ID: 912372634

View in Genome Browser
Species Human (GRCh38)
Location 1:109185731-109185753
Sequence CTGTATGAGAGGCTGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 348}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912372629_912372634 -5 Left 912372629 1:109185713-109185735 CCCAGGGAGCTCACAGTCCTGTA No data
Right 912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG 0: 1
1: 0
2: 0
3: 39
4: 348
912372628_912372634 -4 Left 912372628 1:109185712-109185734 CCCCAGGGAGCTCACAGTCCTGT 0: 2
1: 4
2: 34
3: 217
4: 1350
Right 912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG 0: 1
1: 0
2: 0
3: 39
4: 348
912372630_912372634 -6 Left 912372630 1:109185714-109185736 CCAGGGAGCTCACAGTCCTGTAT 0: 1
1: 0
2: 1
3: 21
4: 213
Right 912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG 0: 1
1: 0
2: 0
3: 39
4: 348
912372626_912372634 1 Left 912372626 1:109185707-109185729 CCTGCCCCCAGGGAGCTCACAGT No data
Right 912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG 0: 1
1: 0
2: 0
3: 39
4: 348
912372627_912372634 -3 Left 912372627 1:109185711-109185733 CCCCCAGGGAGCTCACAGTCCTG 0: 1
1: 3
2: 13
3: 118
4: 678
Right 912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG 0: 1
1: 0
2: 0
3: 39
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912372634 Original CRISPR CTGTATGAGAGGCTGGAGAG AGG Intronic
900578398 1:3395451-3395473 CTGGCTGTGAGGCTGGGGAGAGG - Intronic
901327461 1:8376584-8376606 CTGTATCAGAAGCTGGTGGGTGG - Intronic
902402657 1:16166592-16166614 CTGGATGAGGAGCTGGGGAGGGG + Intergenic
902863900 1:19265028-19265050 CTGTATAAAAGACTGGAGAAGGG - Intergenic
903707671 1:25298891-25298913 CTGTTTGAGAGGGTGGCCAGGGG + Intronic
903813803 1:26049865-26049887 CAGTATGGGAGGCGGGAGACAGG + Intergenic
904350035 1:29899126-29899148 CTGTCTTAGAGGGTGGAGAAAGG + Intergenic
904379556 1:30101750-30101772 CTGTAGAAGAGGCTGGGGAAGGG - Intergenic
905043421 1:34978007-34978029 CAGGATGAAAGGCTTGAGAGTGG - Intergenic
905881027 1:41463856-41463878 CTGTATGAGGAGCTGAAGTGGGG + Intergenic
906014698 1:42564834-42564856 GTGGTTGAGAGGCTGGGGAGGGG - Intronic
906635809 1:47409772-47409794 CCCTATGATAGGCTGCAGAGGGG - Intergenic
907309251 1:53529953-53529975 CTGCAGGAGAGGCTGGTGAGGGG + Intronic
910500704 1:87886987-87887009 CTGAATAAGAGGAGGGAGAGAGG - Intergenic
912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG + Intronic
912478257 1:109956945-109956967 ATCTATGAGAGGCTGCAGATAGG - Intergenic
912633964 1:111273564-111273586 ACCTATCAGAGGCTGGAGAGTGG + Intergenic
914722700 1:150302335-150302357 CGGGATGAGAAGGTGGAGAGTGG + Intronic
915914208 1:159931434-159931456 CTGGGTTAGTGGCTGGAGAGAGG - Exonic
916337782 1:163692651-163692673 CTGAAAGGGAGGCTGGAAAGGGG + Intergenic
917632228 1:176901719-176901741 CTGAATGTGAGGCTGGAGACTGG - Intronic
