ID: 912372023

View in Genome Browser
Species Human (GRCh38)
Location 1:109181058-109181080
Sequence TATTACCTATAGCATAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912372021_912372023 2 Left 912372021 1:109181033-109181055 CCAATTGACAAAACATGATCTCA No data
Right 912372023 1:109181058-109181080 TATTACCTATAGCATAGTGAGGG 0: 1
1: 0
2: 1
3: 4
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912372023 Original CRISPR TATTACCTATAGCATAGTGA GGG Intronic
906071991 1:43023732-43023754 CATTACCTTTATTATAGTGAGGG + Intergenic
907826133 1:58018439-58018461 TATTACATACAGCATGGAGAGGG - Intronic
907998304 1:59655127-59655149 TAGTACCCACAGCATGGTGAAGG + Intronic
908319827 1:62968406-62968428 TATTCACAATAGCATAGAGATGG + Intergenic
909043456 1:70681715-70681737 TATTCCCAATAGCAAAGTCAAGG - Intergenic
909838203 1:80284705-80284727 TCTTACCTAAAGAATTGTGAAGG + Intergenic
910198339 1:84669497-84669519 TAATACCTACAGTATATTGAAGG - Intronic
910203145 1:84720960-84720982 TATTATTTATAGAATAGTTAAGG + Intergenic
911814460 1:102327492-102327514 TATTAAATATAGCATAGAGTTGG - Intergenic
912237428 1:107867083-107867105 TATGAGATATAGCATAGTAAAGG - Intronic
912372023 1:109181058-109181080 TATTACCTATAGCATAGTGAGGG + Intronic
912401911 1:109400539-109400561 TATTAAGTATAGCATGTTGATGG - Exonic
914925830 1:151885924-151885946 TGTTACCTGTAGCATCTTGAAGG + Intronic
916627341 1:166572409-166572431 TTTTACCTATTGCATAGGAACGG - Intergenic
920926608 1:210347621-210347643 TATTACTTAGAGTATAGTCATGG + Intronic
921827104 1:219684956-219684978 TATTCACAATAGCATAGTCATGG - Intergenic
922421341 1:225462800-225462822 TGTTATCTATAGAACAGTGACGG - Intergenic
923421041 1:233815299-233815321 TATTAGATATAGCATAGATATGG + Intergenic
924362705 1:243257573-243257595 TGTTACTTAAAGCAAAGTGAAGG + Intronic
1066076843 10:31887489-31887511 AATAACCTATTGTATAGTGAAGG - Intronic
1068011349 10:51455442-51455464 TCTTTCCTATCGCATAGTCAGGG + Intronic
1068094527 10:52473928-52473950 TATTACAGATATCATACTGAAGG + Intergenic
1072384998 10:94915566-94915588 TATTACCTATAGCACAGACCTGG - Intergenic
1072410939 10:95201579-95201601 TATTCACAATAGCAAAGTGATGG - Intronic
1072883862 10:99256204-99256226 TATTACCAATACAATAGTGTTGG + Intergenic
1073640417 10:105247122-105247144 TTTTACCAAAAGCACAGTGATGG + Intronic
1076267751 10:129122238-129122260 TATTCCCTCTACCAGAGTGAGGG + Intergenic
1081281446 11:41213471-41213493 TATTACCTGTTGGTTAGTGATGG - Intronic
1086140272 11:83491291-83491313 TATCACTTGTAGCCTAGTGAAGG + Intronic
1090112597 11:123930546-123930568 TATGACATATATCATAGTAAAGG - Intergenic
1091981433 12:4867327-4867349 TATTCCCAATAGCAAAGTCATGG - Intergenic
1096932939 12:55235846-55235868 TACTACCTTTAGCATTGTAAAGG - Intergenic
1100511039 12:95274096-95274118 TATTTACTATAGCATAGTGAGGG + Intronic
1108832232 13:54494523-54494545 TATTACCTATAGAAGATAGATGG + Intergenic
1110443273 13:75549093-75549115 TGGTACCTATATGATAGTGATGG - Intronic
1112527357 13:100164015-100164037 TATAACATAGAGGATAGTGATGG - Intronic
1112715213 13:102176782-102176804 TATTACCTTGATCATGGTGATGG + Intronic
1113720490 13:112552566-112552588 GATTACCTCTAGGATTGTGAAGG - Intronic
1114538419 14:23437403-23437425 TATTATCTATAGCTTTGAGAGGG - Intergenic
1115425383 14:33253046-33253068 TATTCCCAATAGCAAAGTCATGG - Intronic
1115778762 14:36746171-36746193 TATTCCCAATAGCAAAGTCATGG + Intronic
