ID: 912370818

View in Genome Browser
Species Human (GRCh38)
Location 1:109172773-109172795
Sequence GCTGGAAAGCTGCTGGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 2, 2: 2, 3: 31, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912370818_912370825 6 Left 912370818 1:109172773-109172795 CCAAAGACCAGCAGCTTTCCAGC 0: 1
1: 2
2: 2
3: 31
4: 236
Right 912370825 1:109172802-109172824 ACTGGGTCTTCTGCCGGGCATGG No data
912370818_912370826 9 Left 912370818 1:109172773-109172795 CCAAAGACCAGCAGCTTTCCAGC 0: 1
1: 2
2: 2
3: 31
4: 236
Right 912370826 1:109172805-109172827 GGGTCTTCTGCCGGGCATGGTGG 0: 1
1: 0
2: 8
3: 86
4: 604
912370818_912370823 0 Left 912370818 1:109172773-109172795 CCAAAGACCAGCAGCTTTCCAGC 0: 1
1: 2
2: 2
3: 31
4: 236
Right 912370823 1:109172796-109172818 TTTAAGACTGGGTCTTCTGCCGG 0: 1
1: 0
2: 1
3: 12
4: 156
912370818_912370824 1 Left 912370818 1:109172773-109172795 CCAAAGACCAGCAGCTTTCCAGC 0: 1
1: 2
2: 2
3: 31
4: 236
Right 912370824 1:109172797-109172819 TTAAGACTGGGTCTTCTGCCGGG 0: 1
1: 1
2: 2
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912370818 Original CRISPR GCTGGAAAGCTGCTGGTCTT TGG (reversed) Intronic
901795626 1:11677709-11677731 CCTGGAGAGCTGCTGGGCCTCGG - Intronic
902287621 1:15416727-15416749 GCGGTGAAGCTGCTGGTGTTTGG - Intronic
902385251 1:16072589-16072611 GTTGGAAAGCTGGTGGTGATGGG + Intronic
905044222 1:34983820-34983842 GCTGGGTTGCTGCTGGTCATGGG - Exonic
906193665 1:43915202-43915224 GCTGAAGAGCTGCTGGTCACTGG + Intronic
907823638 1:57994574-57994596 GCCCCAAAGCTGCTGGTCCTAGG - Intronic
909071626 1:71001068-71001090 ACTGGAAAGCAGGTGGTCTAGGG + Intronic
910865397 1:91783654-91783676 GCTCAAAAGTTGCTGGTCATTGG - Intronic
911046049 1:93629280-93629302 GCAGGAAGGATGCTGGTATTGGG - Intronic
911086291 1:93980165-93980187 GCTGAAAAGCAGCTGGGCTGTGG - Intergenic
911184382 1:94888537-94888559 GCTGGAAAGCTGCTCCAGTTTGG - Intronic
912370818 1:109172773-109172795 GCTGGAAAGCTGCTGGTCTTTGG - Intronic
912430101 1:109624402-109624424 GCCGTGAAGCTGCTGGTCTATGG - Intronic
912433396 1:109641677-109641699 CCTGGGAACCTGCTGATCTTGGG + Intergenic
912625269 1:111200906-111200928 ACTGGAAACCGGCTGGTCTCAGG + Exonic
917072260 1:171165046-171165068 ACTGAAAAGCTGATTGTCTTTGG - Intergenic
920652754 1:207851075-207851097 GCTGACAAGCTTCTGGGCTTTGG + Intergenic
923265007 1:232306014-232306036 GTTGGAAGGGTGCTGGGCTTGGG - Intergenic
1063063893 10:2589288-2589310 GGTGTAAAGCTTCTGGGCTTTGG - Intergenic
1063123896 10:3123778-3123800 GCTGGGAAGCAGCTGGCATTTGG + Intronic