918202414 1:182279806-182279828 CTGGATCAGGGGGTGGAGAGTGG - Intergenic
918309103 1:183272851-183272873 AGATATGAGAGGCTGGAGTGCGG + Intronic
918794013 1:188869156-188869178 CTGTATGAAAAACTAGAGAGAGG - Intergenic
918844939 1:189596798-189596820 ATGTATGAGTGGCTGGAGTGGGG - Intergenic
918845693 1:189608317-189608339 CTGTGAGAGATGCTGGAGAGAGG + Intergenic
919525926 1:198650373-198650395 CTGAATGGGAGGATGGAGAAAGG + Intronic
919939442 1:202276280-202276302 GTGGAAGAGAGGATGGAGAGGGG - Intronic
919974787 1:202603358-202603380 GTGTCTCAGAGGCAGGAGAGTGG - Intronic
920008951 1:202853817-202853839 CTGTTGCTGAGGCTGGAGAGGGG + Intergenic
920051264 1:203166405-203166427 CTGTAGGAGAGACTGGCCAGAGG + Exonic
922797290 1:228346649-228346671 CGGTATGCCAGGATGGAGAGTGG + Intronic
923268913 1:232337194-232337216 CAGCATGAGAGGGTGGGGAGAGG + Intergenic
923456727 1:234171165-234171187 CTGAATCAGAAGCTGGAGTGGGG + Intronic
923489620 1:234472935-234472957 CTGTATCAGAGCCTGGATAGGGG + Intronic
923567039 1:235084013-235084035 CTGTCTGGGAGGCTGAAGACTGG - Intergenic
924431741 1:244003259-244003281 CTGTGTGTGTGGCTGAAGAGAGG + Intergenic
1062818154 10:516327-516349 CAGTATGGGAGGCGGGGGAGAGG + Intronic
1063200687 10:3783534-3783556 CTGTGTGCGAGCCTGGGGAGGGG - Intronic
1063795730 10:9512254-9512276 CTGCCTGAGAGCCTGGAAAGGGG + Intergenic
1065221589 10:23501439-23501461 CCCTATGTGAGGGTGGAGAGTGG - Intergenic
1067261419 10:44696202-44696224 GTGTGTGAGAGATTGGAGAGAGG + Intergenic
1067720283 10:48722954-48722976 CTAGATGAGAGGTTGGGGAGGGG + Intronic
1069707916 10:70470454-70470476 CTGTAGAAGAGGCTGAAAAGAGG - Intergenic
1070554412 10:77516800-77516822 CTGTGTGAGCGGCTGGTGTGGGG + Intronic
1071512345 10:86269963-86269985 CTGTGAGGGAGGCTGTAGAGAGG - Intronic
1072271014 10:93776650-93776672 CTGAATGAGAGGCTTAAAAGAGG - Intronic
1072894604 10:99356153-99356175 CTGCTTGAAAGGCTGGGGAGAGG + Intronic
1073209481 10:101787711-101787733 CTGTTGGCCAGGCTGGAGAGGGG + Intronic
1073879414 10:107962662-107962684 ATTTATAAGAGGCTGGAGAGAGG + Intergenic
1074138126 10:110644806-110644828 CTGTTTGTTAGGCTGGAAAGAGG + Intronic
1075420865 10:122299293-122299315 CTGTGTGTGGGGCTGGGGAGAGG + Intronic
1075442933 10:122493956-122493978 CTGCATGAGGAGCTGGAGAGGGG - Intronic
1076049787 10:127323327-127323349 ATATCTGAGAGGCTGGAGGGAGG - Intronic
1076866510 10:133168933-133168955 CTGTGTGGCCGGCTGGAGAGGGG + Intronic
1077861489 11:6185298-6185320 GTAGAGGAGAGGCTGGAGAGAGG + Intergenic
1079024326 11:16934058-16934080 CTGGAGGAGAGGCTGGAGACAGG + Intronic
1079190428 11:18272502-18272524 CTGTAGCAGTGGCTGGAGAAAGG + Intergenic
1079808988 11:24971479-24971501 CTGTACTAGAGGGTGGAGGGAGG + Intronic
1080447846 11:32353632-32353654 CTGTGTAGGAGGCTGGAGAATGG - Intergenic
1081284054 11:41246209-41246231 CTGGGAGGGAGGCTGGAGAGGGG - Intronic
