ID: 912363475

View in Genome Browser
Species Human (GRCh38)
Location 1:109113874-109113896
Sequence GCCGCGCGCACCAGCGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912363466_912363475 5 Left 912363466 1:109113846-109113868 CCCCGGGCGCGCGCTCTCCCGCG 0: 1
1: 0
2: 1
3: 22
4: 136
Right 912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG 0: 1
1: 0
2: 2
3: 17
4: 184
912363462_912363475 25 Left 912363462 1:109113826-109113848 CCTGTTGGGCCGGTTGCGCACCC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG 0: 1
1: 0
2: 2
3: 17
4: 184
912363461_912363475 29 Left 912363461 1:109113822-109113844 CCTGCCTGTTGGGCCGGTTGCGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG 0: 1
1: 0
2: 2
3: 17
4: 184
912363467_912363475 4 Left 912363467 1:109113847-109113869 CCCGGGCGCGCGCTCTCCCGCGC 0: 1
1: 0
2: 3
3: 21
4: 257
Right 912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG 0: 1
1: 0
2: 2
3: 17
4: 184
912363468_912363475 3 Left 912363468 1:109113848-109113870 CCGGGCGCGCGCTCTCCCGCGCC 0: 1
1: 0
2: 4
3: 30
4: 274
Right 912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG 0: 1
1: 0
2: 2
3: 17
4: 184
912363465_912363475 16 Left 912363465 1:109113835-109113857 CCGGTTGCGCACCCCGGGCGCGC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG 0: 1
1: 0
2: 2
3: 17
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912363475 Original CRISPR GCCGCGCGCACCAGCGGCGG CGG Intronic
900204919 1:1427641-1427663 GAGGCGAGCACCAGCAGCGGCGG - Exonic
900287701 1:1909325-1909347 GCCGTGCGTCCTAGCGGCGGCGG - Intergenic
900786922 1:4655213-4655235 GCCATGCGCCCCAACGGCGGCGG + Exonic
900983265 1:6058706-6058728 GCCGCGCAGACAAGGGGCGGAGG + Intronic
901797938 1:11691490-11691512 GCCCCGCGCCCTCGCGGCGGCGG + Exonic
901811305 1:11768128-11768150 GCAGCGGGAGCCAGCGGCGGCGG + Exonic
902350409 1:15849451-15849473 GACGCGCGCTCCAGCGGCGAGGG - Intronic
903324696 1:22563332-22563354 GGCGTGCGCACGTGCGGCGGCGG + Intergenic
903724543 1:25431020-25431042 GCGGGGCGGGCCAGCGGCGGCGG + Exonic
907905674 1:58782514-58782536 GGCGCGCTGAGCAGCGGCGGCGG - Exonic
908355924 1:63324446-63324468 GGCGGCCGCAGCAGCGGCGGCGG - Exonic
912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG + Intronic
913565473 1:120069113-120069135 GCCGCGGGGAGCAGAGGCGGCGG + Intronic
913632659 1:120724449-120724471 GCCGCGGGGAGCAGAGGCGGCGG - Intergenic
914286062 1:146228468-146228490 GCCGCGGGGAGCAGAGGCGGCGG + Intronic
914547093 1:148679221-148679243 GCCGCGGGGAGCAGAGGCGGCGG + Intronic
914619414 1:149391141-149391163 GCCGCGGGGAGCAGAGGCGGCGG - Intergenic