1064897028 10:20248639-20248661 GCTGGTAAGCAGCTGATTTTTGG + Intronic
1065270234 10:24023362-24023384 GATGGAAAACTGCTGGTTATAGG - Intronic
1066478424 10:35771125-35771147 CCTGGATAGGTGCTGGTCCTGGG - Intergenic
1067184064 10:44012288-44012310 GCTGGAAAGCAGCTGACTTTAGG + Intergenic
1067549313 10:47222445-47222467 GCTGGAAAGCTCAGGGTCTGGGG + Intergenic
1067677000 10:48389961-48389983 GCTTGCAAGCTGCAGATCTTGGG - Intronic
1070050867 10:72888454-72888476 GTTGGAAAGTTTCTGGTCTAAGG - Intergenic
1070960740 10:80498550-80498572 TCTGGAAAGCACTTGGTCTTAGG + Intronic
1071391587 10:85180596-85180618 GCAGGAAAGGTGGTGGTGTTTGG - Intergenic
1071525051 10:86353714-86353736 GCTGGCAAACTGCAGGACTTGGG + Intronic
1073607104 10:104907517-104907539 GCTGGGAAGCTGCTGCTGGTGGG + Intronic
1074497227 10:113990741-113990763 GGTGCAAAGCTGCTGGACTGCGG - Intergenic
1074987238 10:118669185-118669207 GCTGAAATGCTGCTGCTCTGCGG - Intergenic
1076053574 10:127353446-127353468 GCAGCAAAGCTACTGGACTTGGG - Intronic
1076176735 10:128374005-128374027 GCTGGACAGCTGCAGGTCGGGGG - Intergenic
1076287169 10:129311535-129311557 GCTTGAAAGCTGCTGGCCTATGG - Intergenic
1076301718 10:129433458-129433480 GCTGGAAAGTTGCTGGGGTTGGG - Intergenic
1076798053 10:132808300-132808322 TCTGGAAAGCTGCTGGGTTCAGG + Intergenic
1076840035 10:133041338-133041360 GCTAGAAAGCTGCCGGCCCTTGG - Intergenic
1076984216 11:223674-223696 GGTGGGAAGCTGCTGGGCTTTGG - Intronic
1078125250 11:8555267-8555289 AATGGAAAGCTGCTGGTCAAAGG + Intronic
1079225278 11:18599673-18599695 GCTGCTCAGCTGCTGGTCTGGGG + Intergenic
1080087119 11:28296899-28296921 GCTGGCAAGCTGCTGGGTTCTGG - Exonic
1080200013 11:29657925-29657947 GCTGAAAGGCTGCTGGTCAAGGG - Intergenic
1080774570 11:35373450-35373472 GCTGGGGAGCAGCTGGTCTAGGG + Intronic
1081664420 11:44908263-44908285 ACAGGAAAACTGCTGGGCTTTGG - Intronic
1081728201 11:45347983-45348005 GCTTGGAAGCAGCTGGTTTTTGG - Intergenic
1082251052 11:49980722-49980744 GCTGGAATACTGGTGGGCTTAGG - Intergenic
1083202040 11:61126514-61126536 GTTGGAAGGCTGCTTGTTTTGGG - Exonic
1083848890 11:65354116-65354138 GCTGGAGAGCAGCTGGGCTGCGG + Intergenic
1084052705 11:66610952-66610974 GCGGGGATGCTGCTGGTATTGGG + Intergenic
1084509550 11:69594748-69594770 GCTGGGAAGGTGCTGGGCGTGGG - Intergenic
1084636247 11:70394781-70394803 ACTGCAAAGCTGCTGGGCCTGGG - Intergenic
1089508180 11:118979013-118979035 CCTGGAAAGCTGGAGGTCTCAGG + Exonic
1089812864 11:121145895-121145917 GCTGCACAGCTGCTGCACTTTGG - Exonic
