ID: 912364033

View in Genome Browser
Species Human (GRCh38)
Location 1:109118216-109118238
Sequence CAGTAGGCAGAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 973
Summary {0: 1, 1: 0, 2: 6, 3: 82, 4: 884}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912364029_912364033 9 Left 912364029 1:109118184-109118206 CCTGCTTCTGTGATTGATAATCA No data
Right 912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG 0: 1
1: 0
2: 6
3: 82
4: 884

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912364033 Original CRISPR CAGTAGGCAGAGATGGAGGA AGG Intronic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
901264406 1:7899071-7899093 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
901811882 1:11772061-11772083 CACTAAGGAGAGAGGGAGGAGGG - Exonic
902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG + Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902398294 1:16144135-16144157 CAGGAGGGAGAGAGGGAGGGAGG + Intronic
902421923 1:16287688-16287710 CAGGAGGCTGAGTGGGAGGATGG - Intronic
902580391 1:17404208-17404230 CAGTAGGCAGGGATGCAGGGAGG - Intergenic
902719388 1:18293968-18293990 CAGTAGGCAGAGACTGAGCTGGG - Intronic
903094792 1:20960645-20960667 CAGAAGGCTGAGGTGGAGGTGGG + Intronic
903295303 1:22339675-22339697 CAGAAAGCAGCGCTGGAGGAGGG + Intergenic
903331609 1:22599757-22599779 AAGAAGGGAGAGAGGGAGGAAGG + Intronic
903769248 1:25753674-25753696 CAGTAGGCAGGCAAGCAGGAGGG + Intronic
903932953 1:26874423-26874445 CAGTAGGCTGAGGTGGGAGATGG + Intergenic
904205116 1:28849283-28849305 CTGTTGGCAGAGCTGGAGAAAGG - Intronic
904326118 1:29727912-29727934 CTGTAGGGAGAGATGGGTGAGGG + Intergenic
904335413 1:29794107-29794129 CAGGAGGGAGAGAGGGAGGGAGG - Intergenic
904426038 1:30423772-30423794 CAGAAGGCAGAGGATGAGGAAGG + Intergenic
904547445 1:31286744-31286766 GAGTAGTCAGAGAGTGAGGAAGG - Intronic
905051201 1:35052640-35052662 CAGTAGGCAGGTAGGCAGGAAGG - Intergenic
905421796 1:37851717-37851739 CAGTAATCACTGATGGAGGATGG + Intronic
905583555 1:39100291-39100313 CAGTAGGTGGAGTTGGGGGATGG + Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905930733 1:41785327-41785349 GAGTAGGCAGAGAATGGGGAGGG + Intronic
906314153 1:44775655-44775677 CAGTAGGCTGTGAAGCAGGATGG - Intronic
906501294 1:46343138-46343160 CAGTGGGCAGGGATGGGGGGTGG - Intronic
906588540 1:47001915-47001937 CAGAAGGCAGAGGTGGAGGGAGG - Intergenic
906659380 1:47571712-47571734 AAGGAGGGAGAGATGGAGGGAGG - Intergenic
906946611 1:50300182-50300204 CACCAGGCAGAGATGGAACAGGG + Intergenic
907474787 1:54698503-54698525 GGGGAGGCAGAGCTGGAGGAGGG - Intronic
907505888 1:54918074-54918096 GAGGAGAGAGAGATGGAGGAGGG - Intergenic
907850047 1:58247749-58247771 GAGAAGGGAGAGATGCAGGAAGG - Intronic
907952302 1:59195594-59195616 AAGAAGGAAGAGAGGGAGGAAGG - Intergenic
907966649 1:59337340-59337362 CAAAAGGGAGAGAGGGAGGAAGG + Intronic
908230537 1:62100416-62100438 CATGAGGCAGAGAGGGAGGGGGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
909056475 1:70826684-70826706 CAGTAGTCAGGGCTGGAGAAGGG - Intergenic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
909434016 1:75619226-75619248 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
909706919 1:78596517-78596539 CAGGAGGCAGAGTGGGAAGAGGG - Intergenic
911165630 1:94722180-94722202 CTGTAGGCAGAGACAAAGGAAGG + Intergenic
911519456 1:98911036-98911058 CATCAGGCAGAAAGGGAGGAAGG - Intronic
911630525 1:100178832-100178854 CTGGAGGCAGGGATGGTGGAAGG - Intergenic
912048132 1:105486599-105486621 CAGGAGGCAGAGCTGGACCAGGG - Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
912759529 1:112354719-112354741 AAGAAGGGAGAGGTGGAGGAAGG - Intergenic
912953312 1:114135472-114135494 TAGGAGGAGGAGATGGAGGAGGG + Intronic
913275993 1:117138192-117138214 CAGCATGTAGAGATGGCGGAAGG - Intergenic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
914195581 1:145446482-145446504 AAGGAGGCAGAGAGGGAGGGGGG + Intergenic
914329383 1:146652082-146652104 AAGTAGGCTGAGGAGGAGGAGGG + Intergenic
915848205 1:159291630-159291652 CAGTAAGCAGAGAGGGAATAAGG - Intronic
916256323 1:162791125-162791147 CAGTAGGCAAAGATGGAAAAGGG - Intronic
916408766 1:164524293-164524315 CAGGAGGCTGAGATGGAAGAGGG - Intergenic
916512120 1:165481816-165481838 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
917186733 1:172364828-172364850 CAGTAGCAAGAGAGGGAGCAGGG - Intronic
917215329 1:172672247-172672269 CAGTAGGGAGTGATGGAAGAAGG + Intergenic
917670834 1:177271889-177271911 CAGTCGGGAGAGAGGCAGGAAGG - Intronic
918512848 1:185330161-185330183 CAGGAGGCTGAGGTGGAAGATGG - Intergenic
918809769 1:189100985-189101007 GATTAGGCAGAGAGGGAGGGAGG + Intergenic
919172447 1:193972466-193972488 GAGTAGGCTGAGAAGGAGGAGGG - Intergenic
920724096 1:208417472-208417494 CAGTAGGCAGAAATTGATGGTGG + Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
921181517 1:212635520-212635542 CAGTCTTCAGAGATGGATGAGGG + Intergenic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921618373 1:217298633-217298655 CAGTGGGCTGAGGTGGAGGACGG + Intergenic
921771885 1:219050405-219050427 AAGAAGGGAGAGAAGGAGGAAGG + Intergenic
922325405 1:224523893-224523915 CATTAAGCTGAGAAGGAGGATGG + Intronic
922768393 1:228168142-228168164 GAGTAGGCTGAGGAGGAGGAAGG - Intronic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
922875059 1:228934038-228934060 CAGTAGGCTGGGATTCAGGAAGG - Intergenic
922986303 1:229868518-229868540 GAGTAGGCTGAGGAGGAGGAAGG - Intergenic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
923666514 1:236003018-236003040 CAGGAAGCAGAGATGCAGGTGGG - Intronic
923675763 1:236079642-236079664 AAGTAGGCTGAGAAGGAAGAAGG - Intergenic
923797330 1:237170450-237170472 CACCTGGCAGAGACGGAGGAGGG - Intronic
923905135 1:238376221-238376243 AAGCAGGCAGAGGAGGAGGAAGG + Intergenic
923963495 1:239109140-239109162 CAGCAGGCAGAGAGAGAGGGAGG + Intergenic
924039036 1:239965324-239965346 AAGTAGACAGATCTGGAGGAAGG + Intergenic
924135479 1:240961904-240961926 AAGAAGGCAGAGAGGAAGGAAGG + Intronic
924329118 1:242924799-242924821 CAGGAGGCGGAGGTGGAGGTTGG - Intergenic
924461465 1:244263356-244263378 GAGAAGGAAGAGAGGGAGGAGGG + Intergenic
924465127 1:244292648-244292670 GAGTAGGCTGAGGAGGAGGAGGG + Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1063194406 10:3727742-3727764 CAGGAGGGAGAGAGGGAGAAAGG - Intergenic
1063839910 10:10059376-10059398 CAATTAGCAGAGATGGCGGAAGG - Intergenic
1063907063 10:10792032-10792054 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1064492170 10:15870564-15870586 CAGGAGGCAAAGGTGGAGGGTGG + Intergenic
1064741540 10:18439788-18439810 CAGAAGGGAGGGAGGGAGGAAGG - Intronic
1065351121 10:24796555-24796577 CAGGAGGCTGAGGTGAAGGATGG + Intergenic
1065414424 10:25469075-25469097 AAGCAGGCTGAGATGGAGCAGGG - Intronic
1065625200 10:27623107-27623129 CAGGAGGCTGAGTGGGAGGATGG - Intergenic
1065699383 10:28410191-28410213 CAGGAGGCTGAGGTGGAGGATGG - Intergenic
1065819785 10:29515056-29515078 GAGAAGGAAGAGATTGAGGAAGG - Intronic
1065953131 10:30669833-30669855 GAGAAGGAAGAGATTGAGGAAGG + Intergenic
1066722785 10:38356778-38356800 CAGTAGGCAAAGATGGAAAAGGG - Intergenic
1067191676 10:44075109-44075131 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1067292851 10:44957048-44957070 CTGGACGCAGAGATGGGGGAAGG - Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067690298 10:48497472-48497494 CAGAAGGCAGAGGGGAAGGAGGG + Intronic
1068109735 10:52665773-52665795 CAGCAGGCAATGATAGAGGATGG - Intergenic
1068962532 10:62880161-62880183 TAGTAGGAAGAGATGGTGGTGGG - Intronic
1069132947 10:64728915-64728937 CAATGGTCAGAGGTGGAGGAAGG + Intergenic
1069244443 10:66185249-66185271 TAGTAGATAGAGTTGGAGGATGG + Intronic
1069359661 10:67627184-67627206 CAGGAGGCAGAGCTGGACCAGGG - Intronic
1069619535 10:69828273-69828295 CAGGAGGAAGAGATGGGGGTGGG - Intronic
1069635174 10:69920600-69920622 CACAAGGCAGAGAGGGAGAACGG - Intronic
1069649591 10:70035777-70035799 CAGTAGGTGGAGATGGGAGAAGG - Intergenic
1070324309 10:75377982-75378004 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1070392792 10:75985716-75985738 CAGAACTCAGAGATGGAGGGAGG + Intronic
1070846278 10:79524680-79524702 CAGGAGGCTGAGATGGGAGAAGG + Intergenic
