ID: 912350138

View in Genome Browser
Species Human (GRCh38)
Location 1:109004735-109004757
Sequence AAAAAACAAAAAGGCAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7405
Summary {0: 1, 1: 7, 2: 107, 3: 949, 4: 6341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912350133_912350138 -10 Left 912350133 1:109004722-109004744 CCAGAAACGTGCAAAAAAACAAA 0: 1
1: 0
2: 3
3: 56
4: 664
Right 912350138 1:109004735-109004757 AAAAAACAAAAAGGCAGAGGGGG 0: 1
1: 7
2: 107
3: 949
4: 6341
912350130_912350138 29 Left 912350130 1:109004683-109004705 CCGATAGGCCTCTGTGCATCAAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 912350138 1:109004735-109004757 AAAAAACAAAAAGGCAGAGGGGG 0: 1
1: 7
2: 107
3: 949
4: 6341
912350132_912350138 21 Left 912350132 1:109004691-109004713 CCTCTGTGCATCAACAGGTGTAT 0: 1
1: 0
2: 1
3: 19
4: 259
Right 912350138 1:109004735-109004757 AAAAAACAAAAAGGCAGAGGGGG 0: 1
1: 7
2: 107
3: 949
4: 6341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912350138 Original CRISPR AAAAAACAAAAAGGCAGAGG GGG Intronic
Too many off-targets to display for this crispr