917974712 1:180231127-180231149 GCCGCGGGCAGTAGCGGCTGGGG - Intronic
918365649 1:183805129-183805151 GTCGCGCGCACCGGCGGCGGCGG + Intronic
920029197 1:203026494-203026516 GCCGCGCGCTTGGGCGGCGGAGG + Intronic
923478197 1:234357010-234357032 ACAGTGCGCGCCAGCGGCGGCGG - Intergenic
923506398 1:234609601-234609623 GTCTCCCCCACCAGCGGCGGCGG + Intergenic
1062774713 10:135516-135538 GCCGGGCGCGGCGGCGGCGGCGG + Intronic
1064208969 10:13347774-13347796 GCCCCGCGCGGCGGCGGCGGCGG + Intronic
1064209073 10:13348105-13348127 GCCGCGCCCGGCGGCGGCGGCGG + Exonic
1064443184 10:15371311-15371333 GGCGCGGGCAGCGGCGGCGGCGG - Intergenic
1065140473 10:22714454-22714476 GCTGAGCGCGCCGGCGGCGGCGG - Exonic
1065214945 10:23439726-23439748 GCCGGGCGGGCCGGCGGCGGCGG - Exonic
1070800840 10:79243568-79243590 GCTCCGCGCCCCGGCGGCGGCGG - Intronic
1071086825 10:81875239-81875261 GGCGCGGGCTCCGGCGGCGGCGG - Intergenic
1072102259 10:92240058-92240080 GCCGCGGGCTCCTGAGGCGGCGG + Exonic
1072710671 10:97713901-97713923 GCCGCACGCGCCTGGGGCGGCGG - Exonic
1074830059 10:117241568-117241590 GCCGCGCGCACCGGCATCCGGGG - Intronic
1075800683 10:125151845-125151867 GCCGCTCGGACCCGGGGCGGCGG - Intronic
1075801882 10:125159480-125159502 GCCCCGCGCGGCAGTGGCGGCGG + Intronic
1076358190 10:129867957-129867979 GCCGAGCGGCCCAGCGTCGGAGG - Intronic
1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG + Exonic
1076981932 11:209204-209226 GCCGCCCGCATCAGCGGACGCGG + Intronic
1077057060 11:599075-599097 TGCACGCGCACCAGCGCCGGGGG - Intronic
1077100243 11:819364-819386 GCCGTGCCCAGCAGGGGCGGAGG + Intronic
1077962463 11:7089625-7089647 CCGGCTCGCAGCAGCGGCGGTGG + Exonic
1079361995 11:19777272-19777294 CCCGCGCGCAGCAGCGGCCCCGG + Intronic
1081492581 11:43579620-43579642 GCCCCGCGCCGCGGCGGCGGCGG + Intronic
1081528305 11:43942206-43942228 GCCCCGCGCAGAACCGGCGGTGG + Intronic
1083876095 11:65525123-65525145 GGCGCCCGAACCCGCGGCGGCGG + Exonic
1083936517 11:65872565-65872587 GCCCCGCGCCCCTGCGGCGAAGG + Intronic
1083965787 11:66042943-66042965 GCCGCCCGCGCCAGCGCCGCGGG + Exonic
1084522077 11:69669645-69669667 GCCGGGCGCACCATCAGAGGCGG + Intronic
1085485607 11:76860782-76860804 GCCCCGCGGCCCAGCGGCGCCGG + Intergenic
1086887802 11:92224809-92224831 GCGGCGAGCAGTAGCGGCGGCGG + Intergenic
1090780388 11:130002218-130002240 CCTGCGCGCTCCGGCGGCGGCGG - Intronic
1091108299 11:132943147-132943169 GCCCCGCGCACCAGCGGGCTCGG + Exonic
1091558688 12:1594469-1594491 GGCCCGCGGAGCAGCGGCGGCGG - Intronic
1092860729 12:12717275-12717297 GCCGCGCTCGCCAGCCTCGGCGG + Exonic
