ID: 912354460

View in Genome Browser
Species Human (GRCh38)
Location 1:109043186-109043208
Sequence TGAGCTGGACCTCCCAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912354453_912354460 27 Left 912354453 1:109043136-109043158 CCGTCTCACAGAAAAAAGAACAT 0: 1
1: 2
2: 16
3: 470
4: 10361
Right 912354460 1:109043186-109043208 TGAGCTGGACCTCCCAAAAGGGG 0: 1
1: 0
2: 0
3: 22
4: 184
912354455_912354460 1 Left 912354455 1:109043162-109043184 CCTCACAGAGGCGAAAGTCCAGA 0: 1
1: 0
2: 0
3: 9
4: 142
Right 912354460 1:109043186-109043208 TGAGCTGGACCTCCCAAAAGGGG 0: 1
1: 0
2: 0
3: 22
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912354460 Original CRISPR TGAGCTGGACCTCCCAAAAG GGG Intergenic
904435480 1:30492232-30492254 TGTGCTGGACCACGCAGAAGGGG - Intergenic
904496614 1:30890897-30890919 TGAGCTGGGCCTCCCACTTGTGG - Intronic
906584644 1:46965648-46965670 TGAGTGAGACCTCCCAACAGGGG - Intergenic
910626990 1:89317311-89317333 TGGGATAGACCTCCCAACAGGGG + Intergenic
912354460 1:109043186-109043208 TGAGCTGGACCTCCCAAAAGGGG + Intergenic
915844853 1:159252499-159252521 TGGGCAGGACCTCCCAACTGGGG + Intergenic
916739156 1:167632960-167632982 TGAGTTTCACCTCTCAAAAGAGG - Intronic
917449796 1:175137986-175138008 GGAGCTGGATCTGCAAAAAGGGG + Intronic
919583277 1:199404380-199404402 TGATCTGGACCTGCCTAAACAGG + Intergenic
920251713 1:204626341-204626363 TGAGCAGGAAAGCCCAAAAGAGG - Intronic
921880892 1:220253199-220253221 TGGGTGGGACCTCCCAACAGGGG + Intronic
921886844 1:220315619-220315641 TGAACTGGACATCGCTAAAGAGG - Intergenic
1066050960 10:31634764-31634786 TGAGCTGGAGGTCTCAACAGTGG - Intergenic
1069759327 10:70797931-70797953 TGGGCAGGACCTCCCAACGGGGG - Intergenic
1070054731 10:72923945-72923967 TGAGGGGGACCTCCCAACTGGGG - Intronic
1070470541 10:76775030-76775052 TGTGCTCCACCTCCCACAAGGGG - Intergenic
1071054093 10:81488716-81488738 TGAGCTGTACATCTCAACAGTGG - Intergenic
1073255539 10:102148615-102148637 AGAGCTGTACCTGACAAAAGAGG - Exonic
1075165784 10:120067093-120067115 TGGGCTGTAGCTGCCAAAAGAGG + Intergenic
1076761977 10:132610459-132610481 TGTGCTGGACTTCCCAAGCGAGG + Intronic
1077520291 11:3029220-3029242 TGAGCTGGCCTTGCCAAAACAGG + Intronic
1078294707 11:10056698-10056720 TGAGCAGGACCTCCCAACCAGGG + Intronic
1078294763 11:10056964-10056986 TGGGTGGGACCTCCCAAAAAGGG + Intronic
1078610245 11:12813441-12813463 TGGGCTGGACATCCCAAATGTGG + Intronic
1080214764 11:29827767-29827789 TGAGTGAGACCTCCCAACAGGGG + Intergenic
1081754178 11:45532841-45532863 TGAGCTGGAGCTCAGAAATGGGG - Intergenic
1082938677 11:58680640-58680662 TGAGCAGGACCTCCCAACCATGG + Intronic
1083008094 11:59367784-59367806 TGGGCAGGACCTCCCAACTGGGG + Intergenic
1084445808 11:69202859-69202881 TGAGTTCAACCTCCCAAGAGGGG + Intergenic
1084747797 11:71184239-71184261 AGAGCTGGCCCACCCAAAAATGG - Intronic
1086021763 11:82239330-82239352 AGGGTGGGACCTCCCAAAAGGGG - Intergenic
1086991005 11:93303811-93303833 TGAGTGGGACCTCCCAACTGGGG + Intergenic
1089023152 11:115239294-115239316 TGAGGTGGAGCTGCCAAAAGTGG + Intronic
