ID: 912363789

View in Genome Browser
Species Human (GRCh38)
Location 1:109116271-109116293
Sequence AAAACCACGTGGTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912363789_912363794 22 Left 912363789 1:109116271-109116293 CCTGTTACTTACCACGTGGTTTT 0: 1
1: 0
2: 0
3: 9
4: 74
Right 912363794 1:109116316-109116338 AAATAACACCTACCTCAGAAAGG 0: 1
1: 1
2: 1
3: 38
4: 252
912363789_912363793 -6 Left 912363789 1:109116271-109116293 CCTGTTACTTACCACGTGGTTTT 0: 1
1: 0
2: 0
3: 9
4: 74
Right 912363793 1:109116288-109116310 GGTTTTTGGATTTGTAGAATGGG 0: 1
1: 0
2: 4
3: 71
4: 941
912363789_912363792 -7 Left 912363789 1:109116271-109116293 CCTGTTACTTACCACGTGGTTTT 0: 1
1: 0
2: 0
3: 9
4: 74
Right 912363792 1:109116287-109116309 TGGTTTTTGGATTTGTAGAATGG 0: 1
1: 0
2: 2
3: 49
4: 727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912363789 Original CRISPR AAAACCACGTGGTAAGTAAC AGG (reversed) Intronic
905984399 1:42265793-42265815 AAAACCACATGGAAAGATACTGG + Intronic
907640100 1:56180180-56180202 AAAACCACATGGTCAGAAACTGG + Intergenic
909096886 1:71298350-71298372 AAGACAACAGGGTAAGTAACTGG - Intergenic
909519842 1:76554911-76554933 AAAAACACATGGTAGGTAATAGG + Intronic
910169750 1:84365503-84365525 AAAACCACATGGTAATTTAAAGG + Intronic
910490581 1:87765095-87765117 AATGCCACATGGTAAGTAAGTGG - Intergenic
912363789 1:109116271-109116293 AAAACCACGTGGTAAGTAACAGG - Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
1065424396 10:25584570-25584592 AAAACTGTGTGGTAAGTAGCAGG + Intronic
1066694656 10:38066957-38066979 AAAACCATGTGATGAGAAACGGG + Intergenic
1067975008 10:51014477-51014499 AAATCCAAGAGGTAAGTAATAGG + Intronic
1068933998 10:62618513-62618535 AACACCACGTGGTAAATGAATGG + Intronic
1069132645 10:64726302-64726324 AAAACTGTGTAGTAAGTAACAGG - Intergenic
1071266557 10:83969745-83969767 AATACCACGTGCTTAGTAAAAGG - Intergenic
1075139606 10:119819340-119819362 AAAAGCACTTGGCACGTAACAGG - Intronic
1079344287 11:19638461-19638483 CAAATCACATGGTTAGTAACTGG - Intronic
1087219576 11:95531751-95531773 AAAACCACATGGTTAGGAAGGGG - Intergenic
1088773214 11:113056586-113056608 AAGCCCATGTGGTAAGGAACTGG + Intronic
1090232279 11:125116639-125116661 AAAACCACGTAGTCAGTAGACGG + Intergenic
1093887805 12:24482916-24482938 ACACCCACATGCTAAGTAACAGG - Intergenic
1100776117 12:97976584-97976606 AAGACCACATGGCAAGAAACTGG + Intergenic
1102029185 12:109730253-109730275 AAAGCCATCTGGTAAGAAACTGG - Intronic
1108021814 13:46135480-46135502 AAAACCATCTGGAAAGTCACGGG - Intronic
1108781508 13:53841642-53841664 AAACCCACATGGTTGGTAACTGG - Intergenic
1109231364 13:59761942-59761964 AAACCCAAGTTGTAAGGAACTGG - Intronic
1110499612 13:76211732-76211754 AGATCCACATGGTAAGAAACTGG + Intergenic
1112265303 13:97918264-97918286 AATTCCAGGTGGTAAGAAACTGG + Intergenic
1116377338 14:44220369-44220391 AGAAACACCTGGTAAGTGACCGG + Intergenic
1131713640 15:95084363-95084385 AAGGTCACTTGGTAAGTAACAGG - Intergenic
1138486249 16:57346041-57346063 AAAACCACCTAGGAAGTTACTGG - Intergenic
1138878962 16:60987513-60987535 AAAATCACGTTGGAAGAAACTGG - Intergenic
1146631760 17:34475090-34475112 AAAAGCACTTTGTAAGTCACAGG + Intergenic
1157426162 18:47586076-47586098 AAAACCAAGTGGTAGGAAAGGGG - Intergenic
926861510 2:17315103-17315125 AAAACCACATGGCAAGAAAAAGG + Intergenic
928897274 2:36280142-36280164 TAGATCACGTGGTAAGTATCGGG - Intergenic