1096863834 12:54549599-54549621 GCAGCGCGCGGCGGCGGCGGCGG + Exonic
1100632060 12:96399679-96399701 GCAGCGAGCACCGGAGGCGGCGG + Intronic
1101354685 12:103966012-103966034 GCCGCCCGCATCAGCGGCCTCGG + Exonic
1102247281 12:111363304-111363326 GCAGCACGAACCAGCGCCGGTGG + Exonic
1103433019 12:120904093-120904115 GCCTCCCTCACCCGCGGCGGCGG + Exonic
1103749864 12:123151147-123151169 GCCGCGCGGGGGAGCGGCGGCGG + Intergenic
1104108317 12:125683994-125684016 GACGCGCGCTCTAGCGCCGGAGG + Intergenic
1106340067 13:28819696-28819718 GCCGCGCCCACCGCCTGCGGAGG + Intergenic
1106720084 13:32427781-32427803 GCGGCAGGCACCCGCGGCGGGGG + Intronic
1110119732 13:71866420-71866442 GCCGCGAGCAACGGCAGCGGCGG - Exonic
1110450725 13:75635904-75635926 GCCGCGCTCCCCAGCGGGGGAGG + Intronic
1112461443 13:99606722-99606744 GGCGCGCGGAGCTGCGGCGGCGG + Exonic
1112494773 13:99896073-99896095 TCCGCGCGCACCGGGGGCGCGGG - Exonic
1113656103 13:112068506-112068528 GCCGCCCGCAGCGGCGGCGGCGG - Exonic
1118289273 14:64504840-64504862 GCCGCGAGCTGCAGTGGCGGCGG - Exonic
1118971554 14:70642097-70642119 GCGGCGCGCACCAGGCGCCGGGG + Exonic
1121742506 14:96264116-96264138 GCCGGAGGCAGCAGCGGCGGAGG + Exonic
1122871412 14:104640685-104640707 GCCGTGCGCACCAGGGATGGGGG - Intergenic
1123036503 14:105474047-105474069 GCGGCGGGCACCAGCGCCGAGGG - Intronic
1125508783 15:40282023-40282045 GCCCCGGGCCGCAGCGGCGGCGG + Exonic
1130540340 15:84817347-84817369 GCCGCGGGCGGGAGCGGCGGCGG + Exonic
1132879435 16:2155440-2155462 GCGGAGCGTACCAGCGGCGGGGG - Intergenic
1136399875 16:30011444-30011466 GCCGCGCGCGCGGGCGGGGGCGG - Intronic
1137426575 16:48385388-48385410 GACGCGCGAAACGGCGGCGGCGG - Intronic
1138178704 16:54928774-54928796 CCCGCGCGCCCGCGCGGCGGAGG - Intergenic
1138651498 16:58463846-58463868 GACGCGCGCAGCAGCCGCGGCGG - Intronic
1139583128 16:67884918-67884940 GCCGGCAGCAGCAGCGGCGGCGG - Exonic
1142037142 16:87869380-87869402 GCGGCGCGCGCTAGCGGCGCCGG - Exonic
1142206470 16:88785320-88785342 GCCGCGCGGGACAGCGGAGGGGG - Intergenic
1142694839 17:1628028-1628050 GCTGCGCGCACCGGCCGCCGCGG - Intronic
1143494969 17:7307637-7307659 CCCGTGTGCAGCAGCGGCGGCGG + Intronic
1143628012 17:8122029-8122051 GCCGGCCGCACCAGCCGCCGCGG - Exonic
1146339566 17:32007541-32007563 GCCGGGCGCAGTGGCGGCGGTGG - Intergenic
1147440331 17:40443658-40443680 GGCGCGCGGGCGAGCGGCGGAGG - Exonic
1147743774 17:42683071-42683093 GCCGCGCGCGCCCGGGGCTGGGG + Intronic
1148489182 17:48012365-48012387 GCCGCGCGCCCCGGAGGCCGCGG + Intergenic
1148556594 17:48582222-48582244 GGCCTGCGCACCGGCGGCGGCGG + Intronic
1148836565 17:50468836-50468858 GCTGGGGGCAGCAGCGGCGGCGG + Exonic
