGTAAAAAAAAAAAAAAAGG - Intergenic
1058580191 9:106447458-106447480 GAAAAAGCAAAAAAACAAAAAGG + Intergenic
1059194336 9:112356574-112356596 AACAGAGCAAAAAAAAAAAATGG + Intergenic
1059500652 9:114750642-114750664 AAACAAACAAACAAACAAAAAGG - Intergenic
1059551722 9:115235929-115235951 AAACTGGAAAAAAAAAAAAAAGG - Intronic
1059828892 9:118069109-118069131 AAACTTTCAAAAAAACTAGATGG - Intergenic
1060041137 9:120302740-120302762 AAACAAACAAAAAAAAAAAAAGG - Intergenic
1060070901 9:120546612-120546634 AAAAAAACAAAAAAACAAAAGGG - Intronic
1060320882 9:122560211-122560233 TCACGTGCAAAGAAACAAATAGG - Intergenic
1060388693 9:123259055-123259077 GAAAGGGCAAAAAAAAAAAAAGG + Intronic
1060502159 9:124167473-124167495 AAAAGTTAAAAAAAAAAAAAAGG - Intergenic
1060677155 9:125525699-125525721 AAACAAACAAAAAAAAAAAAAGG + Intronic
1061049787 9:128188110-128188132 AAAAAAGCAAAAAAAAAAAAAGG + Intronic
1061383479 9:130274515-130274537 AAACTTGACAAAAAACACAAAGG - Intergenic
1062299778 9:135859390-135859412 AAACAAACAAACAAACAAAATGG - Intronic
1203752077 Un_GL000218v1:89196-89218 AAACTACCAAAAAAAAAAAAAGG + Intergenic
1185570781 X:1133344-1133366 AAACAAACAAAAAAACAAAGGGG - Intergenic
1185591387 X:1279775-1279797 AAACAAACAAAAAAAAAAAACGG - Intronic
1185665464 X:1761866-1761888 AAACAAACAAAAAAACAAATTGG - Intergenic
1186001080 X:5011306-5011328 AAACGAACAAACAAACAAAAGGG + Intergenic
1186060467 X:5699888-5699910 GAATGTGCAATAGAACAAAAAGG + Intergenic
1186395560 X:9205442-9205464 AAAGGAGAAAAAAAAAAAAAGGG + Intergenic
1186995897 X:15121854-15121876 AAAGGTGAAAAAAAGCCAAATGG + Intergenic
1187058724 X:15765485-15765507 AAACAAGCAAACAAAAAAAAAGG - Intronic
1187279661 X:17848286-17848308 AAAAATGAAAAAAAAAAAAAGGG + Intronic
1187881738 X:23853606-23853628 AAACAAACAAAAAAAAAAAACGG - Intronic
1188055251 X:25533384-25533406 AAACTTGCACCAAAAAAAAAGGG + Intergenic
1188155861 X:26741953-26741975 AAACATGTATTAAAACAAAATGG + Intergenic
1188449168 X:30290938-30290960 AAAATTTCAAAAAAATAAAAAGG + Intergenic
1188546545 X:31313812-31313834 AAAAGTTAAAAAAAAAAAAAAGG - Intronic
1188589026 X:31812040-31812062 TAAATTGCAAAAAAAAAAAATGG - Intronic
1188867914 X:35337201-35337223 AAACAAGCAAAAAACCAAAATGG - Intergenic
1188878814 X:35466851-35466873 AAACATGGAAGAAGACAAAAAGG + Intergenic
1188896806 X:35678801-35678823 AAACAAACAAACAAACAAAAAGG + Intergenic
1189171712 X:38915915-38915937 AAATATCCAAAAAAGCAAAATGG - Intergenic
1189296288 X:39920605-39920627 ATATATGCAAAAAAAAAAAAAGG + Intergenic
1189472862 X:41327731-41327753 AAACAAACAAACAAACAAAATGG - Intergenic
1189527567 X:41840953-41840975 AAATGTGGAAACAAACCAAATGG - Intronic
1189592055 X:42523895-42523917 AGACATGCAAAAAGACAAGAAGG - Intergenic
1189614418 X:42768867-42768889 AAACAAGCAAAAAGAGAAAAGGG - Intergenic
1190172906 X:48125824-48125846 AAACAAACAAAAAATCAAAAAGG + Intergenic
1190251224 X:48727491-48727513 AAACCTGTAAAAAAAAAATAGGG + Intergenic
1190299553 X:49048903-49048925 AAACAAACAAACAAACAAAAAGG - Intergenic
1190574220 X:51816835-51816857 AAAAGAGCAAAAAGATAAAAGGG + Intronic
1190594557 X:52039831-52039853 AAACATACAAACAAGCAAAAAGG - Intergenic
1190763664 X:53457850-53457872 AAAAAACCAAAAAAACAAAAAGG + Intergenic
1190972170 X:55360616-55360638 AAAAGTAAAAAAAAAAAAAAAGG - Intergenic
1191175862 X:57501381-57501403 CAACATGCATAAAAACAACAAGG + Intergenic
1191183141 X:57583151-57583173 AAACAAACAAACAAACAAAACGG - Intergenic