1091809963 12:3389009-3389031 GCTGGCAAGCAGGTGGTCCTGGG - Intronic
1094157783 12:27355610-27355632 CCTGGGAAGTTGCTGGCCTTGGG + Intronic
1094324654 12:29223752-29223774 TCTGAAAAGCTGCTGGTCTTGGG + Intronic
1097326725 12:58285633-58285655 GCAGGAAAGCTCCTAGTCGTAGG - Intergenic
1097369134 12:58754702-58754724 ACTGAAAAGATGCTGGTCATGGG + Intronic
1098358555 12:69633306-69633328 GCTGGAAAGTGGCTGGTCTAAGG - Intergenic
1101765711 12:107697232-107697254 GCTGTGCTGCTGCTGGTCTTTGG - Intronic
1102241938 12:111329936-111329958 GCTGGAAAACTGACGGTCTTTGG - Intronic
1103221802 12:119252561-119252583 GCTTCAAAGCTTCTGGTCTTGGG - Intergenic
1106176435 13:27336370-27336392 GCTGGGCAGCTGCTGGGCTGGGG - Intergenic
1107305805 13:39017872-39017894 TCTGGAAAGATGCTGGCCTGAGG + Intronic
1110118997 13:71858650-71858672 ACTGGAGAGCTGTTGGTCTAAGG - Intronic
1110769372 13:79321233-79321255 GCAGGAGAGCTCCTGGTATTAGG - Intronic
1113967879 13:114164815-114164837 CCTGGGAGGCTGCTTGTCTTTGG - Intergenic
1117636413 14:57749051-57749073 GCTGGTAAGCAGCTGAGCTTGGG + Intronic
1118318121 14:64737874-64737896 GCTGGAACCCTCCTGGACTTTGG + Intronic
1119514952 14:75240703-75240725 GCTGGAAAGATGCTGATCCATGG - Intronic
1119936885 14:78600133-78600155 CCTGGATTGATGCTGGTCTTGGG + Intronic
1121055115 14:90845781-90845803 GCTGGCATGCTGCTTCTCTTGGG + Intergenic
1121138582 14:91521063-91521085 ACTCCAAAGCTGCTGGTATTTGG + Intergenic
1122368498 14:101213709-101213731 GCTGGAAAGCTGCTGCTTTGGGG - Intergenic
1122539039 14:102486609-102486631 GCTGGAAAACTGCTGGTCTTCGG + Intronic
1124169184 15:27357340-27357362 GATGTAAAGCTACTGGTCTGTGG + Intronic
1125798678 15:42424928-42424950 GCCCGAAAACTGCTGGTCGTGGG - Exonic
1127353456 15:58174938-58174960 GGTGGAAAACTGCTGATCGTGGG + Exonic
1127937682 15:63658469-63658491 GCTGGAAGTCTGGTGGTGTTTGG - Intronic
1128539315 15:68515355-68515377 GCTTGAGAGCTGCTGTTCTAGGG + Intergenic
1129521740 15:76190560-76190582 GCGGGACAGCTGCTGGACTTGGG + Intronic
1130536321 15:84787425-84787447 GCTTGATGGCTGCTGGGCTTGGG + Intronic
1130573319 15:85068471-85068493 CCTGGATAGCTGCTTGTCTCTGG + Intronic
1131861665 15:96660564-96660586 GCTGGAAAGCAGCCTGTCCTGGG + Intergenic
1132086501 15:98912400-98912422 GCTGGACAGCTGCTGGCCGCTGG - Intronic
1132201050 15:99955045-99955067 ACTGGAAACATGCTGGTCTTTGG + Intergenic
1132485931 16:190977-190999 GCTTGAAAACAGCAGGTCTTTGG - Intronic
1132786121 16:1657842-1657864 GCTGGCGAGCTGCTGGACATGGG + Intronic
1133256746 16:4521767-4521789 GCTGGAAAGTGGTGGGTCTTGGG - Intronic