1070927521 10:80235630-80235652 CAGGAGGCTGAGATGGGAGAAGG - Intergenic
1071489368 10:86125681-86125703 GAGGCGGGAGAGATGGAGGAGGG - Intronic
1072275279 10:93816701-93816723 AGGTAGGGAGAGAAGGAGGAAGG + Intergenic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072771237 10:98140437-98140459 CAATAGGCAGAGAGAGAGGAGGG + Intronic
1073054223 10:100688776-100688798 CAGGAGGCAGAAATGGAGTGAGG + Intergenic
1073127403 10:101159907-101159929 CACTTGGCAGAGATGGAGAGTGG - Intergenic
1073190843 10:101649788-101649810 CGGAAGGCAGAGATGCAGGCTGG - Intronic
1073220518 10:101868580-101868602 GAGTAGGCTGAGGAGGAGGAAGG - Intronic
1073249999 10:102115278-102115300 CCACTGGCAGAGATGGAGGAGGG + Intronic
1073521194 10:104131050-104131072 GAGGAGGCAGGGAGGGAGGAAGG + Intronic
1073797171 10:107001132-107001154 AAATAGGCAGAGAGGCAGGAAGG + Intronic
1074094715 10:110301229-110301251 CAGAAGGCAGAGAAGGAAAAAGG + Intronic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074225422 10:111479803-111479825 CAGGAGGCAGGGTTGGGGGAGGG - Intergenic
1074969651 10:118525630-118525652 CAGGAGGAAGAGAGAGAGGAAGG - Intergenic
1075439707 10:122470123-122470145 CAGTAGGCAGAAAATCAGGAAGG - Intronic
1076148683 10:128145680-128145702 CAGAAGGCAGAGGTGCAGCAAGG - Intergenic
1076162301 10:128254620-128254642 CAGCAGGCAGAGAGGGAGGTTGG + Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1077272224 11:1686739-1686761 AAGGAGGCAGAGAAGGAGGGAGG - Intergenic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078335828 11:10462511-10462533 CCCAAGGCAGAGATGGAGGCAGG + Intronic
1078562455 11:12385005-12385027 AAGCAGGCAGAGATGAAGCAGGG + Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080050881 11:27857772-27857794 CAGGAGCCAGAGATAGAGAATGG - Intergenic
1080117324 11:28635507-28635529 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1080215611 11:29836617-29836639 CAGTAGGTAGAGGATGAGGAGGG + Intergenic
1080582723 11:33657141-33657163 AAGCAAGCAGAGAGGGAGGAAGG + Intronic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1080812189 11:35715843-35715865 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1081446844 11:43138984-43139006 CAGTGGGCAGAACTGGAGCATGG - Intergenic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1081748527 11:45489882-45489904 CAGGTGGCAGGGATGGTGGAGGG + Intergenic
1081770712 11:45649208-45649230 CAGGAGGCAGGGATGGGGAAAGG + Exonic
1081867830 11:46369311-46369333 GAGGAGGCAGAGAGGCAGGAGGG + Intronic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1083035189 11:59630363-59630385 CAGGAGGCTGAGATGGAGGTTGG + Intergenic
1083796873 11:65021955-65021977 CAGCAGGCTGGGGTGGAGGAGGG - Exonic
1083840138 11:65299558-65299580 CAGAAGGCAGAGCTGGATGGAGG - Intronic
1083894767 11:65614266-65614288 CGGGAGGCAGAGGTGGAGGGTGG + Intronic
1084067936 11:66716043-66716065 CAGTTGGCAGGGGTGGGGGATGG + Intronic
1084951335 11:72667536-72667558 CAAGTGGCAGAGATGAAGGATGG - Intronic
1085150749 11:74251288-74251310 CAAAAGCCAGAGATGGAAGAGGG + Intronic
1085847507 11:80083194-80083216 AAGAAGGAAGAGAGGGAGGACGG - Intergenic
1086791073 11:91038707-91038729 CAGGAGGGAGAAATGGAGGTAGG + Intergenic
1086918339 11:92557140-92557162 CAGAAGGTGAAGATGGAGGAGGG - Intronic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1088530231 11:110800120-110800142 TAGTAGGGAGAAATGGATGAAGG + Intergenic
1088544019 11:110941921-110941943 GAGTAGGCTGAGGAGGAGGAAGG + Intergenic
1089577824 11:119459371-119459393 CAGTAGGCAGAGAGAGGGGTTGG + Intergenic
1089611672 11:119672776-119672798 GAGTAGGCAGGGCTGGAGGGCGG - Intronic
1090168728 11:124579423-124579445 GAGAAGGAAGAGGTGGAGGAGGG + Intergenic
1090284936 11:125491662-125491684 TTGTAGGTAGAGATGGAGAATGG - Intronic
1090357069 11:126147232-126147254 CAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1090407825 11:126487957-126487979 CAGAAGGCGGAGGTGGAGGGAGG + Intronic
1090423927 11:126594110-126594132 CAGGAGGGAGGGGTGGAGGATGG - Intronic
1090580403 11:128152885-128152907 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090580420 11:128152929-128152951 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090654423 11:128832128-128832150 AAGTAGGCAAGGAAGGAGGAGGG - Intergenic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1091419955 12:328224-328246 TATCAGGCAGAGAGGGAGGAGGG + Intronic
1091686691 12:2567506-2567528 GAGGAGGCAGAGAGGGAGGCAGG - Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091688257 12:2578914-2578936 GGGAAGGCAGAGATGGAGCATGG - Intronic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1092986612 12:13851922-13851944 GAGTAGGCAGAGGAGGAGGAGGG + Intronic
1093231130 12:16543332-16543354 CCGTAGTCAGAGATAGTGGATGG - Intronic
1093440447 12:19189354-19189376 GTGTCAGCAGAGATGGAGGAAGG + Intronic
1093472911 12:19524025-19524047 AGGGAGGGAGAGATGGAGGAAGG - Intronic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1094003180 12:25718482-25718504 CAGGAGGCAGATAAGGGGGAAGG + Intergenic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094362849 12:29649017-29649039 ATGTGGGCAGAGGTGGAGGATGG - Intronic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096201860 12:49689609-49689631 AAGGAGGCTGAAATGGAGGACGG + Intronic
1096290251 12:50336208-50336230 CAGTAGGGAGAGAGAGAGAAAGG - Intronic
1096413593 12:51394041-51394063 CAAAGGGCAGAGGTGGAGGAAGG - Intronic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097904064 12:64902244-64902266 AAGGAGGCAGAGAGGGAGGGAGG - Intergenic
1098096363 12:66960890-66960912 GAGTAGCCAGGGAAGGAGGAGGG - Intergenic
1099004622 12:77221480-77221502 CAGGAGGCTGAGGCGGAGGAAGG + Intergenic
1099278704 12:80613665-80613687 CATTAGGTTGAGAAGGAGGAAGG - Exonic
1099582620 12:84470583-84470605 CAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1099657115 12:85507687-85507709 CAGTTGGTTGAGATGGAGTAAGG + Intergenic
1099904596 12:88757213-88757235 AAGAAGGGAGAGAGGGAGGAGGG - Intergenic
1100471250 12:94895214-94895236 CAGAAGGGAGAGAGGGAGCAAGG - Intergenic
1101255567 12:102973669-102973691 GAGGAGGGAGAGATTGAGGAAGG - Intergenic
1101311771 12:103587114-103587136 CAGTAGGCAGGACTAGAGGAGGG + Intergenic
1101405767 12:104427367-104427389 CAGTAGGCAGAGATGGGTTCAGG - Intergenic
1102113991 12:110387123-110387145 CAGGAGGCTGAGCAGGAGGATGG + Intronic
1102452710 12:113053725-113053747 AGGAAGGGAGAGATGGAGGAAGG + Intergenic
1102476690 12:113193231-113193253 CAGGAGGCTGAGGGGGAGGATGG - Intergenic
1102501151 12:113353538-113353560 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1102521968 12:113483585-113483607 GAGTAGTAAGAGATGGGGGAAGG + Intergenic
1102598762 12:114012961-114012983 AAGGAGGGAGAGACGGAGGAGGG + Intergenic
1102598767 12:114012976-114012998 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1103492405 12:121332340-121332362 AAGTTGGCAGAGATCAAGGAGGG + Intronic
1103631592 12:122266135-122266157 CAGGAGGCAGCGATGAAGGGGGG - Intronic
1103901937 12:124307879-124307901 CAGAAGCCAGAGAGGCAGGAAGG - Intronic
1104509418 12:129363044-129363066 CAATAAACAAAGATGGAGGAAGG - Intronic
1104993500 12:132640208-132640230 CAGGACCCAGGGATGGAGGATGG + Intronic
1105208949 13:18246723-18246745 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1105532225 13:21230397-21230419 CAGGAGGCTGAGTGGGAGGATGG + Intergenic
1105686378 13:22786455-22786477 CAGGAGGCTGAGATGGGAGATGG - Intergenic
1105914648 13:24901884-24901906 CAGGAGGCTGAGGTGGAGGATGG + Intronic
1106194293 13:27480202-27480224 CAGCAGGCCGAGAAGCAGGAAGG + Intergenic
1106520569 13:30493870-30493892 CAGGAGGCTGAGGTGGGGGAGGG + Intronic
1106671900 13:31915035-31915057 CGATAGGCAGAGGTGGAGGTGGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107805373 13:44148850-44148872 CAGTACCCAGAGCTGGAGGATGG + Intronic
1108106238 13:47013771-47013793 AAGAAGGAAGAGATGGAGAAAGG + Intergenic
1108465984 13:50715638-50715660 AAGAAGTCGGAGATGGAGGAGGG + Intronic
1109016356 13:57020484-57020506 CAGCTGCCAGGGATGGAGGAGGG - Intergenic
1109718493 13:66247071-66247093 CAGAAGGCAAAGAGGAAGGAAGG - Intergenic
1109873794 13:68371250-68371272 CAGGAGGCAGAGGTTGAGGTGGG - Intergenic
1109880767 13:68471736-68471758 CAGAAGGCAAAGATGGACAAAGG - Intergenic