1150561973 17:66302501-66302523 GCCGCGAGGACGAGCGGCGGGGG - Intergenic
1152629467 17:81403823-81403845 GCCGCGTGGACCGGCGGCGGTGG + Intronic
1152938307 17:83153059-83153081 GCCGCGCGCATCCTCGGGGGGGG + Intergenic
1154416304 18:14177768-14177790 GCTGCCCGCAGCAGCGGTGGGGG + Intergenic
1158718238 18:59899778-59899800 GCGGCGCCGACCCGCGGCGGGGG - Intergenic
1159704744 18:71673819-71673841 GCCAGGCGCACCAGCTGCAGTGG + Intergenic
1160861278 19:1238100-1238122 GCCCCCCGCACCCGCCGCGGCGG + Intergenic
1160865517 19:1254300-1254322 CCCCCGCGCAGCAGCGGCGGCGG - Exonic
1160903313 19:1440039-1440061 ACAGTGCGCGCCAGCGGCGGCGG + Exonic
1160908947 19:1466021-1466043 GCCGGGCGCACCCGCTGCTGCGG + Exonic
1160909925 19:1469671-1469693 GCCGCGCGCCGCAGCAGCGACGG + Exonic
1160968602 19:1757570-1757592 GCCGCGCGGCCCCGCGGCCGCGG + Intronic
1161388090 19:4007602-4007624 GCCGCGCGCGCCTGCGCAGGAGG + Intergenic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1162464280 19:10831076-10831098 GCCTCACGCACCCGCGGCGCAGG + Exonic
1162470923 19:10871657-10871679 CCCGGGCGCAGCGGCGGCGGCGG + Exonic
1163743892 19:19033489-19033511 GCCTCGCGCGGCGGCGGCGGCGG - Intronic
1164658554 19:29942390-29942412 GACGCGAACAGCAGCGGCGGCGG + Exonic
1167613485 19:50518310-50518332 GCCGGGGGCACCGGCAGCGGCGG - Exonic
1168100356 19:54138129-54138151 GCCCCGCGCTGCAGAGGCGGCGG - Intronic
934566850 2:95346235-95346257 TCCGCGCGGGCCAGCGGCGCGGG + Intronic
934966872 2:98731155-98731177 GGCGGGCGCTCCAGCGGCGGGGG - Intergenic
938451424 2:131424971-131424993 GACGCGCGCCCAGGCGGCGGGGG - Intergenic
939900503 2:147844598-147844620 GCGGCGGGCGGCAGCGGCGGCGG - Exonic
941986677 2:171517576-171517598 ACAGTGCGCGCCAGCGGCGGCGG - Intergenic
946235711 2:218323354-218323376 GCCGCGCTCGGCAGCCGCGGGGG - Intronic
948823225 2:240560730-240560752 GCGACGCGCACCAACGGTGGAGG - Exonic
949040144 2:241844219-241844241 GCCTCGCACAGCAGCTGCGGCGG - Intergenic
1169132550 20:3173593-3173615 GCCCCGCCCACCAGCGGCTGCGG + Intergenic
1169367076 20:5000967-5000989 CCCGTGCGCACCACCGGGGGAGG + Intronic
1172596597 20:36154724-36154746 GCCGACTGCAGCAGCGGCGGCGG - Intronic
1172654371 20:36528008-36528030 GCCCCGAGAGCCAGCGGCGGCGG - Exonic
1172837445 20:37882155-37882177 GACGCACGCACCAGCCGCCGGGG + Intergenic
1173251608 20:41366706-41366728 CCCGGGCCGACCAGCGGCGGGGG - Exonic
1173737561 20:45372849-45372871 GCCGCGCGGACCAGCCTGGGCGG - Exonic
1176096540 20:63346982-63347004 GCCGCGTGCACCAGCAGCAATGG - Intronic
1176100120 20:63360973-63360995 GTCGCGCGCACCCGCGGCTTGGG + Intronic
