ID: 912350135

View in Genome Browser
Species Human (GRCh38)
Location 1:109004732-109004754
Sequence GCAAAAAAACAAAAAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5014
Summary {0: 1, 1: 1, 2: 52, 3: 736, 4: 4224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912350132_912350135 18 Left 912350132 1:109004691-109004713 CCTCTGTGCATCAACAGGTGTAT 0: 1
1: 0
2: 1
3: 19
4: 259
Right 912350135 1:109004732-109004754 GCAAAAAAACAAAAAGGCAGAGG 0: 1
1: 1
2: 52
3: 736
4: 4224
912350130_912350135 26 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350135 1:109004732-109004754 GCAAAAAAACAAAAAGGCAGAGG 0: 1
1: 1
2: 52
3: 736
4: 4224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912350135 Original CRISPR GCAAAAAAACAAAAAGGCAG AGG Intronic
Too many off-targets to display for this crispr