ID: 912350137

View in Genome Browser
Species Human (GRCh38)
Location 1:109004734-109004756
Sequence AAAAAAACAAAAAGGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12118
Summary {0: 1, 1: 10, 2: 166, 3: 1694, 4: 10247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912350130_912350137 28 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350137 1:109004734-109004756 AAAAAAACAAAAAGGCAGAGGGG 0: 1
1: 10
2: 166
3: 1694
4: 10247
912350132_912350137 20 Left 912350132 1:109004691-109004713 CCTCTGTGCATCAACAGGTGTAT 0: 1
1: 0
2: 1
3: 19
4: 259
Right 912350137 1:109004734-109004756 AAAAAAACAAAAAGGCAGAGGGG 0: 1
1: 10
2: 166
3: 1694
4: 10247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912350137 Original CRISPR AAAAAAACAAAAAGGCAGAG GGG Intronic
Too many off-targets to display for this crispr