1176178813 20:63740293-63740315 GCCGAGCGGATCCGCGGCGGAGG + Intronic
1176867561 21:14062698-14062720 GCTGCCCGCAGCAGCGGGGGGGG + Intergenic
1178350876 21:31872759-31872781 GCCGCACCCACCCGGGGCGGGGG - Intergenic
1178400224 21:32279059-32279081 GCCCCGCGCATGAGCAGCGGCGG - Exonic
1179663571 21:42893595-42893617 GCCTCGGGCAGCGGCGGCGGCGG - Intronic
1180965134 22:19784301-19784323 GGAGCGCCCAGCAGCGGCGGCGG + Exonic
1182435436 22:30326833-30326855 GCCGCGCGCGCCCGCGGCCGGGG - Exonic
1183201313 22:36387466-36387488 GGCGCGTGCCCCAGCGGCTGGGG + Intronic
1183856133 22:40636385-40636407 GACGCGCGCAGCAGGGTCGGGGG + Intronic
1183939576 22:41285838-41285860 GCCGAGCGCCCCAGGGGTGGCGG - Intronic
1184101559 22:42343912-42343934 GCCGTGCGCGCCGGCGGGGGAGG + Intergenic
1184593909 22:45502977-45502999 GCGGCGCGCTCCATGGGCGGCGG - Exonic
1185255147 22:49827614-49827636 CCCGCGCCCAGGAGCGGCGGCGG - Intergenic
950153818 3:10707961-10707983 CGGGCGCGCACCAGCGGCAGCGG - Intronic
950345485 3:12288323-12288345 GGAGCGCGCACTAGGGGCGGAGG + Intronic
950345610 3:12288768-12288790 GCTGCGCGCTCCATCCGCGGAGG - Intronic
951080468 3:18445299-18445321 GCGGTGCGCAGCAGCGGCGGCGG - Intronic
951208238 3:19946908-19946930 GCCGCGCGTACCTGGGGTGGGGG + Intronic
958814596 3:98901654-98901676 GCCGCGCTCACCCGCGGCTCCGG + Exonic
966712080 3:182980890-182980912 GAAGCGGGCACGAGCGGCGGCGG + Intronic
966919336 3:184601944-184601966 GCGGCGGGGACCACCGGCGGCGG - Intronic
968506448 4:973363-973385 GCCGCGCGCGCCCGGGGCCGGGG - Exonic
971195685 4:24470707-24470729 GACGCCCCCACCCGCGGCGGCGG + Intergenic
975683503 4:76897961-76897983 GCCGCCCCCATCAGCCGCGGAGG + Exonic
977536561 4:98261376-98261398 GCGGCGGGGACGAGCGGCGGGGG - Intronic
978576711 4:110196768-110196790 GCCGCGCGCACCGGCGGGGCAGG - Intronic
981315636 4:143337177-143337199 GACGCGCGCACCATGAGCGGTGG + Exonic
981550604 4:145937747-145937769 GCCGCCGGCGGCAGCGGCGGCGG - Intronic
983254088 4:165379124-165379146 GCCGCCCCCAGCAGCGCCGGCGG + Exonic
990955032 5:61332342-61332364 GGCGGGGGCAGCAGCGGCGGCGG + Exonic
992105784 5:73448198-73448220 TCCCCGCGCAGCGGCGGCGGCGG - Exonic
995241026 5:109885335-109885357 GCCGCGCGCAGCCGAGGCGCCGG - Intergenic
998166643 5:139848189-139848211 GCAGCGCGCACGGGCGGCGAGGG - Exonic
1000712781 5:164601321-164601343 ACGGCGCGCGCCAGCTGCGGCGG - Intergenic
1001826691 5:174751200-174751222 GCCGCGAGCTCCCGGGGCGGAGG + Intergenic
1002063912 5:176642861-176642883 GCCCCGCCCACCTGGGGCGGGGG - Intronic
1002190144 5:177473637-177473659 GCCGAGCGAGCCAGCGGCCGGGG + Intronic
1002691274 5:181052626-181052648 GCCGACAGCACCAGCGGCGCAGG - Intronic