1115938752 14:38585072-38585094 TATTCACAATAGCAAAGTGATGG - Intergenic
1116184579 14:41581319-41581341 CATTACCTATAAAATAGTAAGGG + Intergenic
1117366071 14:55028636-55028658 TATTACAGATATTATAGTGAAGG - Intronic
1118033607 14:61841940-61841962 TATTTACAATAGCATAGTCATGG - Intergenic
1121859236 14:97300713-97300735 TATTACAGAAAGCATAATGACGG + Intergenic
1123784113 15:23651644-23651666 TCTTATCTATAGCACAGTGCTGG - Intergenic
1133786775 16:8980074-8980096 TATTACCTTCATTATAGTGATGG + Intergenic
1137897017 16:52224593-52224615 TATTCCCAATAGCAAAGAGAAGG - Intergenic
1148982142 17:51586428-51586450 TATTCACAATAGCAAAGTGATGG - Intergenic
1151135765 17:71944727-71944749 TATTTTCTATAGCATTGTCAGGG - Intergenic
1152500145 17:80702655-80702677 TCTTACCTATTGCGTAGAGAAGG - Intronic
1156866560 18:41895200-41895222 TACTACCTATAGAATAGTCTTGG - Intergenic
1157303973 18:46503056-46503078 CAGTACCTGGAGCATAGTGAGGG - Intronic
1158375393 18:56857700-56857722 TATTTCCTATAGCATAATCCAGG - Intronic
1163089389 19:15008626-15008648 TATTCACTATAGCAAAGTTATGG + Intronic
1165278709 19:34778036-34778058 TATTACCTTGATTATAGTGATGG + Intergenic
927321902 2:21756856-21756878 TATTACCTTGATCATGGTGATGG - Intergenic
930601341 2:53447059-53447081 TCTTTCCAATAGCATTGTGAAGG - Intergenic
930750973 2:54933762-54933784 AATTACATATAGGATAGTGGGGG - Intronic
946745108 2:222837665-222837687 AATTAACTAAAGCACAGTGAGGG - Intergenic
952565955 3:34658079-34658101 TATTCACTATAGCATAGACATGG - Intergenic
952909680 3:38172337-38172359 TATTAGCAATATCATGGTGATGG - Intronic
955666335 3:61353203-61353225 GATTACGTATAGTATGGTGAGGG + Intergenic
956851062 3:73228646-73228668 TATTACAGCTGGCATAGTGAGGG + Intergenic
959259108 3:104052266-104052288 TATTCCCAATAGCAAAGAGATGG + Intergenic
959776170 3:110166123-110166145 TTTTTCCTTTAGCTTAGTGATGG + Intergenic
959980918 3:112516666-112516688 TATTACCTGTGGGATAGTGGAGG - Intergenic
960602978 3:119476615-119476637 TATTGCCCCTAGCATAGTGCTGG + Intronic
962518711 3:136178288-136178310 TATTACCTATAAGATAATGTAGG + Intronic
963353804 3:144185149-144185171 TATTACCTATAGAGCAGTTAAGG - Intergenic
964227614 3:154426315-154426337 TTTTTCCTATGTCATAGTGATGG - Intronic
966485145 3:180460465-180460487 TATTCCCAATAGCAAAGTCATGG - Intergenic
970473388 4:16398814-16398836 TGTGACCTATAGCAGAGTAAGGG - Intergenic
971100469 4:23460854-23460876 TATTAACAATAGCAAAGTCATGG + Intergenic
971125615 4:23750798-23750820 TATTAAATATATCATAGTGAGGG - Intergenic
973006043 4:45007984-45008006 TGTGACCAATAGCACAGTGATGG - Intergenic
977147119 4:93457693-93457715 GATTACCTATAGCGTGGTGTGGG + Intronic
978092675 4:104737173-104737195 TATTACCTCTGGCATAGGTAGGG - Intergenic
981557649 4:146012749-146012771 TATTTCCTAAAGCATACTCATGG + Intergenic
982524160 4:156456576-156456598 TATTCACTATAGCAAAGTCATGG + Intergenic
982625692 4:157763323-157763345 TATTACAGATAGCATATTGCTGG - Intergenic
985313357 4:188628384-188628406 AATTTTCTATAGCAAAGTGAAGG + Intergenic
986198819 5:5562308-5562330 AATTACCTTTAGCATAGAGATGG - Intergenic
988979778 5:36555323-36555345 TATTCCCAATAGCAAAGTCATGG - Intergenic
990495491 5:56343643-56343665 AATTACTTAAAGCATAGTGGTGG + Intergenic
995301654 5:110591562-110591584 TATTACCTAGTGCATGGTAAAGG - Intronic
995449295 5:112282597-112282619 TATTCCCTAGAGCACAGTAAGGG + Intronic