1090939064 11:131371906-131371928 TGAGCCTCACCTCCCAAGAGAGG - Intronic
1091603774 12:1933839-1933861 TGAGCTGGACCTCCACGAACAGG - Intergenic
1097582967 12:61481122-61481144 TGAGCGGGACCTCCCAACCGGGG + Intergenic
1104434174 12:128742743-128742765 TGAGGCTGACCTCCCAAGAGAGG + Intergenic
1105068054 12:133217108-133217130 AGGACTGGACCTCCCAAAAGGGG - Intergenic
1105742206 13:23338516-23338538 TCATCTGGACCTCTAAAAAGTGG + Exonic
1109439414 13:62349773-62349795 TGAGTGAGACCTCCCAACAGAGG + Intergenic
1111702815 13:91712076-91712098 TTATCTTGACCTCCTAAAAGTGG + Intronic
1112972093 13:105273476-105273498 TGAGATGGAGCTCCCAGAGGCGG - Intergenic
1113696223 13:112348140-112348162 TGCGCTCGGCCTCACAAAAGCGG - Intergenic
1113766688 13:112885948-112885970 GAGGCTGGACCTCCCTAAAGGGG - Exonic
1115339156 14:32273396-32273418 TGGGCGAGACCTCCCAACAGGGG + Intergenic
1118957585 14:70497223-70497245 TGAGCAGGACCTCCCAACTCAGG + Intergenic
1118957642 14:70497496-70497518 TGGGCAGGACCTCCCAACCGGGG + Intergenic
1122060679 14:99134767-99134789 TCAGCTGGAACTCTCTAAAGGGG - Intergenic
1122271705 14:100571187-100571209 TGGGCTGGACCACCAGAAAGAGG - Intronic
1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG + Intergenic
1123983575 15:25624603-25624625 AGAGCTGGAGTTCCCAGAAGAGG + Intergenic
1125966807 15:43881320-43881342 TGAGATGTACACCCCAAAAGAGG + Intronic
1130030335 15:80308200-80308222 TGAGTGAGACCTCCCAACAGGGG - Intergenic
1131187055 15:90283712-90283734 GGAGCTGGATATCCAAAAAGAGG - Intronic
1133733658 16:8597284-8597306 TGAGTTGCAGCTCCCCAAAGTGG + Intergenic
1135375487 16:21943573-21943595 TGAGTGAGACCTCCCAATAGGGG - Intergenic
1135502431 16:23008255-23008277 TCAGCTGCTCCTCCTAAAAGTGG - Intergenic
1136044086 16:27601892-27601914 TGAAATGGACCTCCCAACACAGG - Intronic
1137259631 16:46814230-46814252 AGAGCTGTTCCTCCCAAAGGAGG + Intronic
1137828924 16:51525449-51525471 TGAGCTGCACCTTCCAATTGAGG - Intergenic
1138235571 16:55379747-55379769 TGAGCTGGAGCTCAGGAAAGAGG - Intergenic
1142203297 16:88771229-88771251 TGGTCTGGACCTCCCAAGGGGGG - Intronic
1147461062 17:40569237-40569259 TGGGCAGGACCTCCCAACTGTGG + Intergenic
1147664569 17:42138413-42138435 AGAGCTGGACCTCCTGAAGGTGG - Intronic
1149505339 17:57189477-57189499 TAGGCTGGAACTCCCAGAAGTGG - Intergenic
1151933923 17:77249623-77249645 TGAGGTGGGCCCCCCAAAATGGG - Intergenic
1152537141 17:80957399-80957421 TGAGCTGGAACTCCCAAGTCCGG - Intronic
1152954762 18:28788-28810 TGGGCAAGACCTCCCAACAGGGG + Intergenic
1155091427 18:22515197-22515219 TGGGCTTGACCTCCCAACTGGGG - Intergenic
1158006184 18:52674433-52674455 TCAGATGGCCCTCCCAAAAATGG - Intronic
1163294062 19:16400934-16400956 TGAGCAGGACAAGCCAAAAGCGG + Intronic
1166911754 19:46163985-46164007 TGGGCAGGACCTCCCAAATGGGG - Intergenic
1166967455 19:46538126-46538148 TGAGCTGGAACACCCAAGATGGG - Intronic
1167755384 19:51409957-51409979 TGATCTAGACCCCCCAAGAGAGG + Intergenic
1202636503 1_KI270706v1_random:48683-48705 TGTACAGGACCTCCCAAATGGGG - Intergenic
926741173 2:16111925-16111947 TGAGGTGGAGCAGCCAAAAGAGG - Intergenic