1110379918 13:74838925-74838947 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1110643142 13:77849879-77849901 CAGGAGGCTGAGGTGGAGAATGG - Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111668710 13:91301750-91301772 CAGGAGGCTGAGATGGGAGATGG - Intergenic
1111919417 13:94394831-94394853 CAGTAGGCACAGTTAGAGGCTGG + Intronic
1112184804 13:97117368-97117390 CAGAAGACAGAGTTGCAGGAAGG + Intergenic
1112753829 13:102608789-102608811 GAGGAGGCAGAGAAAGAGGAAGG - Intronic
1112831158 13:103453199-103453221 CAGGAGGCTGAGGTGGAGGATGG - Intergenic
1113653646 13:112055476-112055498 GAGGAGGCAGAGAGGGAGGGTGG + Intergenic
1113870043 13:113553765-113553787 CAAAAGGCAGACAGGGAGGAAGG - Intronic
1114317403 14:21521900-21521922 AAGTAGGGAGAAATGAAGGAAGG - Exonic
1114358098 14:21937253-21937275 AAGGAGGGAGAGATGGAGGGGGG - Intergenic
1114384934 14:22244472-22244494 CAGTAGGCAGGGATGGACTGAGG + Intergenic
1115365965 14:32557335-32557357 TAGGAGGCCAAGATGGAGGATGG - Intronic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1117098790 14:52324240-52324262 CAGGAGGCAGAGAGGCAGGAGGG + Intronic
1117255326 14:53971500-53971522 CAATAAGCAGAGATAGAGTAGGG + Intergenic
1117289274 14:54316764-54316786 CAGGAGGCAGATAAGGGGGAGGG + Intergenic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118269132 14:64325704-64325726 GAGTAGTCTGAGAAGGAGGAAGG - Intronic
1118660637 14:68005962-68005984 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1118987211 14:70766815-70766837 GATTAGGCAGAAATGGAGGCAGG - Intronic
1119110781 14:71971945-71971967 CAACAGGCAGAGAAGGAAGATGG + Intronic
1119587581 14:75850986-75851008 CAGGAGGCGGAGGTGGCGGAGGG + Intronic
1119712025 14:76829250-76829272 CAGGCAGCAGAGATGGAGGAAGG + Intronic
1119842057 14:77800480-77800502 GAGTGGGCAGAGCTGGAGGAGGG + Intronic
1120576350 14:86186069-86186091 CAGGAGGCAGGGAGGGGGGAGGG - Intergenic
1120798697 14:88665664-88665686 CAGTAGGCAGAGTAGGGGAAGGG + Intronic
1120844676 14:89115568-89115590 GGGTTGGCAGGGATGGAGGATGG - Intergenic
1120901164 14:89576778-89576800 CAGTTGGGAGAGACGGAGGAGGG - Intronic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121223281 14:92302413-92302435 CTGGAGGCTGAGGTGGAGGATGG + Intergenic
1121592348 14:95125649-95125671 GAGGAGGCAGAGATGGGGGGAGG + Intronic
1121793287 14:96714947-96714969 GAGTAGGCTGAGGAGGAGGAAGG - Intergenic
1121832681 14:97065744-97065766 CAGTAGGCAGAGAAGGAAAAGGG + Intergenic
1121832734 14:97066010-97066032 AAGGAGGCAGGGAGGGAGGAAGG - Intergenic
1121882585 14:97514316-97514338 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1121888046 14:97562576-97562598 TAGAAGGAAGAGATGGAAGAAGG + Intergenic
1122007432 14:98717004-98717026 CACTTGGCAGAGAGGGAGGCGGG + Intronic
1122040401 14:98983779-98983801 CAATAGGAAGGGAGGGAGGAAGG + Intergenic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122546501 14:102525665-102525687 AAGGAGGCAGGGAGGGAGGAAGG - Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1122960491 14:105091780-105091802 CAGTGGGCGGGGGTGGAGGACGG + Intergenic
1123122296 14:105922268-105922290 CATTGGGAAGGGATGGAGGATGG + Exonic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1124110200 15:26778147-26778169 CAGGAGGAAGAGAGAGAGGAGGG + Intronic
1124266989 15:28245118-28245140 CAGGAGGCAGAGATTGATAATGG - Intronic
1124614917 15:31234446-31234468 CAGGAGGCAGAGATGTGGGTGGG + Intergenic
1124898198 15:33797215-33797237 CTGTAGGCAGAGAAGAAGGTTGG - Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125689080 15:41582019-41582041 GAGGAGGCAGAGATTGAGGCAGG - Exonic
1126118637 15:45231519-45231541 AAGTAGAAAGAGATGAAGGAAGG + Intergenic
1126196280 15:45935621-45935643 CGGTGGGGAGAGATAGAGGAGGG + Intergenic
1127137553 15:55940476-55940498 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1127330200 15:57931606-57931628 AAGAAGGGAAAGATGGAGGAAGG - Intergenic
1127330206 15:57931650-57931672 AAGAAGGGAGAGATGGAGGAAGG - Intergenic
1127830631 15:62747940-62747962 GAGTAGGCAGCGGAGGAGGAGGG + Intronic
1127835653 15:62788970-62788992 GAGAAGGCAGAGCTGGATGAAGG + Intronic
1127967395 15:63932608-63932630 CAGTAGCTTGAGAAGGAGGAAGG + Intronic
1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG + Intergenic
1129161081 15:73748297-73748319 CAGCAGGCAGAGGAGGAAGATGG + Intronic
1129163159 15:73758898-73758920 CAGCAGCCAGAGAGGCAGGAAGG - Intergenic
1129664828 15:77573715-77573737 CAGGAGCCAGAAGTGGAGGATGG + Intergenic
1129731693 15:77936037-77936059 CAGGAGGCAGAGGTTGAGCAGGG + Intergenic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1131175135 15:90204487-90204509 CAGTAGGGAGAGGAGGATGAGGG + Intronic
1131833211 15:96367264-96367286 CCGGAGGGAGAGCTGGAGGAAGG - Intergenic
1132169926 15:99640500-99640522 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1132242667 15:100270912-100270934 CAGATGGCTGAGAGGGAGGAGGG - Intronic
1132338349 15:101063095-101063117 CGGGAGGCAGAGATGGAGGGAGG - Intronic
1132361227 15:101217602-101217624 CAGAAGGAAGGGATGGAGGGAGG + Intronic
1132386126 15:101401239-101401261 GCGTGGGCAGCGATGGAGGATGG + Intronic
1132576480 16:666688-666710 CAGAAGGCAGCGAGGGAGGGTGG - Exonic
1132828145 16:1915026-1915048 AGGGAGGCTGAGATGGAGGAGGG - Intronic
1133002386 16:2857941-2857963 CAGGAGGGAGAGAGGGAGGGAGG + Intronic
1133003018 16:2860614-2860636 CGGGAGGCAGAGAGGGAGGCTGG - Intergenic
1133625117 16:7563883-7563905 CAGTGGGCAGGGTTGGAGGTTGG - Intronic
1133912917 16:10082165-10082187 TCGTAGGCAGAGATGGAGTGTGG - Intronic
1134288001 16:12879208-12879230 AAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1134318202 16:13139265-13139287 AAGAAGGAAGAGATAGAGGAAGG - Intronic
1134682381 16:16135311-16135333 AAGTGGGGACAGATGGAGGAGGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134799683 16:17071956-17071978 CAGAAGGCAGGGAGGGAGGGAGG - Intergenic
1135180508 16:20269750-20269772 CAGTAAACAGAGATGTAGGCAGG - Intergenic
1135510349 16:23077575-23077597 AGGTAGGGAGAGATGGAGGAGGG - Intronic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135993931 16:27234343-27234365 GACTGGCCAGAGATGGAGGAGGG - Intronic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1136268016 16:29132144-29132166 AAGAAGGGAGAGAGGGAGGATGG + Intergenic
1136403766 16:30031618-30031640 CAGAAGGAAGAGCTGAAGGAGGG + Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1137406888 16:48196279-48196301 CAGGAGGAGGAGATGGAAGAAGG - Exonic
1137436159 16:48455693-48455715 CAGTTGGCAGAGGTGCAGGCTGG + Intergenic
1137600076 16:49750444-49750466 CAGTTGGCAGAAAGAGAGGAAGG - Intronic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1138195823 16:55051458-55051480 CAGAAGGAAGACAGGGAGGAGGG + Intergenic
1138486729 16:57349938-57349960 GAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138708416 16:58941377-58941399 GAGTAGGAAGAGTAGGAGGAGGG - Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139303108 16:65961978-65962000 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139353003 16:66349265-66349287 TAGTGGGGAGAGTTGGAGGAGGG + Intergenic
1139476066 16:67203163-67203185 CAGTACGGAGACATGGAGGAGGG + Exonic
1139582119 16:67879978-67880000 CAAGGGTCAGAGATGGAGGATGG + Intronic
1140004178 16:71058852-71058874 AAGTAGGCTGAGGAGGAGGAGGG - Intronic
1140719991 16:77763128-77763150 CAGAAGGCAGCGTTGAAGGATGG - Intergenic
1140830370 16:78745301-78745323 TTGAAGGCAGAGGTGGAGGAAGG - Intronic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1141137220 16:81474289-81474311 CAGTAGGGAGAGAGGGAGGGAGG - Intronic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141165506 16:81658066-81658088 CCCTAGGCAGAGACGCAGGAAGG - Intronic
1141251381 16:82362084-82362106 CAGAAGGCAGAGATGGGGCCAGG - Intergenic
1141298226 16:82789959-82789981 CAATAGACAGAGATGGGGGCTGG - Intronic
1141427142 16:83951887-83951909 AAGCAGGGAGAGAAGGAGGAAGG - Intronic
1142176604 16:88648168-88648190 CAGTAGGTAGAGAAGGGGGGTGG - Intronic
1142548211 17:720511-720533 CAGTAGGCTGTGAGGGAGGTGGG + Intronic
1142883550 17:2898665-2898687 CAGAAGGCAGAGGTGGACGGGGG - Intronic
1143865959 17:9924276-9924298 CAGGAGGCTAAGGTGGAGGATGG - Intronic
1143870474 17:9954452-9954474 CAGTCTGCAGTGATGGGGGATGG + Intronic