1136071746 16:27791613-27791635 GGTGGAGAGCTGGTGGTGTTGGG - Intronic
1136474358 16:30503337-30503359 GGTGGAAAGATCCTGGACTTTGG + Intronic
1136682519 16:31976412-31976434 GCTGGAAGGCTTCTGGGCTTGGG + Intergenic
1136782779 16:32917580-32917602 GCTGGAAGGCTTCTGGGCTTGGG + Intergenic
1136887018 16:33936270-33936292 GCTGGAAGGCTTCTGGGCTTGGG - Intergenic
1137314187 16:47299436-47299458 GGGGGAAAGCTGGTGGTGTTGGG + Intronic
1138624186 16:58236339-58236361 CCTGGAATGCTGCTGGTCCCTGG - Intronic
1141399825 16:83737865-83737887 GCTGGAAAGCTGCATGACTCAGG + Intronic
1142433514 16:90043223-90043245 GAGGCAAAGCTGCTGGCCTTCGG + Exonic
1203085430 16_KI270728v1_random:1181564-1181586 GCTGGAAGGCTTCTGGGCTTGGG + Intergenic
1143458008 17:7080164-7080186 ACTGGAGTCCTGCTGGTCTTGGG + Exonic
1143889808 17:10094162-10094184 GCCTGCAAGCTGCTGATCTTGGG - Intronic
1144684607 17:17217654-17217676 GCTTGACGGCTGCTGTTCTTTGG + Intronic
1146018473 17:29252696-29252718 GCTGGGATGTTTCTGGTCTTTGG + Intronic
1146843590 17:36170250-36170272 GCTGCCAAGCTCCTGGGCTTTGG + Intronic
1146855897 17:36258188-36258210 GCTGCCAAGCTCCTGGGCTTTGG + Intronic
1146864723 17:36330187-36330209 GCTGCCAAGCTCCTGGGCTTTGG - Intronic
1146871803 17:36382099-36382121 GCTGCCAAGCTCCTGGGCTTTGG + Intronic
1146879164 17:36433181-36433203 GCTGCCAAGCTCCTGGGCTTTGG + Intronic
1146986536 17:37225401-37225423 ATTGCAAAGCTGCTGGTCCTAGG + Intronic
1147067584 17:37930781-37930803 GCTGCCAAGCTCCTGGGCTTTGG - Intronic
1147074690 17:37982723-37982745 GCTGCCAAGCTCCTGGGCTTTGG + Intronic
1147079113 17:38010336-38010358 GCTGCCAAGCTCCTGGGCTTTGG - Intronic
1147086213 17:38062262-38062284 GCTGCCAAGCTCCTGGGCTTTGG + Intronic
1147095052 17:38134278-38134300 GCTGCCAAGCTCCTGGGCTTTGG - Intergenic
1147102159 17:38186227-38186249 GCTGCCAAGCTCCTGGGCTTTGG + Intergenic
1147143044 17:38469750-38469772 GCTGGAAGGCTTCTGGGCTTGGG + Intronic
1149374451 17:56030387-56030409 CCTGGCCACCTGCTGGTCTTAGG - Intergenic
1149846748 17:60012738-60012760 GCTGCCAAGCTCCTGGGCTTTGG + Intergenic
1150085095 17:62269312-62269334 GCTGCCAAGCTCCTGGGCTTTGG + Intergenic
1150845945 17:68658039-68658061 TGTGGAAAGGTCCTGGTCTTGGG - Intergenic
1151070416 17:71204156-71204178 GCTGGAATGCTGCTGGCATAGGG + Intergenic
1151115617 17:71731813-71731835 GCTGGAAAGCTGCTGCTCTTGGG - Intergenic
1151453752 17:74214258-74214280 GCTGGAAGGCTGCAGGGCTTGGG + Intronic
1151657279 17:75501937-75501959 GCTGGAAGGCTGCTGGGCTCGGG + Exonic
1151803487 17:76391313-76391335 TCTGGCGAGCTGCTGGCCTTGGG + Exonic