930229325 2:48827422-48827444 TGGGCAGGACCTCCCAACTGGGG + Intergenic
930585989 2:53267770-53267792 TGGGCAGGACCTCCCAACTGGGG + Intergenic
931319461 2:61162011-61162033 TAACCTGGACCTCTCAGAAGAGG + Intronic
933482633 2:82876295-82876317 TGGGTGAGACCTCCCAAAAGGGG + Intergenic
934698832 2:96422364-96422386 TGAGAGAGACCTCCCAACAGGGG - Intergenic
934810168 2:97270675-97270697 TGGGCGGGACCTCCCAACTGGGG - Intergenic
934827524 2:97437264-97437286 TGGGCGGGACCTCCCAACTGGGG + Intergenic
936171588 2:110181333-110181355 TGGGTGAGACCTCCCAAAAGGGG + Intronic
937568930 2:123333432-123333454 TGGGCGGGACCTCCCAAATGGGG + Intergenic
938568033 2:132538487-132538509 TGGGAAAGACCTCCCAAAAGGGG - Intronic
939018285 2:136927300-136927322 TGAGCTGGACCTGCCTCAGGTGG + Intronic
940049312 2:149445179-149445201 TGAGCAGTAGATCCCAAAAGGGG + Intronic
940587293 2:155669640-155669662 TGAGGTGGACCTCCAAAATTTGG - Intergenic
940615049 2:156039044-156039066 TGAGTGAGACCTCCCAACAGGGG + Intergenic
943467357 2:188244695-188244717 TGAGCTGGACCTTCCTTAAAAGG - Intergenic
943612016 2:190045166-190045188 TGGGTGGGACCTCCCAAAAGGGG - Intronic
945043500 2:205762351-205762373 TGTGCTGGACCTCCCATCAGTGG - Intronic
946059767 2:216931866-216931888 TGAGCTGGGCCTCCAGAAACAGG + Intergenic
946334983 2:219030390-219030412 TGCGCTGGGCCTGCCCAAAGGGG + Intronic
946749149 2:222875768-222875790 TGAACTGGACAACCCAAAAGGGG - Intronic
1169331706 20:4721523-4721545 TGAGCTGAACCTCCCCACAGAGG + Intergenic
1169421256 20:5462818-5462840 TGAGAGAGACCTCCCAACAGGGG - Intergenic
1170848369 20:19981473-19981495 TAAGCTCCACCTCCCAGAAGCGG + Intronic
1170996755 20:21368548-21368570 TGGGCTTGTCCTCTCAAAAGCGG - Exonic
1171525917 20:25810923-25810945 TGAGCTGTAGGTCTCAAAAGTGG - Intronic
1171550910 20:26044961-26044983 TGAGCTGTAGGTCTCAAAAGTGG + Intergenic
1179310442 21:40191038-40191060 TGAGCTTGACCTCAGAAATGGGG - Intronic
1180133493 21:45844259-45844281 TGTGCAAGACCTCCCTAAAGTGG - Intronic
1180253989 21:46610016-46610038 TGTGATGGACCTCCCTGAAGGGG + Intergenic
1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG + Intergenic
1181309424 22:21936485-21936507 TGAGCTCCACCTCGCAAAAGGGG - Intronic
949140095 3:622041-622063 TGAGCTAGAACTCCAAAAATAGG - Intergenic
950413056 3:12851422-12851444 TGAGATTGACCTCCCGAATGTGG + Intronic
950533423 3:13566245-13566267 TCAGCTGGAGCTCCCAGGAGGGG + Intronic
952949722 3:38512734-38512756 TGGGCTGGACTTGCCATAAGAGG - Intronic
954676070 3:52316055-52316077 TGAGCTGGGCCTCCTGAGAGTGG + Intergenic
959479431 3:106853589-106853611 TGAGAGAGACCTCCCAACAGGGG + Intergenic
960127023 3:114010903-114010925 AGAGCTGGCTCTCACAAAAGAGG - Exonic
962188722 3:133287990-133288012 GGACCTGGAGATCCCAAAAGAGG + Intronic
963008904 3:140751180-140751202 GGAGCTGGCCTCCCCAAAAGTGG + Intergenic
963756064 3:149235907-149235929 TGGGCAAGACCTCCCAACAGGGG + Intergenic
966340841 3:178923807-178923829 TGGGCAGGACCTCCCAAATGGGG + Intergenic
968358960 3:198133351-198133373 TGGGCAAGACCTCCCAACAGGGG - Intergenic
972153501 4:36126608-36126630 TTAGCTGGACCCTTCAAAAGTGG - Intronic