1003325240 6:5085713-5085735 AGCGCGCGCGGCAGCGGCGGCGG - Exonic
1003995794 6:11538157-11538179 GCAGCCTCCACCAGCGGCGGCGG + Intergenic
1005743449 6:28814276-28814298 GGGGTGCGCACCTGCGGCGGCGG + Intergenic
1006180093 6:32149388-32149410 GCCGTGCGCACCTACGGAGGAGG + Exonic
1006472700 6:34237446-34237468 GCGGCGCGAGCCGGCGGCGGGGG + Intronic
1010141883 6:72622141-72622163 GCCGCCAGCGCCTGCGGCGGGGG - Exonic
1013242724 6:108260982-108261004 ACGGCGGGCAGCAGCGGCGGCGG - Exonic
1014137710 6:117907817-117907839 GCCGAGGGCAGCGGCGGCGGCGG + Exonic
1016738920 6:147508445-147508467 GCGGAGCGCGCCAGCGGCGGCGG + Intergenic
1017671963 6:156777686-156777708 CGCGCGGGCAGCAGCGGCGGCGG + Intergenic
1017672246 6:156778741-156778763 GCCGGGGGCCCCGGCGGCGGCGG - Exonic
1019711144 7:2518886-2518908 GCCCCTCGCACGAGCGGGGGCGG - Intronic
1019828411 7:3301823-3301845 GCAGCGCCCACCAGCCGCGGCGG - Exonic
1021827913 7:24573264-24573286 GGAGCGCGCCCAAGCGGCGGCGG + Intronic
1025819371 7:64947846-64947868 GCGGAGCTCACCTGCGGCGGTGG - Intergenic
1027138241 7:75639300-75639322 GCAGCGCGCGCCGGGGGCGGGGG + Intronic
1029109560 7:98205715-98205737 GCCCCGTGCACCCGCGGCCGCGG + Exonic
1029168932 7:98617438-98617460 GCTGAGCGCGGCAGCGGCGGCGG + Exonic
1034223003 7:149460194-149460216 GCCGCGCGCAGTAGCGGCGGCGG - Intronic
1034977841 7:155458398-155458420 GCCTGGCGAAGCAGCGGCGGCGG + Exonic
1035403953 7:158586869-158586891 GCCGCGCGCTCCAGGGCCAGGGG + Intronic
1036786674 8:11692649-11692671 CCCGCACGCACCCGCGGTGGAGG - Intronic
1038319212 8:26513019-26513041 GCAGTGCGCAACAGGGGCGGGGG + Intronic
1041689902 8:60678706-60678728 GCCGCGCGCACCCGAAGCCGCGG - Intergenic
1048345535 8:133572068-133572090 GCCGCGCGCAGGGGAGGCGGTGG - Intergenic
1049452470 8:142669673-142669695 GCCGCGCGCTCAGGCCGCGGGGG + Intronic
1049509000 8:143018475-143018497 GCCGCGCGGCCCCGGGGCGGGGG - Intronic
1055514561 9:77022280-77022302 GCGGCGCGGACAAGAGGCGGAGG - Intergenic
1055611693 9:78031339-78031361 GACGCGCGCCCGGGCGGCGGGGG - Exonic
1057900410 9:98943917-98943939 GCGGCGCTCGGCAGCGGCGGCGG - Exonic
1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG + Intergenic
1060514558 9:124257871-124257893 GCAGCGCGCACGAGCGCTGGGGG + Intronic
1060952267 9:127612018-127612040 GCCGCGCGCGCCCGGGGCGCAGG - Intergenic
1061084785 9:128392601-128392623 TCCGGGCGCAACAGGGGCGGGGG - Intergenic
1061975846 9:134067774-134067796 GCCGCGCACAAAGGCGGCGGCGG + Intronic
1200003195 X:153072530-153072552 GCTGCGCGCCGCTGCGGCGGCGG - Exonic
1200004528 X:153077479-153077501 GCTGCGCGCCGCTGCGGCGGCGG + Intergenic