1191821363 X:65312508-65312530 AAAGGAGCCAAAAAAAAAAATGG + Intergenic
1192328323 X:70152462-70152484 AGACATGAAAAAAAACAAACAGG + Intronic
1192805889 X:74508954-74508976 AAACAAACAAACAAACAAAAAGG - Intronic
1192930869 X:75804632-75804654 AAATATGCAGAAAAACAGAATGG + Intergenic
1193211676 X:78813578-78813600 AAAGGATCATAAAAACAAAATGG + Intergenic
1193415505 X:81218006-81218028 AAAAGTGAAAAAAGACAAAGAGG - Intronic
1193433448 X:81441095-81441117 AAAAGTAAAAAAAAAAAAAAAGG - Intergenic
1193506289 X:82348538-82348560 AAAAGTAGAAAAAAAAAAAAGGG - Intergenic
1193518093 X:82495009-82495031 GAACATGCAACAAAAGAAAAAGG - Intergenic
1194430623 X:93799601-93799623 AAACCTGCAAATAAAAACAAAGG - Intergenic
1194713305 X:97261327-97261349 ATATGTGCAGAAAAACAAATAGG - Intronic
1194874396 X:99168572-99168594 AAACATGCAAAAACACAAATTGG + Intergenic
1194898591 X:99476625-99476647 AAACTTGTAAAAAAAAAAGATGG - Intergenic
1195082846 X:101387199-101387221 AAACAAGCAAACAAAAAAAATGG + Intronic
1195582225 X:106518374-106518396 AAAAGTGGAAACAACCAAAATGG - Intergenic
1195775718 X:108403615-108403637 AAATCTGCAAAATAACTAAATGG - Intronic
1195897310 X:109759697-109759719 AACCATACAACAAAACAAAAAGG + Intergenic
1196128898 X:112131218-112131240 AAACTGGTAAAAAAAAAAAAAGG - Intergenic
1196209624 X:112981311-112981333 AAACAAACAAACAAACAAAATGG - Intergenic
1196301488 X:114053807-114053829 AAACAAACAAATAAACAAAATGG + Intergenic
1196346026 X:114659950-114659972 AAATAAGCAAACAAACAAAAAGG + Intronic
1196505791 X:116440178-116440200 AAAAGTGGAAAGAAAAAAAAAGG + Intronic
1196537938 X:116869195-116869217 AAACTAGCACAAAAAGAAAATGG + Intergenic
1197585459 X:128341946-128341968 ACACTTGCAAAAAAAAAAAAAGG + Intergenic
1197621149 X:128750698-128750720 AAAAGACCAAAAAAATAAAATGG + Intergenic
1197807100 X:130408000-130408022 AAAAAAGCAAACAAACAAAAAGG - Intronic
1197895913 X:131315077-131315099 AAATGCACCAAAAAACAAAATGG + Intronic
1197996943 X:132387333-132387355 AAAAATGCAAAAAAAAAAAAAGG + Intronic
1198083857 X:133264815-133264837 AAATGTAAAAAAAAAAAAAATGG + Intergenic
1198255400 X:134919946-134919968 AAACAAACAAACAAACAAAAAGG + Intergenic
1198276561 X:135099472-135099494 ACACCGGCAAAAAAAAAAAAAGG - Intergenic
1198362924 X:135913658-135913680 AAACAAACAAACAAACAAAATGG + Intergenic
1198581705 X:138072871-138072893 AAACAAACAAACAAACAAAAAGG + Intergenic
1198956853 X:142142176-142142198 AAACTTGTAAAAAAAAAAATGGG + Intergenic
1198979142 X:142374836-142374858 AAATGTGAAAAAATAAAAAAAGG - Intergenic
1199467674 X:148157479-148157501 AAAAATGAAGAAAAACAAAATGG - Intergenic
1199481936 X:148307440-148307462 ATACCTCCAAAAAAATAAAAAGG + Intergenic
1200254806 X:154574752-154574774 AAACTTAAAAAAAAAAAAAAAGG + Intergenic
1200262963 X:154629656-154629678 AAACTTAAAAAAAAAAAAAAAGG - Intergenic
1200362934 X:155629911-155629933 AAAAGTGAAAATAAACAAATGGG - Intronic
1200745140 Y:6897579-6897601 AACCGACCAAAAAAAAAAAAAGG - Intergenic
1200757590 Y:7004792-7004814 AAACCTTCAGAAAAACAAAATGG - Intronic
1201912397 Y:19146131-19146153 AAACATGCAAAAAAATTAAAAGG + Intergenic
1202033993 Y:20612360-20612382 AAACAAACAAAAAAACAAACAGG + Intergenic
1202049317 Y:20764266-20764288 AATTGTGTAAAAAAAAAAAAAGG - Intronic
1202083042 Y:21104676-21104698 CAAAGTGCAGAAAAAGAAAAAGG + Intergenic
1202364617 Y:24149353-24149375 AAAAGTTCAGAAAGACAAAAAGG - Intergenic
1202506164 Y:25520769-25520791 AAAAGTTCAGAAAGACAAAAAGG + Intergenic
1202592075 Y:26495539-26495561 AAATGTTCAAAACATCAAAAAGG - Intergenic