1153819774 18:8823520-8823542 GCTGGAAAGCTCATGACCTTGGG + Intronic
1154002848 18:10498589-10498611 GCTGCAATGCTGCTGGTCCAGGG - Intergenic
1155687706 18:28575906-28575928 CCAGGAAAGCTGCTTGTCTGAGG + Intergenic
1155800374 18:30094118-30094140 GATTAAAAGATGCTGGTCTTAGG - Intergenic
1156224044 18:35084729-35084751 GTTTGAAAGCTACTTGTCTTTGG + Intronic
1159223047 18:65490669-65490691 GCTTGATAGCTGCAGGTGTTTGG + Intergenic
1159233366 18:65637613-65637635 TCTGGAAGGCAACTGGTCTTGGG + Intergenic
1159693172 18:71517667-71517689 GCTAGAAACCTGCTGATCTGGGG - Intergenic
1160336789 18:78048925-78048947 GCTGGAGAGCAGCTGTTCTGAGG - Intergenic
1160787747 19:909138-909160 GCTGGGGAGCTGCTGGAGTTTGG + Intronic
1161964415 19:7540374-7540396 TCTGTAGAGCTGGTGGTCTTTGG + Intronic
1164225427 19:23241280-23241302 GCTGTGAACCTTCTGGTCTTGGG - Intronic
1166126733 19:40719099-40719121 GCTGGCAAGCTGATGGACTCCGG - Intronic
1166599915 19:44084546-44084568 GCTTGAAAGCTGCCTGTCTGGGG - Intronic
1167636030 19:50656298-50656320 GCTGGGAAGCTGGTGGTGTGGGG - Exonic
925302252 2:2825756-2825778 GCTGGTGAGTTGGTGGTCTTGGG - Intergenic
925346444 2:3175238-3175260 CCTGGAAAGCTGGTGTTCTATGG - Intergenic
927709059 2:25314019-25314041 GCTGGGGGGCTGCTGGGCTTTGG + Exonic
929116335 2:38447508-38447530 GCAGAAAAGCTGCTCTTCTTGGG + Intergenic
929267904 2:39939781-39939803 GCTGGAGAGCTGTTTGTCTCAGG - Intergenic
930420996 2:51152638-51152660 ACAGGAAAGCAGCTGGTGTTAGG + Intergenic
930770262 2:55123936-55123958 TCTGTAAGGCAGCTGGTCTTGGG + Intergenic
933771413 2:85746756-85746778 GCTGGAAAGATGGTGGGATTTGG - Intergenic
935805970 2:106748036-106748058 ACTGCAAAGGTGCTGGTCCTGGG - Intergenic
937199019 2:120185044-120185066 GTTGGTAAGCTGCTTGTCTGGGG + Intergenic
938987336 2:136590855-136590877 GCTGTGAAGCTGCAGCTCTTAGG + Intergenic
941205140 2:162562695-162562717 ACTGGCAAGCTGCTTCTCTTTGG - Intronic
941792058 2:169563173-169563195 GGTGGAAAGATCCTGGGCTTTGG - Intronic
942487790 2:176457379-176457401 TCTGGAAAGCAGGTGGCCTTTGG - Intergenic
942608874 2:177720572-177720594 GCTGGAAAGGTTCTGGTCTCTGG - Intronic
945548177 2:211184626-211184648 GCTTGCTAGCTGCAGGTCTTGGG - Intergenic
946943494 2:224795078-224795100 GCTGGGAAATTGCTGTTCTTTGG + Exonic
947038975 2:225893225-225893247 CCTGGGAAGCTTCTGGCCTTTGG + Intergenic
947240092 2:227985066-227985088 GATGGAAAGAAGCTGGTGTTAGG - Intronic
1169498955 20:6141085-6141107 GCAGGAAAGAGGCAGGTCTTGGG - Intergenic
1172692600 20:36800505-36800527 TCTGGAAAGTTCCTGGTCCTGGG - Intronic
1172856333 20:38006299-38006321 TCTCAAGAGCTGCTGGTCTTTGG + Exonic