1082626877 11:55497072-55497094 CAGAAAGAGAGGCTGGAAAGGGG - Intergenic
1083052937 11:59793125-59793147 CTGGAGGAGATGTTGGAGAGTGG + Exonic
1085548780 11:77347197-77347219 CTGTGTGAGAAGCTGGCCAGAGG - Intronic
1085915615 11:80884404-80884426 CTCTGTGAGACCCTGGAGAGAGG - Intergenic
1086486067 11:87303344-87303366 CTGACTGGGTGGCTGGAGAGGGG - Intronic
1087032600 11:93720627-93720649 CTGTTGCAGAGGCTGGAGTGTGG + Intronic
1087045610 11:93841567-93841589 CTGAATGAGAAACTGGAGACCGG - Intronic
1088422177 11:109660386-109660408 CAGAATGATAGGCAGGAGAGGGG + Intergenic
1088596494 11:111444877-111444899 CTCTGTGAGAGGCAGGGGAGTGG + Intronic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1089685104 11:120141700-120141722 CTGAGTTTGAGGCTGGAGAGGGG - Intronic
1089727649 11:120496730-120496752 ATGCATGACAGGCTGGAGAGCGG - Intergenic
1089850387 11:121490934-121490956 TAGTATGAGAAGCTAGAGAGAGG + Intronic
1090258155 11:125300097-125300119 CCGTGTGAGCGGTTGGAGAGGGG + Intronic
1091287659 11:134416938-134416960 CAGCAGGTGAGGCTGGAGAGTGG + Intergenic
1095276800 12:40295177-40295199 CTGGAGGAGAGGATGAAGAGTGG - Intronic
1096164938 12:49414639-49414661 CTGTCTCAAAGGCTGGAGTGCGG + Intronic
1096476145 12:51910431-51910453 CTGAATCAGAGTCTGGAGTGAGG + Intronic
1097794750 12:63849546-63849568 TTGTATGTCAGGCTGCAGAGTGG - Intronic
1098185050 12:67887912-67887934 ATCTTTGAGAGGCAGGAGAGCGG + Intergenic
1100131747 12:91502738-91502760 ATGTATGAGGAGCTGGAAAGGGG + Intergenic
1100531952 12:95469113-95469135 CGGAAAGAGAGGCTGGAAAGGGG + Intergenic
1101051056 12:100864563-100864585 GTGAGTGAGAGGCTGAAGAGGGG - Intronic
1101610081 12:106283287-106283309 CTGTGGAAGACGCTGGAGAGAGG - Intronic
1102512076 12:113422524-113422546 GTGAATGAGAGGCTGATGAGAGG + Intronic
1102571618 12:113830400-113830422 CTCCCTGAGTGGCTGGAGAGTGG + Intronic
1102585700 12:113921400-113921422 ATGTATGAGATGCTGGGGTGTGG - Intronic
1104617560 12:130283315-130283337 CTGAGGGTGAGGCTGGAGAGAGG + Intergenic
1104687914 12:130801440-130801462 CTAGAAGAGATGCTGGAGAGCGG - Exonic
1105211069 13:18257449-18257471 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
1105983271 13:25540631-25540653 CTGCCTGTGATGCTGGAGAGAGG + Intronic
1107708503 13:43130589-43130611 CTCTGTGAGGGGCTGGTGAGAGG - Intergenic
1111669031 13:91304922-91304944 CTGTGTGAGAGTCTGGGCAGAGG - Intergenic
1111698604 13:91658112-91658134 GTTTATGAGAGGCTGGAGTAGGG + Intronic
1111961586 13:94816397-94816419 CTGTTTTCTAGGCTGGAGAGTGG - Intergenic
1112578696 13:100659974-100659996 CAGTGTGAAATGCTGGAGAGTGG + Intronic
1113029789 13:105980528-105980550 CTGTCAGAGTAGCTGGAGAGGGG - Intergenic
1116641237 14:47466159-47466181 GTGTATGTGAGGGTGGAGGGTGG + Intronic
1118012307 14:61622362-61622384 ATGTCTGAGAGCCAGGAGAGAGG + Intronic
