ID: 912350136 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:109004733-109004755 |
Sequence | CAAAAAAACAAAAAGGCAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 7616 | |||
Summary | {0: 1, 1: 5, 2: 59, 3: 836, 4: 6715} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912350130_912350136 | 27 | Left | 912350130 | 1:109004683-109004705 | CCGATAGGCCTCTGTGCATCAAC | 0: 1 1: 0 2: 1 3: 3 4: 79 |
||
Right | 912350136 | 1:109004733-109004755 | CAAAAAAACAAAAAGGCAGAGGG | 0: 1 1: 5 2: 59 3: 836 4: 6715 |
||||
912350132_912350136 | 19 | Left | 912350132 | 1:109004691-109004713 | CCTCTGTGCATCAACAGGTGTAT | 0: 1 1: 0 2: 1 3: 19 4: 259 |
||
Right | 912350136 | 1:109004733-109004755 | CAAAAAAACAAAAAGGCAGAGGG | 0: 1 1: 5 2: 59 3: 836 4: 6715 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912350136 | Original CRISPR | CAAAAAAACAAAAAGGCAGA GGG | Intronic | ||
Too many off-targets to display for this crispr |