1174387084 20:50193667-50193689 GCTGGGAAGCTGCTGGCATTTGG + Intergenic
1175978429 20:62725257-62725279 GCCAGAATGATGCTGGTCTTGGG - Intronic
1175993400 20:62801181-62801203 CCAGGGAAGCTGCTGGTCTACGG + Exonic
1176362572 21:6010219-6010241 GCTGGAGGGCTGCTGGGCTCTGG + Intergenic
1179760946 21:43528326-43528348 GCTGGAGGGCTGCTGGGCTCTGG - Intergenic
1181185514 22:21100667-21100689 TGTGGAAACCTGATGGTCTTGGG - Intergenic
1181314960 22:21964938-21964960 GCTGGAAAGCTGGTGGTCTCTGG - Intronic
1182636612 22:31732744-31732766 TCTGAAAACCTGCTGGTTTTGGG + Intronic
1183065706 22:35361292-35361314 GGTGGAAAGCCCCTGGCCTTTGG - Intergenic
1183364831 22:37401384-37401406 GCAGCAAAGCTGGTGGTCATGGG + Intronic
1183511057 22:38235236-38235258 ACTGGAAAGCTGATAGTCTTGGG - Intronic
1183511215 22:38236147-38236169 ACTGGAAAGTTGATGGCCTTGGG + Intronic
1183548175 22:38466491-38466513 GTAGCAATGCTGCTGGTCTTTGG + Intergenic
1184283929 22:43455794-43455816 GCTTGAAAGTTTCTTGTCTTTGG + Intronic
950463792 3:13141377-13141399 GCTGGCAAGCTGCTGGCATGCGG - Intergenic
952929073 3:38346104-38346126 TCTGGAAAGCAGTTAGTCTTAGG + Intergenic
953658607 3:44873731-44873753 GATGGCAAGCTTGTGGTCTTTGG + Intergenic
954534053 3:51344806-51344828 GCTGGAACACTGGTGGGCTTGGG - Intronic
958055049 3:88399556-88399578 GCTGGTAAGGTGCTGGACATTGG + Intergenic
958843625 3:99239049-99239071 GATGGAAAGCTGTTGGTCAATGG - Intergenic
959552210 3:107674640-107674662 GTTTGAAAGCTGCTTTTCTTAGG + Intronic
962167981 3:133070275-133070297 TCTGGAAAGGTTCTGGTCTTGGG + Intronic
962491418 3:135897297-135897319 GATGCAATGCTGCTGGTCTAAGG - Intergenic
963138348 3:141928293-141928315 GATGCAAAGCTGGTTGTCTTTGG - Intergenic
964667802 3:159192918-159192940 CCTGCAATGCAGCTGGTCTTAGG + Intronic
966008410 3:175046302-175046324 GATGCAATGCTGTTGGTCTTTGG + Intronic
966229962 3:177640989-177641011 GCTGGGAAGCTCATGGTCTGGGG - Intergenic
966856738 3:184199241-184199263 GCTCTACAGCTGATGGTCTTAGG + Intronic
967192979 3:187001088-187001110 GCTTGAAACCTGTGGGTCTTCGG - Intronic
975110079 4:70613593-70613615 GCTGGAAAGCTGCTGAACCCTGG - Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
976414574 4:84757893-84757915 GTTGGAAAGCTGCTGGGCAGTGG + Intronic
978498067 4:109381044-109381066 GCTGGAAAGCTGCCAGTCACAGG + Intergenic
979767937 4:124484794-124484816 TTTGGAAAACTGCTGGTCTCCGG + Intergenic
980110852 4:128635362-128635384 GCTGCAAAGCCGCTGGGATTCGG - Intergenic
980933707 4:139206315-139206337 GCTGGAAAGCAACTGGGATTTGG - Intergenic