1119177357 14:72578938-72578960 TGGTATGAGAGCCTGGAGAATGG + Intergenic
1120707195 14:87757114-87757136 CTTTGTGGGAGGCTGCAGAGAGG - Intergenic
1121254410 14:92520590-92520612 CTGAAAGATAAGCTGGAGAGAGG + Intronic
1121865098 14:97355563-97355585 ATGTAAGAGAGGCTAGAAAGTGG + Intergenic
1123675514 15:22707426-22707448 GTCTCTGAGAGACTGGAGAGAGG + Intergenic
1123808213 15:23897130-23897152 TTGCAGGAGATGCTGGAGAGTGG + Intergenic
1124327504 15:28780364-28780386 ATCTCTGAGAGACTGGAGAGAGG + Intergenic
1126800517 15:52293573-52293595 CTGTATGAGAGACAGCAGGGTGG - Intronic
1127359642 15:58233761-58233783 TTGGGTGAGAGGCTGAAGAGAGG + Intronic
1127494128 15:59493622-59493644 CTGTCTGCCAGGCTGGAGAGCGG + Intronic
1127958361 15:63872220-63872242 CTGAAGGACAGGCTGGGGAGAGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128701127 15:69805158-69805180 CTGCCTGAGAGGCTGGACAGTGG + Intergenic
1129394230 15:75235544-75235566 CTGTGTCAGAGGCTGGGGAGGGG - Intergenic
1129673125 15:77617946-77617968 CTGCAGAAGAGCCTGGAGAGAGG - Intronic
1129708509 15:77808236-77808258 CTGCAGATGAGGCTGGAGAGGGG - Intronic
1130395386 15:83496649-83496671 CTGAATGGGAGGCAGGGGAGTGG + Intronic
1131085198 15:89570040-89570062 CTGGATGAGAGGTTGGAAAGAGG - Intergenic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1132238916 15:100242544-100242566 GTGTGGGAGAGGATGGAGAGAGG - Intronic
1135220354 16:20610071-20610093 CTGGATGAGAGGCTGGCCAAGGG + Intergenic
1135220393 16:20610320-20610342 CTGGCTGAGAGGCTGGACAAGGG + Intronic
1135393655 16:22114715-22114737 CTGTCTGGGAGGCTAGGGAGGGG + Intronic
1135913787 16:26585026-26585048 CTGTAAGAAAGGCTGAAAAGTGG + Intergenic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1136110190 16:28059702-28059724 CTGGTTGAGACGCTGGGGAGGGG - Intronic
1136474696 16:30505477-30505499 GTGGATGGGAGGCTGGAGGGTGG - Intronic
1136553835 16:30996708-30996730 CTGGAAGACATGCTGGAGAGCGG - Exonic
1137645261 16:50067559-50067581 CAGGAAGTGAGGCTGGAGAGAGG + Intronic
1137718278 16:50612194-50612216 CTGCCTGAGAGGCCGGAGGGAGG - Intronic
1138382280 16:56610961-56610983 CTGGGTCAGAGGCTGGGGAGTGG + Intergenic
1139258919 16:65573395-65573417 CCATATGAGATGTTGGAGAGTGG - Intergenic
1139475890 16:67202386-67202408 CTGTCTCAGAGCCTGGAGTGGGG - Exonic
1139671841 16:68497525-68497547 CTGTAGGGGGTGCTGGAGAGGGG - Intergenic
1141445934 16:84058406-84058428 CTGCCTGAGGGGCTGGGGAGAGG + Intronic
1141801491 16:86312419-86312441 CTGTCAGAGAGACGGGAGAGAGG - Intergenic
1142133774 16:88442520-88442542 CTGCAGGAGGGGCTGGTGAGTGG + Intergenic
1142933237 17:3306386-3306408 CAGTTTGGGAGGCTGGAGTGGGG - Intergenic
1143786304 17:9258397-9258419 CAGATTGAGAGGCTGGAGAATGG + Intronic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1145070413 17:19800817-19800839 CTGTATGAGAGGCAGCACTGAGG - Intronic