1144247770 17:13384392-13384414 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1144580221 17:16454615-16454637 CAGGAGGCAGAGGTTGAGGTGGG + Intronic
1144586586 17:16491459-16491481 CCGCAGGCAGAGAAGGAGGCTGG - Intronic
1144773718 17:17773415-17773437 GAGCAAGCAGGGATGGAGGAGGG - Intronic
1145115210 17:20203908-20203930 CAGATGGCAGAGAAGGAAGAAGG - Intronic
1145846424 17:28042287-28042309 GAGTAGGGGGAGATGTAGGAAGG + Exonic
1146000333 17:29126833-29126855 CAGGAGGCTGAGAAGCAGGAGGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146778366 17:35643349-35643371 CAGTAAGCAGAGAGGAAGAAAGG - Intronic
1146916759 17:36682905-36682927 CAGTTGGGAGGGAAGGAGGAAGG - Intergenic
1147193362 17:38749396-38749418 CAGGAGGGAGAGAACGAGGAGGG + Exonic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1147979108 17:44263733-44263755 AAGGAAGCAGGGATGGAGGAAGG - Intronic
1148384934 17:47227586-47227608 GAGTAGGCTGAGGAGGAGGAAGG - Intergenic
1148397843 17:47324168-47324190 CAGTAGGGTGCGAGGGAGGAAGG + Intronic
1149382200 17:56105528-56105550 CAGGAGGCAGGGAAGGAGGGAGG - Intergenic
1150598389 17:66627439-66627461 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1150810400 17:68351972-68351994 CAGCAGGCAGAGGAGGAGGGAGG - Intronic
1150984815 17:70184433-70184455 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1151352795 17:73541592-73541614 CAGCAGGGAGAGACGGAGGGAGG - Intronic
1151385610 17:73753530-73753552 CAGGAGGCAGAGGGGGAGGAAGG + Intergenic
1151677977 17:75609628-75609650 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1151968663 17:77445687-77445709 CAGTTGGCTGAGTTGGAGGTGGG + Intronic
1152154006 17:78621237-78621259 AAGTAGGTAGAGATGGTGGCTGG + Intergenic
1152520286 17:80852293-80852315 TATTGGGCAGAGATGGAGGCAGG + Intronic
1152867147 17:82730979-82731001 CAGCTGGAAGAGATGGGGGAGGG + Intergenic
1152966153 18:116141-116163 GATTAGGGAGAGGTGGAGGAAGG - Intergenic
1153409399 18:4776953-4776975 GAGTAGGCTGAGGAGGAGGAGGG - Intergenic
1154927819 18:20955925-20955947 GATTAGGGAGAGGTGGAGGAAGG + Intronic
1155565543 18:27129994-27130016 AAGAAGGCAAAGGTGGAGGAGGG + Intronic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1156228640 18:35132922-35132944 CAGCAGCCAGAGGTGGAGGTGGG + Intronic
1156377468 18:36527871-36527893 CAGTGAGCTGAGATGGTGGAGGG - Intronic
1156381660 18:36567288-36567310 AGGGAGGAAGAGATGGAGGAAGG + Intronic
1156632884 18:38991527-38991549 AAGGAGGAAGAGAGGGAGGAGGG + Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1156967582 18:43114015-43114037 AAGGAGGAAGGGATGGAGGAAGG - Intronic
1158212574 18:55067693-55067715 TAGCATTCAGAGATGGAGGATGG - Intergenic
1158282499 18:55842802-55842824 CACTAAGCAGAGAAGGAAGAAGG - Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158475456 18:57775436-57775458 AAGAAGGAAGAGAGGGAGGAAGG + Intronic
1158725502 18:59968224-59968246 CAAGAGACAGAGATGGAGGCAGG + Intergenic
1158774651 18:60562990-60563012 CAGTTGGGAGACATAGAGGATGG - Intergenic
1159088978 18:63825017-63825039 CAGAAGGAAGAGAGGGTGGAGGG + Intergenic
1160011131 18:75107796-75107818 GAGTCGGAAGAGAAGGAGGAAGG - Intergenic
1160167962 18:76530429-76530451 CAGGAGGCGGAGGTGGTGGAAGG + Intergenic
1160373016 18:78390331-78390353 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1160570803 18:79816398-79816420 CAGAGGGCAGAGAAGGGGGAGGG - Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1161329217 19:3678432-3678454 GAGGATGGAGAGATGGAGGATGG + Intronic
1161353084 19:3804424-3804446 CATCAGGGAGAGAGGGAGGAAGG + Exonic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161478785 19:4500389-4500411 CAGGAGGCTGAGGTGGAGGATGG - Intronic
1161615768 19:5269417-5269439 CAGATGGCAGAGGAGGAGGAAGG + Intronic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1162121546 19:8472654-8472676 CAGGAGGCAGAGATTGAGTGCGG - Intronic
1162138505 19:8571037-8571059 CAGGAGGAAGGGCTGGAGGAGGG + Intronic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162530025 19:11230618-11230640 GAGGATGCAGAGGTGGAGGAGGG + Intronic
1162950816 19:14071405-14071427 CAGTTGGCATGGCTGGAGGAAGG + Intergenic
1163204909 19:15795219-15795241 AAGTAGGCAGAGAAGAAGGAAGG - Intergenic
1163566472 19:18054869-18054891 CAGAGGGCAGAGTTGGAAGAAGG + Intergenic
1163685105 19:18708169-18708191 CAGGAGGCAGGGAAGGAGGAAGG + Intronic
1163857877 19:19720171-19720193 CAGCAGGCAGAAAATGAGGAAGG + Intronic
1164581774 19:29439205-29439227 AGGGAGGCAGGGATGGAGGAAGG + Intergenic
1164642214 19:29834159-29834181 AAGTAGGCAAATATGGATGATGG - Intergenic
1164757558 19:30701837-30701859 CAGTAGGGAGATATGGCAGAGGG - Intronic
1164767214 19:30781256-30781278 CAGGAGGCAGAAATGCAGGATGG + Intergenic
1165287226 19:34852333-34852355 CAGGAGGCAGAGGCGGAGGCGGG - Intergenic
1165580009 19:36854286-36854308 GAGGAGGAAGAGGTGGAGGAGGG - Intronic
1166055823 19:40287920-40287942 CAGTGAGCCGAGATGGCGGATGG - Intergenic
1166140152 19:40800996-40801018 CAGGAGGCAGAGCGGGAGGGTGG + Exonic
1166146309 19:40838741-40838763 AAGGAGGAAGAGATGGAGAAAGG - Intronic
1166488194 19:43232576-43232598 CAAAAGGCACAGCTGGAGGATGG - Intronic
1166494861 19:43293056-43293078 CAAAAGGCACAGCTGGAGGATGG - Intergenic
1166564593 19:43755727-43755749 CAGTGGGCAGAGTGGGTGGATGG + Intergenic
1166585603 19:43945332-43945354 CAGAAGACAGAGCTGGAGAAGGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167250438 19:48396159-48396181 GAGGAGGTAGAGATGGAGGCGGG + Intronic
1167276079 19:48540492-48540514 CAGTAGGCACAGGTGGGGAAGGG - Intergenic
1167612708 19:50515042-50515064 CAGAAGGTAGAGATGGCGGGAGG - Intergenic
1167633052 19:50637757-50637779 AAGGAGGAAGAGATGGAGAAGGG + Exonic
1167740276 19:51320439-51320461 CACCAGGCGGAGAGGGAGGAAGG - Intronic
1167856727 19:52247937-52247959 CACTAGGCAGAAATGAGGGATGG + Intergenic
1167978852 19:53255509-53255531 CAGGAGGCAGAGATGCACCATGG + Intergenic
1168106933 19:54171518-54171540 GAGGAGGCAAAGATGAAGGAAGG + Intronic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168424423 19:56227419-56227441 CAGGAGGCAGAGGCGGAGGTGGG + Intronic
925260902 2:2527684-2527706 CAGCAGGCAGGGCTGGTGGAGGG - Intergenic
925299435 2:2800149-2800171 AAGGAGGAAGGGATGGAGGAAGG + Intergenic
925389151 2:3483698-3483720 GAGCACCCAGAGATGGAGGAAGG + Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
926181771 2:10651120-10651142 CAGGAGGCAGGGCTGGAGGGTGG - Intronic
926663716 2:15496654-15496676 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
926920717 2:17937349-17937371 AAGGAGGCAGGGAGGGAGGAAGG - Intronic
927065119 2:19463272-19463294 CAGTAGCCAGAGGTCAAGGAAGG + Intergenic
927305100 2:21562240-21562262 GAGAAGCCAGAGATGGAGGAAGG + Intergenic
928290311 2:30030952-30030974 CAGGAGGCGGTGATGGATGAGGG - Intergenic
928320971 2:30282554-30282576 CAGGTGACAGAGATGGAGCAAGG + Intronic
928941350 2:36730507-36730529 CAGTAGGAAGGGATGAAGAAGGG + Intronic
929404012 2:41620236-41620258 CAGAAGGCAGAGAAGAATGAAGG + Intergenic
929427507 2:41858222-41858244 GAGTAGGCAGAGGAAGAGGAGGG + Intergenic
929638951 2:43556413-43556435 AAGTAGGCAGACAAGGATGACGG + Exonic
929922147 2:46180242-46180264 CAGAAGGCAGGGATAGGGGAGGG + Intronic
930191419 2:48463813-48463835 CAGTAGACCGAGGTGGAGGGTGG + Intronic
930218595 2:48722587-48722609 CAGTAGGAAGAGAGAGAGCAGGG - Intronic
930234487 2:48875668-48875690 CTTTAGGTAGAGATGGGGGAAGG + Intergenic
930551625 2:52841796-52841818 AGAGAGGCAGAGATGGAGGAAGG + Intergenic
930752197 2:54945047-54945069 GGGGAGGCAGAGAGGGAGGAGGG - Intronic
931161734 2:59700244-59700266 GAGGAGGCAGAGAAAGAGGAGGG - Intergenic
931596388 2:63949654-63949676 GAGTAGGCTGAGGAGGAGGAGGG + Intronic
931839352 2:66132167-66132189 CAGGAGGCAGACCTGGAGCATGG + Intergenic
932425494 2:71631833-71631855 CAGTGTGCAGCGAGGGAGGAGGG - Intronic
932498580 2:72160184-72160206 GCGTAGCCAGGGATGGAGGAGGG + Intergenic
933678301 2:85077123-85077145 GCGTAGGAAGAGATGGAGGCAGG + Intergenic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
934932364 2:98436895-98436917 CAGGAGGCAGATAAGGGGGAAGG + Intergenic
935014964 2:99173206-99173228 TAGTAGGAAGAGATGGGGAAAGG + Intronic
935104025 2:100022953-100022975 GAGTTGGCAGAGATCAAGGATGG - Intronic
