ID: 912366036

View in Genome Browser
Species Human (GRCh38)
Location 1:109134656-109134678
Sequence AGGGCTTTATCTACACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912366036_912366038 -8 Left 912366036 1:109134656-109134678 CCTGCTTGTGTAGATAAAGCCCT No data
Right 912366038 1:109134671-109134693 AAAGCCCTGCGGAGCTGAGCTGG No data
912366036_912366042 28 Left 912366036 1:109134656-109134678 CCTGCTTGTGTAGATAAAGCCCT No data
Right 912366042 1:109134707-109134729 ATTACAACTTTGAAGCCCTCTGG 0: 1
1: 0
2: 1
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912366036 Original CRISPR AGGGCTTTATCTACACAAGC AGG (reversed) Intronic