1146509184 17:33431009-33431031 CTATGTGAGAGGATGCAGAGGGG + Intronic
1146611356 17:34307887-34307909 CTGTAGGACAGGCAGGATAGTGG - Intergenic
1147460300 17:40564036-40564058 CAGTATGAAAGGCTGGAGCAGGG + Intronic
1147600115 17:41740098-41740120 CTGTGGGAGAGGATGGAGACCGG + Intergenic
1148637898 17:49163206-49163228 ACGTATAAGAGACTGGAGAGGGG - Intronic
1148945423 17:51259146-51259168 TTGTCAGAGAGGCTGCAGAGGGG + Exonic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149819944 17:59766464-59766486 CTGTAGCCCAGGCTGGAGAGCGG - Intronic
1149864930 17:60146132-60146154 ATGGAGGTGAGGCTGGAGAGGGG - Intergenic
1149866671 17:60154934-60154956 CTGGAAAAGAGGCTGGTGAGAGG - Intronic
1150997339 17:70333773-70333795 CTCTATGGAAGGCTGGGGAGGGG + Intergenic
1151624317 17:75267203-75267225 GTGTGTGGGAGGCAGGAGAGTGG - Intronic
1151713268 17:75818567-75818589 CAGGACGAGAGGCTGGAGAGGGG - Intronic
1152310813 17:79548582-79548604 CAGCATCAGATGCTGGAGAGGGG + Intergenic
1153522897 18:5968803-5968825 TTGTATGAGAAGCTGCACAGAGG - Intronic
1154311947 18:13273790-13273812 CTGCATGAGGGGCTGGAGGATGG - Intronic
1155009108 18:21757413-21757435 CTGTAGCCCAGGCTGGAGAGCGG - Intronic
1155019412 18:21881289-21881311 CTGTGTCACAGGCTGGAGCGCGG - Intergenic
1155383127 18:25246615-25246637 CTTTAAGAGAGGGTGGAGGGTGG - Intronic
1155614167 18:27702111-27702133 CTGTCTGAGAAGTTTGAGAGTGG - Intergenic
1157412465 18:47475029-47475051 CTCTAGGAGAGGCAGGAGTGAGG - Intergenic
1157509898 18:48263414-48263436 CTGGACGAGTGGCTGCAGAGTGG - Intronic
1158073477 18:53500876-53500898 ATGCATGGGAGGGTGGAGAGAGG - Intronic
1158606888 18:58903470-58903492 CTGAACAAGAGGCTGGAGACAGG + Intronic
1158947288 18:62458010-62458032 CTGCAGGAGACGCTGGTGAGGGG + Intergenic
1159123896 18:64200952-64200974 CTGAATGACAGGCAGGGGAGAGG - Intergenic
1160908240 19:1461940-1461962 CTGGACGAGGGGCGGGAGAGGGG - Intronic
1160927142 19:1552183-1552205 CTGCAGGGGAGGCTGGGGAGAGG - Intergenic
1161490433 19:4558150-4558172 CTGAGTGAGGGGGTGGAGAGGGG + Intronic
1161787891 19:6339445-6339467 GGGTATGAGGGGCTGGGGAGGGG + Intergenic
1162114184 19:8418528-8418550 CTGTTTTAGAGACTGGAGACTGG + Exonic
1162147218 19:8620334-8620356 CTGGATGGGAGGCTGGAGTGTGG + Intergenic
1162311339 19:9909237-9909259 CTGCCTGGGGGGCTGGAGAGAGG - Intronic
1162367560 19:10258586-10258608 CTGTAAGAGAGGCCAGGGAGTGG - Intronic
1163014033 19:14442893-14442915 CTGCATGAGTCTCTGGAGAGTGG - Intronic
1163099728 19:15087520-15087542 GTGTATGAGAGACTGGAGGTTGG - Exonic
1164504170 19:28845210-28845232 TTGTATTAGAGGTTGAAGAGGGG - Intergenic
1166035194 19:40163197-40163219 CTGTGTGAGAGAGGGGAGAGGGG + Intergenic
1166638534 19:44473524-44473546 CTGTATTTGAGGCTGGAATGCGG + Intergenic
1166885021 19:45954834-45954856 GTGTCTGCGAGGCTGGTGAGTGG + Intronic
1167691311 19:50985112-50985134 GCTTATGAGAGGGTGGAGAGTGG - Intergenic