935282385 2:101529390-101529412 GAGTAGGCTGAGGAGGAGGAGGG + Intergenic
935381971 2:102462043-102462065 CAGGAGTTAGGGATGGAGGAGGG + Intergenic
935447782 2:103175033-103175055 CTATAGGCAGAGTTGGAAGAGGG - Intergenic
936141528 2:109946210-109946232 GTCTAGGCAGAGATGAAGGATGG - Intergenic
936178217 2:110244158-110244180 GTCTAGGCAGAGATGAAGGATGG - Intergenic
936203166 2:110425273-110425295 GTCTAGGCAGAGATGAAGGATGG + Intronic
937306789 2:120876631-120876653 CAGCTGGCAGGGTTGGAGGAGGG + Intronic
937615857 2:123921429-123921451 AAGGAGGGAGGGATGGAGGAAGG + Intergenic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937810182 2:126190610-126190632 CATTGGGGAGAGATGGAGGCAGG - Intergenic
937985949 2:127638181-127638203 CAGTGGGCAGAGGAGGAGGTGGG - Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938316288 2:130331446-130331468 CAGGAGGCTGAGGTGGAGGATGG + Intergenic
938342420 2:130544410-130544432 GAGGAGGCAGAGCTGGAGGCAGG + Intronic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
938347412 2:130576299-130576321 GAGGAGGCAGAGCTGGAGGCAGG - Intronic
938581913 2:132654144-132654166 CACTAGCCAAAGATGGGGGAAGG + Intronic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
939275860 2:139994892-139994914 CAACAGGCAGAGATGAAGGTCGG - Intergenic
939428626 2:142073822-142073844 CAGGAGGAAGAGAGAGAGGAAGG - Intronic
939584436 2:143989528-143989550 GATTAGGCAGACATGGAGGAGGG + Intronic
939733834 2:145819264-145819286 GAGAAGGGAGAGAGGGAGGAAGG - Intergenic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941339331 2:164287045-164287067 AAGGAGGCAGGGAGGGAGGAAGG + Intergenic
941466985 2:165839559-165839581 AAGGAAGCAGAGATGGAGGGAGG + Intergenic
941899631 2:170665480-170665502 CAGAAGGAAGGGGTGGAGGAAGG + Intergenic
942003368 2:171673339-171673361 CAGGAGGCTGAGGTGGAGGATGG - Intergenic
942629425 2:177939478-177939500 AAGAAGGGAGAGAGGGAGGAGGG + Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
942980137 2:182070878-182070900 TAGGAGGAAGAGAGGGAGGAGGG + Intronic
942982077 2:182094804-182094826 CAGTAGGCATAAATGGATTAAGG + Intronic
944515913 2:200511441-200511463 CCTTCTGCAGAGATGGAGGAAGG + Intronic
945404806 2:209432294-209432316 CTGTAGGCAGAGAAACAGGAAGG - Intronic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
946276064 2:218632819-218632841 CAGTAGCCAGAGGAGCAGGAAGG + Intronic
946295837 2:218782696-218782718 CAGTGAGCAGAGGTTGAGGAGGG + Intronic
946579821 2:221116151-221116173 CAGTTAGCAAAGATGGATGAGGG + Intergenic
946609247 2:221440132-221440154 CAGTAGGCAGGGATGCAGTGGGG + Intronic
946703163 2:222432693-222432715 CAGAAGCCAGAGGTGGAGGGGGG + Intronic
946820131 2:223620585-223620607 CAAGAGGCAGAGATGGGGAAGGG - Intergenic
948047332 2:234953897-234953919 CAGAAAGCAGAGGTGGAGGAGGG - Intronic
948063838 2:235062020-235062042 AGGCAGACAGAGATGGAGGAGGG + Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948752202 2:240139297-240139319 CAGAAGTCAGAGGTGGAGAAAGG + Exonic
948815910 2:240510252-240510274 CAGGAGGCAGGGAGGCAGGAAGG - Intronic
948815925 2:240510296-240510318 CAGGAGGCAGGGAGGCAGGAAGG - Intronic
949032348 2:241803056-241803078 CCGTGGGCAGAGCAGGAGGAGGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169221291 20:3824566-3824588 CGGCTGGCAGGGATGGAGGAAGG - Exonic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169681063 20:8214429-8214451 CAGAAGGCAAAGGGGGAGGAGGG - Intronic
1170488408 20:16844331-16844353 CAGAAGGAAGAAAAGGAGGAGGG + Intergenic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1170851010 20:20004493-20004515 AAGAAGGCAGAGAGGGAGGGAGG + Intergenic
1171079071 20:22159656-22159678 CACTAGAGAGAGAGGGAGGAGGG - Intergenic
1171356413 20:24549217-24549239 GAGTGGGCAGAGTAGGAGGAAGG - Intronic
1172474900 20:35229204-35229226 AAGGAGGAAGAGGTGGAGGAAGG - Intronic
1172643384 20:36455221-36455243 CAGAAGGCAAAGATGGTGGGGGG - Intronic
1173530936 20:43769168-43769190 AAGGAGGCAGGGAGGGAGGAAGG + Intergenic
1173595057 20:44253669-44253691 CAGGGGGCAGAGATGGCAGATGG + Intronic
1174114844 20:48219818-48219840 CAGGAGGCCAAGATGGATGAGGG + Intergenic
1174274386 20:49393122-49393144 CAGCAGGCAGAGATGGGAGTAGG + Intronic
1174763503 20:53229768-53229790 AAGGAGGGAGAGAGGGAGGAGGG + Intronic
1174886657 20:54343087-54343109 AAGAAGGCAGGGAAGGAGGAAGG - Intergenic
1175644697 20:60661010-60661032 GAGGAGGCAGAGACGGCGGATGG - Intergenic
1175783475 20:61697956-61697978 CAGAAGTCAGAGATGGAGCCAGG + Intronic
1176297039 21:5079263-5079285 GAGAAAGCAGACATGGAGGACGG + Intergenic
1177249359 21:18572220-18572242 AAGCAGGAAGAGAAGGAGGATGG + Intergenic
1177496113 21:21894567-21894589 CTGTAGGTGGATATGGAGGATGG + Intergenic
1177830824 21:26137044-26137066 CAGGAGGCGGAGGTGGAGGCGGG - Intronic
1178362282 21:31958555-31958577 GATGAGGCAGAGATTGAGGATGG + Intronic
1178745439 21:35245363-35245385 CAGTTGGGAGAGTTGGAGAATGG + Intronic
1179167698 21:38947592-38947614 CAGAAAGGAGAGATGGAGGGAGG - Intergenic
1179179868 21:39036061-39036083 CAGGAGGCATGGATGGAAGAGGG - Intergenic
1179326632 21:40352840-40352862 CTGAAGGCAGATTTGGAGGAAGG - Intronic
1179623354 21:42633084-42633106 TGGTGGGCAGAGATGGAGGACGG - Intergenic
1179859989 21:44182684-44182706 GAGAAAGCAGACATGGAGGACGG - Intergenic
1180116144 21:45706481-45706503 CAGTAGAGAGAGATGGCAGAGGG - Intronic
1180224835 21:46386202-46386224 CAGCAGGCAGGGTGGGAGGAGGG - Intronic
1180767309 22:18352575-18352597 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1180779000 22:18509804-18509826 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1180784024 22:18536975-18536997 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180811721 22:18767124-18767146 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1180855137 22:19040800-19040822 CAGAAGGCAGGGAGGTAGGAGGG + Intronic
1181127592 22:20711023-20711045 CAGCAGGCAGAGAAAGAGAAGGG + Intronic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181197874 22:21201366-21201388 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1181240924 22:21476327-21476349 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181412983 22:22737988-22738010 GAGAAGGAGGAGATGGAGGATGG + Intronic
1181528452 22:23502786-23502808 AAGGAGGGAGGGATGGAGGATGG - Intergenic
1181528471 22:23502838-23502860 AAGGAGGGAGGGATGGAGGATGG - Intergenic
1181666400 22:24401338-24401360 TGGTAGGCAGAGCTGGAGGGTGG + Intronic
1181703825 22:24635534-24635556 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1182758241 22:32698873-32698895 CAGTGGCATGAGATGGAGGAGGG + Intronic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1183302626 22:37065790-37065812 CATTAGGCAGCAGTGGAGGAAGG + Exonic
1183323015 22:37176549-37176571 CAGGAGCCAGAGAGGAAGGAGGG - Intergenic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1183765204 22:39866974-39866996 CAGGAGGCAGAGCTGGCGGTGGG - Intronic
1184095073 22:42312026-42312048 AAGGAGGAAGACATGGAGGATGG + Intronic
1184114181 22:42412656-42412678 CGGTAGACAGAGAGGGAGGCAGG + Intronic
1184257335 22:43294737-43294759 CACGGGGCAGAGAAGGAGGAGGG - Intronic
1184615724 22:45637020-45637042 CAGAAGACAGAGGTGGAGCAGGG - Intergenic
1184864769 22:47195962-47195984 CAGGAGGCAGCGAGGGAGGGAGG + Intergenic
1185072980 22:48667357-48667379 CAGGAGGCAGACCAGGAGGAAGG + Intronic
1185151611 22:49167130-49167152 AAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1203228931 22_KI270731v1_random:93469-93491 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
950037779 3:9899533-9899555 CAGCAGGGAGGGAAGGAGGAAGG - Intergenic
950646550 3:14380796-14380818 AAGAAGGGAGGGATGGAGGAAGG + Intergenic
950674123 3:14544491-14544513 CTGGAGTCAGAGATGAAGGACGG - Intergenic
951034660 3:17919998-17920020 CAAGAGGCTGAGGTGGAGGATGG + Intronic
951350727 3:21603817-21603839 CAGTAGGCAGGGATGGTAGAAGG + Intronic
951732306 3:25823802-25823824 CAGGAAGCAGGGGTGGAGGATGG + Intergenic
951891603 3:27572872-27572894 TAGGAGGTAGAGAGGGAGGAAGG - Intergenic
952798536 3:37265919-37265941 CAGGAGGCTGAGGTGGAAGATGG + Intronic
952875058 3:37937743-37937765 GAGCAGTCAGATATGGAGGATGG + Intronic
953091153 3:39727184-39727206 CAGTAGCAAGAGAGTGAGGATGG + Intergenic
953104017 3:39857240-39857262 CAGGAGGGAGGGAGGGAGGAAGG + Intronic
