ID: 912350136

View in Genome Browser
Species Human (GRCh38)
Location 1:109004733-109004755
Sequence CAAAAAAACAAAAAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7616
Summary {0: 1, 1: 5, 2: 59, 3: 836, 4: 6715}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912350130_912350136 27 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350136 1:109004733-109004755 CAAAAAAACAAAAAGGCAGAGGG 0: 1
1: 5
2: 59
3: 836
4: 6715
912350132_912350136 19 Left 912350132 1:109004691-109004713 CCTCTGTGCATCAACAGGTGTAT 0: 1
1: 0
2: 1
3: 19
4: 259
Right 912350136 1:109004733-109004755 CAAAAAAACAAAAAGGCAGAGGG 0: 1
1: 5
2: 59
3: 836
4: 6715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912350136 Original CRISPR CAAAAAAACAAAAAGGCAGA GGG Intronic
Too many off-targets to display for this crispr