995687702 5:114789018-114789040 CATTACCTATAGGATAATGTTGG + Intergenic
998280113 5:140797816-140797838 TATTAACTATTGCATAGACAAGG - Intronic
998539153 5:142963281-142963303 TATTATCAATAGCAAAGTCACGG - Intronic
999511507 5:152257264-152257286 TGTTACCTTTAGTATAATGAGGG - Intergenic
999934473 5:156471064-156471086 TACTACCTATAGCCTAGCAATGG - Intronic
1000771211 5:165357325-165357347 TATTAACTAGGGGATAGTGAGGG + Intergenic
1002629801 5:180564381-180564403 TAGTAACTATAACATAGTTATGG + Intronic
1009297389 6:61969738-61969760 TGTTATCCATAGCATACTGAAGG - Intronic
1009716495 6:67404510-67404532 TATTCACAATAGCAAAGTGATGG - Intergenic
1009776553 6:68212771-68212793 TCTGACCTATAGCTGAGTGATGG + Intergenic
1010457208 6:76070534-76070556 TATTACCAATAGCAAAGATAGGG + Intronic
1010622506 6:78093552-78093574 TATTAACAATAGCATCGGGAAGG + Intergenic
1011231232 6:85164556-85164578 AATTATCTATAGCAGAATGAAGG - Intergenic
1012749201 6:103136215-103136237 TATTACCTTGATCATGGTGATGG + Intergenic
1012845815 6:104387125-104387147 TATTAACAATAGCAAAGTCATGG + Intergenic
1015155847 6:130095519-130095541 TATTAAATATTGCCTAGTGAAGG + Intronic
1024464675 7:49699846-49699868 TCTTATCTATAGAATTGTGAAGG + Intergenic
1025861227 7:65331376-65331398 TATTACCAATAGCAAAGTTTTGG - Intergenic
1027456347 7:78396535-78396557 TATTTCAGATAGCATGGTGAAGG - Intronic
1030746767 7:113175082-113175104 TCTTACCTTTAGCATTGTGATGG - Intergenic
1032264724 7:130362979-130363001 TTTTACCCACAGCATGGTGAGGG + Exonic
1034552946 7:151832780-151832802 TATTACCTAGAGAAGAGGGAGGG - Intronic
1037303286 8:17477226-17477248 TGTTACCTATAGCCTTGTGTTGG + Intergenic
1042566753 8:70119049-70119071 CATTACATAATGCATAGTGAGGG + Intronic
1042981892 8:74539229-74539251 TCTTAAATATAGCATACTGATGG + Intergenic
1043379234 8:79685057-79685079 TGTGACCTATAGCTGAGTGATGG - Intergenic
1043681363 8:83029704-83029726 TATTTACAATAGCATAGTCATGG + Intergenic
1044482682 8:92711151-92711173 AATTACCAATAGCGTAGTGCTGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1046370555 8:113300406-113300428 TATTCCCAATAGCAAAGTCATGG + Intronic
1047002992 8:120591567-120591589 TACTACCCATAGCATTGTCATGG - Intronic
1048058013 8:130887370-130887392 TATTACCTATAACTTGGTGGTGG - Intronic
1053483586 9:38434815-38434837 TTTTCCCTTTAGCTTAGTGAGGG + Intergenic
1058094428 9:100843473-100843495 TATTTTCTATTGCTTAGTGAAGG - Intergenic
1058186574 9:101862337-101862359 GATTAACTATAGTATATTGAGGG + Intergenic
1058404633 9:104658381-104658403 TATTACTTATAAAATAGTAAGGG + Intergenic
1059630414 9:116116034-116116056 TATAGCCTATAGCAAAGTGATGG + Intergenic
1059657999 9:116373903-116373925 TAGTACCTATCTCATAGTTACGG + Intronic
1061735880 9:132658353-132658375 TAATACCTATAACACAGTGGGGG + Intronic
1189008321 X:37018229-37018251 TATCATCTATTACATAGTGATGG + Intergenic
1189040401 X:37536778-37536800 TATCATCTATTACATAGTGATGG - Intronic
1189853348 X:45198835-45198857 TATTTCCTCTCGCATAGTGTTGG + Intronic
1192728568 X:73778627-73778649 TATTACCTAAAACATGGTGTAGG + Intergenic
1193478344 X:81995547-81995569 TATTAACTATAGCAAAGACATGG - Intergenic
1197563686 X:128054599-128054621 TATTTACCATAGCAAAGTGATGG - Intergenic
1198238984 X:134764717-134764739 TATTTCTGATAGGATAGTGAGGG + Intergenic
1199395061 X:147326619-147326641 AATTGCCTAAATCATAGTGAGGG - Intergenic
1199408645 X:147493548-147493570 TACCAACTATAGCATAGTGCTGG - Intergenic