953410111 3:42686022-42686044 CAGGAGGCCGAGACGGAAGACGG - Exonic
953435880 3:42876768-42876790 GAGAAGGCTGAGATGGTGGAGGG + Intronic
953624687 3:44561222-44561244 CAGAAGGCAAAGAGGAAGGAAGG + Intronic
954196387 3:48999517-48999539 CAGAAGGCAGTGATGGAGCAGGG - Intronic
954627258 3:52029255-52029277 CAGAGGGCAGAGCTGGTGGAAGG + Intergenic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
954899791 3:54008923-54008945 GAGCAGGCAGAGGTGGGGGAAGG - Intergenic
955362018 3:58283784-58283806 CATTGAGCAGAGGTGGAGGATGG + Intronic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
956276704 3:67509946-67509968 CAGTGGTGAGAGATGGAGGTGGG + Intronic
956398724 3:68853429-68853451 CAGTAGGCAGAGAGGAGGAAAGG - Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
957214248 3:77298759-77298781 CAGGAGGCACAGATGAATGAAGG - Intronic
957414717 3:79886409-79886431 CAGTAAGCAGAGATAGAAGGAGG - Intergenic
957444356 3:80295779-80295801 GAGGAGGAAGAGGTGGAGGAGGG - Intergenic
959376625 3:105595583-105595605 GAGTAGGCAGAGAGTGATGAGGG + Intergenic
959471957 3:106763442-106763464 TAGAAGTCAGAGATGGAAGAAGG - Intergenic
960591409 3:119369271-119369293 CAGTTGGCAAAGAGGGATGAGGG + Intronic
961796289 3:129411362-129411384 CAGAGGGAAGAGATGAAGGAAGG + Intronic
962405694 3:135097959-135097981 AAGTTGGCACAGAGGGAGGATGG - Intronic
962494195 3:135923203-135923225 CAATGGGCAGAGGTGGTGGAGGG - Intergenic
962935168 3:140074048-140074070 CAGTAGCCATAAGTGGAGGAGGG - Intronic
963580017 3:147113867-147113889 CAGTTGGCAGAAGTGGAGGAGGG + Intergenic
963834008 3:150037843-150037865 AAGGAGGCAGGGAGGGAGGAAGG + Intronic
964067339 3:152595726-152595748 CAGGAGGCTGAGGTGGAGGTGGG + Intergenic
964508045 3:157421112-157421134 TAGAGGGCAGTGATGGAGGAAGG + Intronic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965460978 3:168962900-168962922 CAGGAGGCTGAGTGGGAGGATGG + Intergenic
965751060 3:171975461-171975483 GAGCAGCCAGAGATGGAGGAGGG + Intergenic
966570853 3:181441538-181441560 CATTTGTCAGAGATGGGGGACGG - Intergenic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
968493051 4:900814-900836 CAGAAGGAAGAGAGGGAGGGAGG + Intronic
968513398 4:1005032-1005054 CAGTTTACAGAGATGGAGGCAGG + Intergenic
968966758 4:3772700-3772722 CAGCAGGCAGTGGAGGAGGATGG + Intergenic
968983179 4:3861565-3861587 ACGTAGCCAGTGATGGAGGACGG + Intergenic
968995885 4:3945708-3945730 CGGGAGGCTGAGGTGGAGGATGG - Intergenic
969124997 4:4940573-4940595 CAGGAGGCAGAGAGGCAGGTGGG + Intergenic
969126556 4:4952830-4952852 CAGGAGGCTGAGATCGAGGATGG - Intergenic
969131783 4:4995534-4995556 AAGCAGGCAGAGAAGGAGGAAGG + Intergenic
969574743 4:8030315-8030337 CAGCAGGCAGAGTGGGAGGCAGG + Intronic
969575228 4:8032718-8032740 CGCCAGGCAGAGAGGGAGGAGGG + Intronic
969621829 4:8282549-8282571 CAGGAGGCAGAGAGGGGCGAGGG - Intronic
970122752 4:12775205-12775227 AAGTAGCTAGAGATGGAAGATGG - Intergenic
970297182 4:14642277-14642299 AAGGAGGCAAAGAGGGAGGAAGG + Intergenic
971041753 4:22761279-22761301 AAGTGGGGAGAGTTGGAGGATGG - Intergenic
971084143 4:23250619-23250641 GAGTAGGCTGAGGAGGAGGAGGG + Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
971810268 4:31416332-31416354 CAGTGGGCTGAGATGGAGGGTGG + Intergenic
972016102 4:34248358-34248380 GAGTAGGAAGGGAAGGAGGAGGG - Intergenic
972353052 4:38254991-38255013 CAGAAAGAAGAAATGGAGGAAGG + Intergenic
972457487 4:39268929-39268951 GGGTAGGGAGAGTTGGAGGATGG + Intronic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
973321074 4:48810823-48810845 CAGTGGGTAGTGATTGAGGATGG + Intronic
973584364 4:52375925-52375947 CAGGAGGCTGAGTGGGAGGATGG + Intergenic
973585598 4:52387782-52387804 CAGGAGGCAGAGATGGTTGGGGG - Intergenic
973726502 4:53782299-53782321 CAGCAGGCAAAGAGGGAGGATGG - Intronic
974086402 4:57265360-57265382 CAGGAGCCAGAGAGGGAGGGAGG + Intergenic
974222764 4:58997757-58997779 CAGGAGGCAGATAAGGAGGGAGG + Intergenic
974375479 4:61070859-61070881 GAGAAGGTAGAGATGAAGGAAGG + Intergenic
974835097 4:67238806-67238828 AAGTAGGGAGAGAGGGAGGGAGG - Intergenic
974875016 4:67693173-67693195 GAGTAGGCTGAGGAGGAGGAAGG - Intronic
975619398 4:76280870-76280892 CAGGAGGCAGAAATGAAGAAAGG - Intronic
975811611 4:78175746-78175768 CAGTAGGAAGGGAGGCAGGAAGG + Intronic
976532891 4:86175578-86175600 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
976979766 4:91212881-91212903 GAGTAGGGAGAGAAGGAGGTGGG - Intronic
977218967 4:94316156-94316178 GAGAAGGCAGACATTGAGGAGGG + Intronic
978376720 4:108081722-108081744 CAGTAGTAAGAGTTGGATGAGGG + Intronic
979495909 4:121381595-121381617 CAGGAGTTAGAGATGGTGGAGGG - Intergenic
979703187 4:123690420-123690442 CAGAAGGCAGAGGGGGAGCAAGG + Intergenic
980204279 4:129697686-129697708 CAGTAGCAAGGGATGGAGAACGG + Intergenic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
981471798 4:145143868-145143890 CAGTAGGAAGAAGTGGAAGAAGG - Intronic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
982183631 4:152774079-152774101 CAGGAGGGAGAGAGGAAGGAAGG - Intronic
982490759 4:156026378-156026400 CAGTAGGCAAAGTGGGAGCAGGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983372565 4:166879895-166879917 CAGGAGGCAGAGAGAGAAGAGGG - Intronic
983541374 4:168914601-168914623 TGGTAGGCAGAGATAGAGAAAGG + Intronic
983551849 4:169025794-169025816 CAGTGAGCAGTGAGGGAGGACGG + Intergenic
983552558 4:169032417-169032439 AAGAAGGGAGAGAAGGAGGAAGG - Intergenic
983881751 4:172940776-172940798 TAGGAGGCTGAGATGGAGGATGG - Intronic
984157032 4:176206188-176206210 CAGGTGGCAGTTATGGAGGATGG + Intergenic
984213430 4:176878438-176878460 CAGTAGGAAGAGAGAGAGTAGGG - Intergenic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
984858861 4:184219286-184219308 CAGAGGGCAGAGGTGGAAGAGGG - Intronic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
984941983 4:184940953-184940975 CAGTAGGCATAGGTGGAAGTGGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985873940 5:2581098-2581120 CAGGAGGGAGGGAGGGAGGAAGG - Intergenic
986093572 5:4534915-4534937 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
986142400 5:5043377-5043399 AAGAAGGCAGGGAGGGAGGAAGG + Intergenic
986203005 5:5596292-5596314 CAGAAGGCAAAGAGGGAGAAAGG - Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986943455 5:12985505-12985527 GAGTAGACTGAGAAGGAGGAGGG - Intergenic
987374148 5:17218256-17218278 CAGCAGCCAAAGATGGAGGGTGG + Intronic
987387560 5:17344522-17344544 CAGGAGGAAGAGATAGAGGGGGG - Intergenic
987448144 5:18047304-18047326 GAGTAGGCTGAGGAGGAGGAGGG + Intergenic
988112903 5:26846633-26846655 AAGTAGGCTGAGGAGGAGGAGGG + Intergenic
988477258 5:31597824-31597846 GAGGAGGCAGAGGTGAAGGAAGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
990304337 5:54480120-54480142 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
991092899 5:62710085-62710107 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
991453245 5:66775294-66775316 CAGTGGGCTGAGTTGGGGGAAGG - Intronic
991966697 5:72098798-72098820 CAACAGGCAGAGATGGAGAAAGG - Intergenic
993637331 5:90360385-90360407 TAGTAGACAGAGAGAGAGGAGGG + Intergenic
993877939 5:93329882-93329904 CAGAAGCCAGAGTTGGGGGATGG - Intergenic
993989619 5:94639790-94639812 GAGTAGGCTGAGTAGGAGGAAGG + Intronic
994559425 5:101347942-101347964 CAAAAGGCAGAGATTGGGGAGGG + Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
994993451 5:107028899-107028921 CAGGAGGGAGAGGTGGAGCAGGG - Intergenic
995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG + Intergenic
995288413 5:110419193-110419215 AAGAAAGCAAAGATGGAGGAAGG + Intronic
995653239 5:114395786-114395808 CAGCAGGCAGTGAAGCAGGAAGG - Intronic
995807139 5:116065677-116065699 GAGTAGGCTGAGAAGGAGGATGG + Intergenic
996012257 5:118493985-118494007 CTGTAGGCAGAGCTGGACAATGG - Intergenic
996297232 5:121935482-121935504 CAGTAGGCAGAGGCAGAAGAAGG - Intergenic
996718845 5:126610809-126610831 CAGAAGGCTGAGGTGGGGGATGG - Intronic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
996876980 5:128250862-128250884 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
996957156 5:129197233-129197255 CAGTGGGCAGGGAAGGTGGAGGG - Intergenic
997420592 5:133763830-133763852 CAGTCAGCAGAGGTGGAGAAGGG - Intergenic