931043257 2:58321732-58321754 AAGACCACATGGTAAGTTACAGG - Intergenic
933034077 2:77370211-77370233 AATGCCAGGTTGTAAGTAACTGG - Intronic
935509321 2:103951546-103951568 ACAACCATGTGATAAGTAACAGG + Intergenic
940537334 2:154961837-154961859 AAAGCCATATGGTAAGTAAATGG - Intergenic
944375949 2:199042314-199042336 AGAACCAAATGGTAAGGAACAGG - Intergenic
944569788 2:201032568-201032590 AAAACCACGTAGGAATTAATTGG - Intronic
946037988 2:216759264-216759286 ACCACCACGTGGCAAGTCACAGG + Intergenic
1168940451 20:1707002-1707024 AAGACCACGTGCTAAGACACAGG + Intergenic
1172697566 20:36832996-36833018 AAAAGCACGTGGTGAGCACCCGG - Intronic
1183563297 22:38594015-38594037 AAGATCAGATGGTAAGTAACAGG - Intronic
1184199153 22:42953715-42953737 AAAGCCACCTGGCAAGTAACCGG + Intronic
955780078 3:62475322-62475344 AAAAGCACCTGGTTAGTAAGTGG + Intronic
957777456 3:84772351-84772373 AAACCAACGTGGTAAGGAAGTGG - Intergenic
962812328 3:138970285-138970307 AAAACCAAGTGGTTAGGAAATGG - Intergenic
962932971 3:140054475-140054497 AAGACCACGCGGTCAGTAAGGGG + Intronic
964322674 3:155514360-155514382 AAAAACAGGTGGTAAGTAGCAGG + Intronic
964812383 3:160679521-160679543 AAAACTACTTGGTATTTAACTGG + Intergenic
974534782 4:63161094-63161116 AACACCACCTGGTATGTGACTGG + Intergenic
975940033 4:79632147-79632169 AATGCCATGTGGTAAGGAACTGG - Intergenic
976427005 4:84915894-84915916 AAAACAACATGGTAAGTAATTGG - Intronic
978762640 4:112371170-112371192 AAATTCACGTGGAAAGTATCAGG - Intronic
981903188 4:149890407-149890429 TAAAGCACTTGGTAAGTAATGGG - Intergenic
982035979 4:151346078-151346100 AAAACCAAATGCTAAGTTACTGG - Intergenic
993869996 5:93241202-93241224 AAAATCACATGGTTAGTAACTGG - Intergenic
998554506 5:143110024-143110046 AACACCTCGGGGTAAGTACCTGG - Intronic
1001849824 5:174953687-174953709 CAAACCAGGTGGTAAGTGCCTGG + Intergenic
1004179723 6:13370782-13370804 AAAACCACGTGCAACGTAAAGGG + Intronic
1006534244 6:34685171-34685193 AAATCCAGGTGGAAATTAACTGG + Intronic
1010997838 6:82553732-82553754 AAAAGCACATGGTGAGTACCTGG - Intergenic
1022238892 7:28489867-28489889 AAAACAGAGTGATAAGTAACTGG + Intronic
1025267642 7:57477803-57477825 GAAACCACATTGTAAGTGACTGG + Intergenic
1025748965 7:64274540-64274562 AAAACCATGTTGTAAGTGACTGG + Intergenic
1029667863 7:102007496-102007518 AAATCCACGTGGGAAATACCCGG - Intronic
1030581658 7:111363847-111363869 AAAACCACGTGGTGTGTACAGGG - Intronic
1032790917 7:135241827-135241849 AAAACTATGTGGTAAGTCCCAGG - Intronic
1033028502 7:137801492-137801514 AAAATCACATGGTTAGAAACTGG - Intronic
1039070874 8:33648382-33648404 AAAACTACTTGGTAAGTTAGTGG + Intergenic
1041005571 8:53494397-53494419 ATAACCGGGTGGTAAGTAGCTGG - Intergenic
1044777755 8:95710924-95710946 AATACCACGTGAGAAATAACAGG + Intergenic
1045140179 8:99271840-99271862 AGAACCAGGTGGGAAGTAACTGG - Intronic
1046765746 8:118067706-118067728 AAAACCAAGTAGCATGTAACTGG - Intronic
1047905683 8:129470791-129470813 AAAATCACGTGGCTAGTAAAAGG + Intergenic
1048592961 8:135838500-135838522 AAAATAACATGGTAAGGAACAGG - Intergenic
1055763298 9:79633235-79633257 AAAACCACTAGGTAAGGAATAGG + Intronic
1058787972 9:108409361-108409383 AAGACCACAAGGAAAGTAACAGG + Intergenic
1185474038 X:403125-403147 AGAACCACGTGCTCAGTCACAGG - Intergenic
1187373424 X:18729104-18729126 AAAAGCACATGCTAAGTAAATGG - Intronic
1188390482 X:29613165-29613187 AAAATCACGTACTAAGAAACAGG + Intronic
1196064050 X:111443090-111443112 AAAACCAGGTGGTAAAACACTGG - Intergenic