981266700 4:142792708-142792730 CCTGGAAAGCTGCTGTGCTTAGG - Intronic
981358705 4:143822381-143822403 CCTTGAAAGCTGCTGGTTTGGGG - Intergenic
982269179 4:153569230-153569252 GCTGGAAATCGGCTGATCTCAGG - Intronic
982304635 4:153917656-153917678 ACTGGAAAGCTGCAATTCTTTGG + Intergenic
982918898 4:161249787-161249809 GCTGGAAAGGAGCAGGTCTCTGG - Intergenic
984924094 4:184791573-184791595 GCTGGAAACCTGCTGTCCCTAGG - Intronic
986110685 5:4713305-4713327 GCTGTAAATCTTCTGGTCCTGGG - Intergenic
990241261 5:53818701-53818723 GATGGAAAACTACTGGTCTTGGG + Intergenic
991190382 5:63865713-63865735 GATGGGAAACAGCTGGTCTTTGG + Intergenic
991363664 5:65846189-65846211 GCTTGCAAACTGCTGATCTTGGG - Intronic
992758167 5:79928801-79928823 GCTGGTAAGCTGGTGTGCTTTGG - Intergenic
994165789 5:96606829-96606851 GATGCTAAGCTGCTGGTCTGGGG - Intronic
994524574 5:100887637-100887659 GCTGGAAAACTGATGATCCTTGG + Intronic
995275618 5:110274491-110274513 GCTTGAAAGCTGTTTGTCATAGG + Intergenic
996207975 5:120766209-120766231 CCTGGAATGCTGCTGGTGTCAGG - Intergenic
996288315 5:121822110-121822132 GCTAAAAAGCTGCTGCTGTTTGG - Intergenic
996779610 5:127171489-127171511 GCGGGATAGTTGTTGGTCTTTGG - Intergenic
996962678 5:129270025-129270047 GCTGGGAATGTGCTGGTCTGAGG + Intergenic
998628457 5:143872206-143872228 TCTACAAAGTTGCTGGTCTTTGG + Intergenic
999082991 5:148861856-148861878 GCTTGCAAACTGCTGATCTTGGG - Intergenic
1001347161 5:170914542-170914564 GGTGGTCAGCTGCTGGACTTAGG - Intronic
1001865094 5:175096923-175096945 GTTGAAAGGCTGCTTGTCTTAGG + Intergenic
1002962053 6:1924430-1924452 CCTGGAAAGAGGCTGGACTTAGG + Intronic
1003029900 6:2592889-2592911 GCTGGAGGTGTGCTGGTCTTGGG + Intergenic
1007670547 6:43549470-43549492 GCTGGTAAGCTGCTGGACCCTGG - Exonic
1007962991 6:45978005-45978027 GCAGGGAAGCTCCTGGGCTTTGG + Intronic
1008508714 6:52256208-52256230 GCTGGAGAGCAGATGGTTTTGGG - Intergenic
1008521938 6:52370152-52370174 TCTGAGAAGCTGCTGGTCTGAGG + Intronic
1010908202 6:81519588-81519610 GCTGGAAAGCAGATGGGGTTAGG - Intronic
1011582896 6:88890494-88890516 GCTGGAAAGCAGATGGTACTCGG - Exonic
1013643155 6:112107770-112107792 GCTGGAAGGCAGATAGTCTTTGG + Intergenic
1016219561 6:141650836-141650858 ACTGGAAATCTGCTTTTCTTAGG - Intergenic
1020657922 7:10949795-10949817 CCTGAAAAGCTGCTAGTTTTGGG - Intergenic
1021207799 7:17806958-17806980 GGAGGAAATCTGCTGGTCTGTGG - Intronic
1021913315 7:25407645-25407667 GTTGGATAGCTGCTGATATTGGG - Intergenic
1022679365 7:32529359-32529381 GCTGTAAATCTCCTGGTTTTAGG + Intronic