973394296 4:49580383-49580405 TGTACAGGACCTCCCAAATGGGG + Intergenic
974991210 4:69093164-69093186 TGGGTGGGACCTCCCAACAGGGG - Intronic
975021927 4:69501349-69501371 TGGGCGGGACCTCCAAACAGGGG + Intronic
975177982 4:71309430-71309452 TGAGAGAGACCTCCCAACAGGGG + Intronic
976527806 4:86114629-86114651 TGAGTGAGACCTCCCAACAGGGG - Intronic
977889273 4:102289268-102289290 TGAGCTGTAGGTCCCAACAGTGG - Intronic
979253587 4:118589838-118589860 TGAGCTGGAGCCCACAAAAATGG - Intergenic
981400100 4:144303660-144303682 GGAGCTGTGCCTGCCAAAAGTGG + Intergenic
981564675 4:146087104-146087126 TGAGCAGTAACTCCCAACAGTGG + Intergenic
981749110 4:148076441-148076463 TGAGCTGGGCTGCCCAAATGAGG - Intergenic
981790877 4:148535550-148535572 TGGGTGAGACCTCCCAAAAGGGG - Intergenic
983898964 4:173113054-173113076 TGGGCAGGACCTCCCAAATGGGG + Intergenic
1202763819 4_GL000008v2_random:134553-134575 TGTACAGGACCTCCCAAATGGGG - Intergenic
986210282 5:5665264-5665286 TGGGCTGGACCTCCCAGAGCTGG - Intergenic
987074535 5:14368461-14368483 TGATCAGGACCTCCCAGAATGGG - Intronic
989608161 5:43266030-43266052 TGAGCGGCACCTCCCAGTAGGGG - Intronic
989823509 5:45825129-45825151 TGAGCAGGAAATCCCAAAAGAGG - Intergenic
991143464 5:63273818-63273840 TGAGTGGAACCTCCCAAATGGGG - Intergenic
991157708 5:63458641-63458663 TGGGCAGGACCTCCCAAATGGGG + Intergenic
991953939 5:71973367-71973389 AGAGCGGTACCTCCAAAAAGGGG - Intergenic
992271341 5:75066697-75066719 TGAGCTGTACATCTCAACAGTGG - Intergenic
994018028 5:94990950-94990972 TGTGCTGGACTTACTAAAAGAGG + Intronic
994569367 5:101495064-101495086 TGAGCTGGACCTGCAAAAGCAGG - Intergenic
994965822 5:106669565-106669587 TGGACTGGACCTCCAAAGAGGGG - Intergenic
996572332 5:124945619-124945641 TGAGCTGGACCTAACGAAAACGG - Intergenic
997205163 5:132043858-132043880 TGGGCAGGACCTCCCAACTGGGG - Intergenic
997365496 5:133322724-133322746 AGTTCTGGACCTCCCAAATGAGG + Intronic
1000491545 5:161920592-161920614 TTAGCTGAACCCCCCAAAAAGGG + Intergenic
1001632608 5:173187279-173187301 TCAACTGGGCCTCCCCAAAGTGG - Intergenic
1003492948 6:6639810-6639832 TGTGCAGGACCCCCCAAAAGTGG - Intronic
1004434278 6:15575787-15575809 TGAGGGGGACCTCCCAGAAGAGG + Intronic
1007448987 6:41928904-41928926 TGAGTAGGACCTCAGAAAAGAGG + Intronic
1008082708 6:47210434-47210456 TGAGTGAGACCTCCCAACAGGGG + Intergenic
1011824189 6:91287083-91287105 GGGGCTGGAATTCCCAAAAGTGG - Intergenic
1012616359 6:101283761-101283783 TGAGCAGGACCTCCCAACCGGGG + Intergenic
1015197164 6:130536725-130536747 TGGGCAGGACCTCCCAACTGGGG + Intergenic
1022960855 7:35425041-35425063 TGAGCTGGCCCACCCAGCAGAGG + Intergenic
1024426296 7:49230141-49230163 TGAGCGGGGCCTCACAACAGTGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1028641073 7:93042892-93042914 AGAGCTGCACTTCTCAAAAGTGG - Intergenic
1028815295 7:95136997-95137019 TGAGCTGGACCTTCAAGAAAAGG + Intronic
1030809633 7:113957547-113957569 TGGGCAGGACCTCCCAACTGAGG + Intronic
1032567240 7:132959193-132959215 TGAGCTCTAACTCCCAAATGAGG + Intronic
1037702671 8:21289220-21289242 AGAGAAGGACCTTCCAAAAGTGG - Intergenic