997528398 5:134567834-134567856 CAGAAGGAAGAGGTGGAGGTGGG + Intronic
997642380 5:135457736-135457758 CAGGAGGCTGCGCTGGAGGAGGG + Intergenic
997913702 5:137902434-137902456 GAGTAGGCTGAGGAGGAGGAGGG - Intronic
997927634 5:138045426-138045448 CAGGAGGCTGAGTGGGAGGATGG + Intronic
999155266 5:149453390-149453412 GGGGAGGCAGGGATGGAGGACGG - Intergenic
999170857 5:149593808-149593830 GAGTAGGCTGAGGAGGAGGAGGG + Intronic
999240139 5:150122766-150122788 GGGCAGGCAGTGATGGAGGAAGG - Intronic
999692204 5:154157857-154157879 CAGGAGGCTGGGATGGAAGAGGG - Intronic
999969642 5:156846292-156846314 CAGGAGGCAGATATAGAGGTGGG + Intergenic
1000047770 5:157535663-157535685 CATTAGGCAGAGATGTTGTAAGG - Intronic
1001277256 5:170359837-170359859 TAGAAGGCAGAGAAGAAGGAGGG + Intronic
1001547872 5:172581646-172581668 CAGTGGGCAGTGCTGGAGGCTGG - Intergenic
1001675284 5:173507259-173507281 CAGTACCCAGAGAGGGAGGCTGG + Intergenic
1001785788 5:174411951-174411973 TATTGGGCAGAGATGGAGAAAGG - Intergenic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1002050467 5:176567867-176567889 CGGGAGGCTGAGATGGGGGATGG - Intronic
1002390984 5:178911476-178911498 CAGACGGCAGAGGAGGAGGAAGG - Intronic
1002425345 5:179171636-179171658 CAGGAGGCAGTGATGGGGGTAGG - Intronic
1002427552 5:179185184-179185206 CAGTGGGAGGACATGGAGGAAGG + Intronic
1003255706 6:4472998-4473020 AGGAAGGCAGAGTTGGAGGATGG - Intergenic
1003414339 6:5894561-5894583 TTGTAGGCAGAGCTGGACGAGGG + Intergenic
1003787989 6:9508557-9508579 CCATACGCAGAGATTGAGGAAGG - Intergenic
1003835595 6:10069372-10069394 CAGGAGGCAGAGGGGGAGGGTGG - Intronic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004024463 6:11805478-11805500 CAGCAGGGAGTCATGGAGGAGGG - Intronic
1004034606 6:11911055-11911077 GAGTAGGCTGAGGAGGAGGAGGG + Intergenic
1004048703 6:12051439-12051461 GAGAAGGCAGAGATAGAAGATGG - Intronic
1004173203 6:13315251-13315273 GAGTAGGCTGAGCAGGAGGAGGG - Intronic
1004302226 6:14469033-14469055 CAGTGGGCAGAGAGCAAGGAAGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004446689 6:15706595-15706617 GAGTAGGCTGAGGAGGAGGAGGG - Intergenic
1004458495 6:15813906-15813928 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1004481185 6:16020833-16020855 CAGAAGCCAGAGAGAGAGGAGGG - Intergenic
1005098825 6:22147090-22147112 GAGAAGGCAGAGCTGGAGAAAGG + Intergenic
1005704314 6:28436223-28436245 CAGACTGCAGAGATGCAGGAAGG - Exonic
1006078592 6:31550761-31550783 CAGGAGGCAGAGGTTGAGGTGGG - Intronic
1007007346 6:38378119-38378141 CAGGAGGCAGATAAGGGGGAGGG - Intronic
1007131937 6:39483364-39483386 CACAAGCAAGAGATGGAGGAAGG - Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007777812 6:44233555-44233577 CAGGAGGCAGACAGGGAGGGAGG - Exonic
1008144018 6:47867691-47867713 TAATAGATAGAGATGGAGGATGG - Intergenic
1008568314 6:52790939-52790961 CAGTTGGCAGAGGTGGTTGAGGG - Intergenic
1008579715 6:52895892-52895914 CAGTTGGCAGAGGTGGTTGAGGG - Intronic
1009028432 6:58027692-58027714 AAGGAGGCAGAGATGGAGTCAGG + Intergenic
1009324670 6:62336344-62336366 AAATAGACAGACATGGAGGATGG + Intergenic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010196881 6:73248435-73248457 CAGGAGGGAGAGAGGAAGGAGGG - Intronic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1010604490 6:77871543-77871565 TAGCAGGGAGAGAGGGAGGAGGG + Intronic
1011847461 6:91584199-91584221 AAGAAGGAAGAGAGGGAGGAAGG + Intergenic
1013029085 6:106313072-106313094 GAGAAGGCAGAGGTGGAGGTGGG + Intronic
1013296414 6:108761809-108761831 GGGTAGGCACAGATGGAGGTGGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014069429 6:117163992-117164014 CTGTTGGCAGAGAAGGAGGCAGG - Intergenic
1014416177 6:121187589-121187611 CAGTAGGAAGAGATGTACGGAGG - Intronic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1015040740 6:128715792-128715814 CAGTAGCCAGAGGGGGATGAGGG - Intergenic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015839740 6:137464169-137464191 AAGTGCCCAGAGATGGAGGAAGG - Intergenic
1015972684 6:138758579-138758601 CAGAAGGGAGAGAGGGAGCAGGG - Intronic
1016404647 6:143717213-143717235 CAATAGGTATAGCTGGAGGAAGG - Intronic
1016795141 6:148109969-148109991 AAGTAGGGAGAGAGAGAGGAAGG - Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018167375 6:161110897-161110919 CAGTGGACAGAGACTGAGGATGG - Intronic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019327608 7:446008-446030 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1019730796 7:2628330-2628352 CAGAAGGCTGAGATTGAGGCGGG + Intergenic
1019785878 7:2977121-2977143 GGGGAGGCAGGGATGGAGGAGGG + Intronic
1019885876 7:3904587-3904609 CAGAAGGCTGATGTGGAGGATGG + Intronic
1020004627 7:4775784-4775806 CCCTAGGGAGAGATGCAGGAAGG - Intronic
1021493309 7:21244625-21244647 GAGTAGGGTGAGAGGGAGGAAGG - Intergenic
1021742081 7:23696970-23696992 CAGGGGGCAGAGCTGGAGGTGGG + Intronic
1021809080 7:24385762-24385784 CATTAGGGAGAGTTGGATGAAGG - Intergenic
1021841640 7:24726032-24726054 CGGCAGGCAGAGATGGAGGGAGG + Intronic
1022466102 7:30654049-30654071 CAGGAGGTAGAGAAGGTGGAGGG - Intronic
1022665908 7:32410367-32410389 GGGTAGGAAGAGAAGGAGGAGGG + Intergenic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1022804389 7:33807346-33807368 CAGTAGGCTGGGAGGGATGAGGG - Intergenic
1022959849 7:35416005-35416027 CTCTAGGAAGAGATGGAGGCTGG - Intergenic
1023217720 7:37882524-37882546 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1023269474 7:38445938-38445960 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
1023619502 7:42055467-42055489 CAGCTAGCAGAGAGGGAGGAGGG - Intronic
1023838267 7:44080927-44080949 GAGTTGGGAGAGAAGGAGGAGGG + Intronic
1023991720 7:45132628-45132650 AAGGAGGCAGGGATGGAGGGAGG + Intergenic
1024168259 7:46756739-46756761 GAGAAGGGAGAGAAGGAGGAAGG + Intronic
1024984448 7:55183068-55183090 CAGAAGCCAGAGAGGCAGGAAGG - Intronic
1025847830 7:65216726-65216748 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1025992835 7:66508587-66508609 AAGTAGGGAGGGAGGGAGGAAGG - Intergenic
1026280749 7:68919796-68919818 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1026589134 7:71680635-71680657 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1026591724 7:71702128-71702150 GAGTAGAGAGAGAGGGAGGAGGG + Intronic
1026622932 7:71966518-71966540 CAGGAGACAGAGAGAGAGGAGGG - Intronic
1026624310 7:71978765-71978787 TAGTCACCAGAGATGGAGGATGG - Intronic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1026962837 7:74420077-74420099 AAGGAGGCAGGGAGGGAGGAGGG - Intergenic
1027190810 7:75994582-75994604 CAGTAGCCAGTAGTGGAGGACGG + Exonic
1029050799 7:97684603-97684625 CAATAAGCAGAGATTGAAGAAGG + Intergenic
1029303868 7:99604595-99604617 CAGTAAGGAGGGATGGAGGCGGG + Exonic
1029346175 7:99980393-99980415 CAGAAGGCAGAGATGAAGTGTGG + Intergenic
1029417387 7:100451541-100451563 CGGGAGGCTGAGGTGGAGGATGG - Intergenic
1029559002 7:101290122-101290144 CAGAAGGCAGAGATGAAGTGTGG - Intergenic
1030412607 7:109200808-109200830 CAGGAGGCAGAGATTGCGGTGGG - Intergenic
1030524586 7:110637680-110637702 CAGTAGGCAGGGAAGGAAAAGGG + Intergenic
1030791028 7:113729333-113729355 CAGGAGGCAGAAGTGGGGGAAGG - Intergenic
1030805458 7:113912627-113912649 CAGTTAGCAGAAGTGGAGGAAGG + Intronic
1030942489 7:115671296-115671318 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1032471030 7:132179547-132179569 CAGTGGGCAGTGCTGGAGGCTGG - Intronic
1032489441 7:132313107-132313129 AGGTAGGCAGAGAGGGAGGTTGG - Intronic
1033349313 7:140549150-140549172 CAGTAGGCAGAGGTTGTGGTGGG + Intronic
1033546387 7:142405200-142405222 CAGTAGGAATAGATGGAGTTGGG + Intergenic
1033921629 7:146400110-146400132 TAGGAGGCAGGGATGGAGGGAGG - Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034636683 7:152572830-152572852 CAGGAGGCTGAGGTGGAGGATGG + Intergenic
1035303381 7:157913400-157913422 CAGCAGGCAGTGAAGCAGGAAGG - Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036561751 8:9904678-9904700 CAGTGTGGAGAGGTGGAGGAGGG - Intergenic
1036571455 8:9983254-9983276 CAGTGGGCAGGCATGCAGGAGGG + Intergenic
1036598141 8:10232339-10232361 TAGTAGGCAGAGGTGGAGAGTGG + Intronic