1023121809 7:36916783-36916805 GCTGGAAACCTCCTGCTCTAAGG + Intronic
1027865467 7:83640469-83640491 GCTGGGAAGCTGATGCTCTCAGG - Intronic
1027951165 7:84818199-84818221 GCTGGAAAGCTGCTAAATTTTGG + Intergenic
1028264721 7:88708928-88708950 CCTGGAAAGCTGCTTTACTTTGG + Intergenic
1029217356 7:98960553-98960575 GTTTGAAAGATGCTTGTCTTTGG + Intronic
1034009219 7:147509463-147509485 GAAGGAAAGCAGCTGGACTTGGG + Intronic
1037872398 8:22510599-22510621 GATGGAAAGCTGCTGGACTGCGG - Intronic
1037912674 8:22753301-22753323 TCTGGAAACCTGCTTGTCTCTGG - Intronic
1038219425 8:25593394-25593416 TCTGGAAAGCTGTGGGTCTTGGG + Intergenic
1039079057 8:33718085-33718107 TCTGTAAAGCTGCTGGCCTCTGG + Intergenic
1039810542 8:41044191-41044213 GCTGGGAGGCTGCTAGTCTGGGG - Intergenic
1039828128 8:41192098-41192120 GCTGGCAAGCGGCTGGGCCTGGG - Intergenic
1040318351 8:46276674-46276696 GCAGGACAGCAGCTGGGCTTGGG - Intergenic
1045174440 8:99706640-99706662 GCTAGAAAACTGCTGGCCTCAGG + Intronic
1045649190 8:104326854-104326876 TTTGAGAAGCTGCTGGTCTTTGG + Intergenic
1045889910 8:107143378-107143400 ACAGGAATGCTGCTGGTCTCAGG - Intergenic
1046591462 8:116212217-116212239 GCTGGGAGGCTGTTGGTCTAGGG - Intergenic
1047049512 8:121095155-121095177 TCTGGGAAGCTCCTGATCTTTGG + Intergenic
1049555681 8:143280430-143280452 GCTTGACAGCTGCAGGTCTTGGG - Intergenic
1051279818 9:15431154-15431176 GCAGGAAAGCTGCTGGGCGCGGG - Intronic
1053612343 9:39727960-39727982 GGTGGCAAGCTGCTGGACTTAGG - Intergenic
1053870378 9:42485959-42485981 GGTGGCAAGCTGCTGGACTTAGG - Intergenic
1054085908 9:60743189-60743211 GGTGGCAAGCTGCTGGACTTAGG + Intergenic
1054241174 9:62614432-62614454 GGTGGCAAGCTGCTGGACTTAGG + Intergenic
1054555303 9:66648956-66648978 GGTGGCAAGCTGCTGGACTTAGG + Intergenic
1061474441 9:130854800-130854822 GGTGAAAAGCTCCGGGTCTTAGG + Exonic
1062516164 9:136937635-136937657 TCTTCAGAGCTGCTGGTCTTTGG + Intronic
1062591460 9:137276613-137276635 GGTGGAATGCTGGTGCTCTTTGG - Intergenic
1189221874 X:39379116-39379138 GCTGCAGATCTGCTGGGCTTGGG + Intergenic
1191257744 X:58287054-58287076 GCTGGAAAGGCACTGGTCTCTGG - Intergenic
1195626331 X:107008372-107008394 GGTGGGAAGCTGTTGGTCTAGGG - Intergenic
1196174625 X:112627338-112627360 GATGGAAAGGTTCTGGTCTCTGG - Intergenic
1197770698 X:130087314-130087336 GCTGGAAAGCCGATGATCTTAGG - Intronic
1200217285 X:154373634-154373656 GCTGAACAGCTCCTGGGCTTGGG - Intronic
1200332638 X:155313764-155313786 GCTGGGAGGCTGGTGGTCTGGGG + Intronic
1201589677 Y:15601295-15601317 GCTGTAATCCTGCTGGACTTTGG + Intergenic