1039378932 8:37066923-37066945 TGGGCTGGAGCTCCCCACAGTGG - Intergenic
1039489418 8:37936393-37936415 TAACCTTGACCTCCCAAAGGAGG + Intronic
1041390002 8:57339514-57339536 CGGGCTGGTCCTCCCAAAGGGGG + Intergenic
1041889831 8:62856615-62856637 TGAACTGGACATCACTAAAGAGG + Intronic
1042644289 8:70968888-70968910 TGTGTAAGACCTCCCAAAAGGGG - Intergenic
1045144756 8:99329074-99329096 TGAGCTAGACTTTTCAAAAGAGG - Intronic
1046255696 8:111694101-111694123 TGAGGTGGAGCTCCCAGAGGAGG - Intergenic
1052311770 9:27075722-27075744 TGGGCAGGACCTCCCAGCAGGGG - Intergenic
1056436242 9:86578177-86578199 TGTACTGGACCACCCAAGAGCGG + Intergenic
1060153904 9:121305814-121305836 TGGGCTGGACCTGCCAAGTGCGG - Intronic
1061138717 9:128751572-128751594 TGAGCTGGGCCTCCCCACTGGGG + Intronic
1062110067 9:134777411-134777433 TGAGCAGCACCTCCCATTAGAGG - Intronic
1062743094 9:138192484-138192506 TGGGCAAGACCTCCCAACAGGGG - Intergenic
1062743343 9:138194485-138194507 TGGGCAAGACCTCCCAACAGGGG - Intergenic
1062743592 9:138196486-138196508 TGGGCAAGACCTCCCAACAGGGG - Intergenic
1203544571 Un_KI270743v1:119426-119448 TGTACAGGACCTCCCAAATGGGG - Intergenic
1189367059 X:40396985-40397007 AGAGCTGGACCTGCCATGAGAGG + Intergenic
1189560142 X:42183872-42183894 TGAGCTAGAGCTTACAAAAGTGG - Intergenic
1191019337 X:55842723-55842745 TGGGCAGGACCTCCCAACAAGGG - Intergenic
1191155185 X:57266155-57266177 TGAACAAGACCTCCCAACAGGGG + Intergenic
1192537650 X:71942012-71942034 TGAGCTGGACTTAGCATAAGAGG - Intergenic
1192573266 X:72223380-72223402 TCAGCAGGACCTCCTAAATGCGG + Intronic
1192891785 X:75398646-75398668 TGGGCGGGACCTCCCAACTGGGG + Intronic
1192915980 X:75651897-75651919 TGAGAGAGACCTCCCAACAGGGG - Intergenic
1193360563 X:80574392-80574414 TGAAGTGGACCTCACAAAGGTGG + Intergenic
1193712340 X:84894616-84894638 TGGGCTGAACCTCCCAAGTGGGG - Intergenic
1193715143 X:84928092-84928114 TGGGCAGGACCTCCCAAATGGGG - Intergenic
1194710387 X:97229401-97229423 TGAGATGCACTTCCTAAAAGTGG + Intronic
1194776459 X:97971289-97971311 AAATCTGGACCTACCAAAAGTGG - Intergenic
1194899875 X:99497356-99497378 TGAGCAGGGCCTCCCAACATGGG + Intergenic
1194947944 X:100091309-100091331 TGGGCAGGACCTCCCAACAGGGG + Intergenic
1194988359 X:100517094-100517116 TGAGAAAGACTTCCCAAAAGAGG + Intergenic
1195473609 X:105260356-105260378 TGGGCGGGACCTCCCAAACTGGG - Intronic
1195730197 X:107959354-107959376 TGGGAGGGACCTCCCAACAGGGG - Intergenic
1195844178 X:109208730-109208752 TGGGAGAGACCTCCCAAAAGGGG - Intergenic
1197077019 X:122364580-122364602 TGGGCAGGACCTCCCAACTGGGG - Intergenic
1198613325 X:138425842-138425864 TGAGCTCCCCCTCCCACAAGAGG + Intergenic
1199238974 X:145525151-145525173 TCAGCTGCAACTCCCACAAGTGG + Intergenic
1199478627 X:148273680-148273702 TGGGCAGGACCTCCCAACTGGGG + Intergenic
1199478780 X:148274461-148274483 TGGGCAAGACCTCCCAAAGGGGG + Intergenic
1201534757 Y:15034330-15034352 TGAGATGGATCTTGCAAAAGAGG - Intergenic
1201756750 Y:17494456-17494478 TGGGCAAGACCTCCCAAAAGGGG + Intergenic
1201844803 Y:18411528-18411550 TGGGCAAGACCTCCCAAAAGGGG - Intergenic