1036798028 8:11769876-11769898 CAGGCGGCTGAGACGGAGGAGGG - Exonic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037013395 8:13873354-13873376 GAGTAGGCTGAGGAGGAGGAGGG + Intergenic
1037049024 8:14345806-14345828 CAGTAGGAAGGGATGGAGTTTGG - Intronic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1037426605 8:18762264-18762286 CAGGAGGAAGAGAGGAAGGAAGG - Intronic
1037554194 8:20006140-20006162 CAGGAGGCTGAGGCGGAGGATGG + Intergenic
1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG + Intergenic
1038497087 8:28011128-28011150 CAGTAGCTAGTGATGGAGGAGGG + Intergenic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1038805284 8:30785209-30785231 CAGGAGGCTGAGGTGGAGGATGG - Intronic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG + Intergenic
1039856467 8:41419265-41419287 CAAGAGGCTGAGATGGAGGTGGG - Intergenic
1039986568 8:42452680-42452702 AAGGAGGAAAAGATGGAGGAGGG + Intronic
1040523753 8:48199941-48199963 AAGAAGGGAGAGAGGGAGGAGGG - Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041516922 8:58710749-58710771 GAGTAGGGGGAGGTGGAGGAAGG + Intergenic
1041601168 8:59718778-59718800 GAGTAGGCAGAGAAGGAGGAAGG + Intergenic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041963096 8:63642586-63642608 CAGTCGCCAGAGATGAAGGAGGG - Intergenic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1043062631 8:75524606-75524628 CAGTACACAGAAATGGATGAGGG + Intronic
1043283582 8:78501356-78501378 CAGGAGGCAGAGAGAGAGCAAGG + Intergenic
1043744358 8:83855075-83855097 GAGCAGGGAGAGAGGGAGGAAGG + Intergenic
1044090330 8:87992536-87992558 GAGTAGGAAGAGGAGGAGGAGGG - Intergenic
1044428608 8:92082889-92082911 GAGGAGGGAGAGAAGGAGGAGGG + Intronic
1045155299 8:99462177-99462199 CAAAAGGAAGAGATGGAGGGAGG - Intronic
1045411977 8:101929246-101929268 GAGGAGGAAGGGATGGAGGAAGG + Intronic
1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG + Intergenic
1046365693 8:113228256-113228278 AATTAGGCAGAGATAGGGGAAGG - Intronic
1046753397 8:117948184-117948206 TAGTAAGAAGAGATAGAGGAGGG + Intronic
1046763023 8:118041242-118041264 CAGAAAGCAGAGATGGTGCAGGG + Intronic
1046983569 8:120362797-120362819 GAGTAGGAGGAGATGGAGGGAGG + Intronic
1047207935 8:122818484-122818506 AACTAGGCAGAGAGGGAGGAGGG - Intronic
1047495461 8:125405641-125405663 CAGTAGCCAGACTTGGAGGCAGG - Intergenic
1048007693 8:130432178-130432200 GAGAAGGGAGAGAGGGAGGAAGG + Intronic
1048053956 8:130846487-130846509 AAGAAGGAAGAGAGGGAGGAAGG - Intronic
1048188344 8:132264706-132264728 CACTAGACAGAGATAGAGCACGG - Intronic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048690326 8:136955769-136955791 AAGAAGGCAGGGAGGGAGGAAGG - Intergenic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1048800307 8:138188687-138188709 CAGTGGGCAGGGCTGCAGGAAGG - Intronic
1048972863 8:139655005-139655027 CAGTGGACAGAGATGGATGGCGG + Intronic
1049166596 8:141129432-141129454 GAGGGTGCAGAGATGGAGGAAGG - Intronic
1049290490 8:141798976-141798998 AGGGAGGCAGGGATGGAGGAAGG - Intergenic
1049678111 8:143902526-143902548 CAGTAGGCAGGGGCGGGGGATGG - Intergenic
1049791434 8:144474404-144474426 CAGTAGGCAGGGCTGGTTGACGG + Exonic
1049850779 8:144829136-144829158 CAGTGGGCAGAGCAGGAGGTGGG - Intronic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050929820 9:11308743-11308765 CAGGAGGCAGATAAGGGGGAGGG + Intergenic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1051357710 9:16254892-16254914 GAGGAGGAAGAGGTGGAGGAAGG + Intronic
1052834379 9:33239808-33239830 CAGGAGGCAGAGAAGGGGGCTGG - Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054969094 9:71063656-71063678 CAGTAGACAAAGATGGCTGAGGG + Intronic
1055699090 9:78921758-78921780 CAGAAGGCTGAGGAGGAGGAAGG + Intergenic
1056238314 9:84618048-84618070 TAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1056762362 9:89424679-89424701 CATTGGGCAGAGGTGGGGGAGGG - Intronic
1056832935 9:89931244-89931266 CAGCAGGAAGAGGTGCAGGAAGG + Intergenic
1057383600 9:94589526-94589548 CAGTGAGCAGACATGGAGCATGG - Intronic
1057980880 9:99661996-99662018 CAGATGGTAGAAATGGAGGAAGG + Intergenic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1059072416 9:111152796-111152818 AAGGAGGCAGAGGAGGAGGAAGG + Intergenic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059333239 9:113549899-113549921 CAGGAGGCTGAGATGGGAGATGG + Intronic
1059456361 9:114402610-114402632 CAGTGGGCTGGGATGGAGGGGGG + Exonic
1060374336 9:123105229-123105251 CACCAGGCAGAGATGGAAGAGGG + Intergenic
1060771597 9:126336016-126336038 CAGGAGGCCGAGATGGTGGGAGG + Intronic
1060803980 9:126563523-126563545 CAGGATGCAGAAGTGGAGGACGG + Intergenic
1061036808 9:128118768-128118790 AGGGATGCAGAGATGGAGGATGG + Intergenic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061339157 9:129965443-129965465 GAGTAGCCAGAGAAGGAGGGAGG - Intronic
1061888498 9:133605491-133605513 CAGGTGGCAGAGGTGGAAGAAGG - Intergenic
1062014839 9:134286161-134286183 CAGTAGGCGAGGAAGGAGGATGG - Intergenic
1062478851 9:136742360-136742382 CAGCAGGCAGAGTTGGGGGCCGG - Intronic
1062682146 9:137787824-137787846 CAGTAGGCAGAGCTGGTTGACGG + Intronic
1062699084 9:137889868-137889890 AAGGAGGCAGAGAGGGAGGGGGG - Intronic
1185499479 X:585722-585744 CCGGAGACAGGGATGGAGGAGGG - Intergenic
1185598408 X:1322691-1322713 CAGTGGGCAGCTTTGGAGGAAGG - Intergenic
1185678002 X:1864467-1864489 CAGGAGGCTGAGGTGGAGGGGGG - Intergenic
1185698348 X:2213019-2213041 AAGGAGGGAGAGATGAAGGAAGG + Intergenic
1185820220 X:3195907-3195929 CAGAAAGGAGGGATGGAGGAAGG + Intergenic
1185872473 X:3675448-3675470 GAGAAGGAAGAGATGGAGGAGGG - Intronic
1185959140 X:4528193-4528215 TAGCAGGGAGAGATGGAGGAAGG - Intergenic
1186033511 X:5395381-5395403 GAGTAGGCTGAGGAGGAGGAAGG + Intergenic
1186184027 X:7002602-7002624 CAGTTGGAAGACATGGAGAAGGG + Intergenic
1187173786 X:16876543-16876565 CAGTAGTCATTGATGGAGGAAGG - Intergenic
1187178576 X:16919770-16919792 CAGAAGGCAGAGAGGAAAGATGG + Intergenic
1187608352 X:20911951-20911973 AAGCAGACAGAGATGGAGGTGGG - Intergenic
1187628920 X:21146435-21146457 CGGGAGGCTGAGGTGGAGGATGG - Intergenic
1188056287 X:25544481-25544503 CAGTAGGAAGGGATGGAGGAAGG - Intergenic
1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG + Intergenic
1189302109 X:39959662-39959684 CAGCAGGGAAAGATGGAGGAGGG + Intergenic
1189753074 X:44242753-44242775 CAGTAGGAGGAGATGGTGGATGG - Intronic
1189960344 X:46318585-46318607 CAGAAGGAAGGGATGGAGGAAGG + Intergenic
1191666329 X:63706415-63706437 CAGGAGGATGAGGTGGAGGAGGG - Exonic
1191786873 X:64925635-64925657 AAGTAGGCATGGAGGGAGGAGGG - Intronic
1192153648 X:68727182-68727204 GAGTAGGCAGAGATGAGGGATGG - Intergenic
1192295455 X:69842865-69842887 CAGAAGGCAAAGGTGGAGCAGGG - Intronic
1192901715 X:75505998-75506020 CACTAGGCAAAGATGAGGGAAGG + Intronic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1194839095 X:98716152-98716174 CAGAAGGCAAAGGTGGAGCAAGG - Intergenic
1195306154 X:103585802-103585824 CAGTGGGCAGAGGGTGAGGAAGG + Intronic
1195385257 X:104308135-104308157 GAGTAGGCTGAGAAGGAGGAAGG - Intergenic
1195681050 X:107546974-107546996 CCTCATGCAGAGATGGAGGAGGG - Intronic
1195907263 X:109856761-109856783 GAGAAGGCAGAGAGAGAGGATGG + Intergenic
1196723738 X:118877962-118877984 AACTTGGCAGTGATGGAGGAAGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197288486 X:124625663-124625685 CAGAAGGCAAAGGGGGAGGAAGG + Intronic
1197353783 X:125409205-125409227 AAGAAGGCAGAAATGGAGAAAGG - Intergenic
1197835154 X:130686385-130686407 CAGAAGGCAAAGATGGAGCGAGG - Intronic
1198041782 X:132859848-132859870 AAGGAGGGAGAGATGGAGGGAGG + Intronic
1198400416 X:136263196-136263218 GAATTGGCAGAGATGGAGGTGGG - Intergenic
1198481702 X:137047189-137047211 CAGTAGGCAGAGGAAGAGGGGGG + Intergenic
1199635756 X:149809988-149810010 CAGGAGGCTGAGAAGGAGAATGG + Intergenic
1199833422 X:151565410-151565432 GAGTTGGCAGTGATGGAGGGAGG + Intronic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1201226494 Y:11823910-11823932 CAGGAGGCGGAGGTGGAGGTTGG - Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201381116 Y:13380164-13380186 CAGTTGGAAGAGATAGAGCAAGG + Intronic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic
1201954101 Y:19602112-19602134 AAGAATGCAGTGATGGAGGAAGG + Intergenic