1167990559 19:53357416-53357438 CTGCATCACAGGCTGGAGTGTGG + Intergenic
1168522398 19:57062713-57062735 CTGTATGTAAGCCTGGAGAATGG - Intergenic
925991830 2:9260495-9260517 GTGTGGGAGAAGCTGGAGAGGGG + Intronic
926043248 2:9691547-9691569 CTGGAAGAGGGGCTAGAGAGAGG - Intergenic
926707581 2:15847476-15847498 CAGAGTGAGAGACTGGAGAGGGG + Intergenic
927832907 2:26369607-26369629 ATGAATGACAGGCTGGAGAGAGG - Intronic
930606337 2:53497141-53497163 GTGTGGGAGTGGCTGGAGAGGGG - Intergenic
933235502 2:79859736-79859758 CTGTTTCAGAGGCTGGTGAAGGG + Intronic
935332080 2:101984833-101984855 CTGGATCAGAGGCTAGAGATGGG - Intergenic
935643394 2:105311546-105311568 CTGTTTCCCAGGCTGGAGAGCGG - Intronic
935714292 2:105926420-105926442 CTCCAAGAGTGGCTGGAGAGCGG - Intergenic
937551294 2:123095487-123095509 CTCTTTGAGAGAGTGGAGAGCGG + Intergenic
937988477 2:127649379-127649401 CTGAAGCAGAGGCTGGAGAGAGG - Intronic
938069012 2:128298637-128298659 CGGCGTGAGAGGCTGGAGGGAGG + Intronic
938982970 2:136544225-136544247 CTAAATGAGAGGCTTCAGAGAGG - Intergenic
940221417 2:151355731-151355753 CTGCATGAGAGTTGGGAGAGGGG + Intergenic
945177740 2:207060569-207060591 GTGGAAGAGAGGCTGGAGAGTGG - Intergenic
946757014 2:222957575-222957597 GTTTATGAGAGGCTGGGAAGGGG + Intergenic
946980751 2:225212750-225212772 ATGTAAGAGGGGCTGGAGTGAGG + Intergenic
948643003 2:239387279-239387301 CTGCAGCAGGGGCTGGAGAGTGG + Intronic
948777404 2:240296853-240296875 GTGGATGGGAGGCAGGAGAGAGG - Intergenic
948832139 2:240603320-240603342 CTTCCTAAGAGGCTGGAGAGTGG + Intronic
1168901274 20:1367210-1367232 CTGTATCCCAGGCTGGAGTGCGG - Intronic
1172027673 20:31960192-31960214 AGGGATGAGAGGCAGGAGAGAGG - Intergenic
1172035948 20:32010791-32010813 CTGTCTGAGAGGCTGCAGGAGGG - Intronic
1172543714 20:35742632-35742654 CTGTGTGGGAGGCCGGAGCGGGG - Intergenic
1173082303 20:39879919-39879941 CTGTATTGGAGGATGGAGGGTGG - Intergenic
1173331012 20:42076345-42076367 CTGAATGCTAGGCTGGAAAGTGG - Exonic
1174247092 20:49189311-49189333 TTGTATGGGAGGTTGGAGAGAGG + Intergenic
1174447899 20:50602633-50602655 CTGTAGGACAGACTGGAGAGGGG + Exonic
1174640807 20:52042368-52042390 CTGTAACACAGGCTGGAGTGTGG - Intergenic
1174838878 20:53883142-53883164 CTGTCACAGAGGCTGGAGTGTGG + Intergenic
1175696422 20:61106198-61106220 CTGGCAGAAAGGCTGGAGAGAGG + Intergenic
1176268593 20:64223636-64223658 CTTCAGGAGAGGCTGGAGGGTGG - Intronic
1176305897 21:5122989-5123011 CTGTCTCAGAGGGTGCAGAGTGG + Intronic
1176411266 21:6450737-6450759 CAGTGTGACAGGCAGGAGAGCGG - Intergenic
1176411279 21:6450786-6450808 CAGTGTGACAGGCAGGAGAGCGG - Intergenic
1176911364 21:14569045-14569067 CAGTTTGGGAGGCTGGAAAGAGG + Intronic
1177224247 21:18233130-18233152 GGTTATCAGAGGCTGGAGAGTGG - Intronic
1179016816 21:37600976-37600998 CTGTTTGTGGGGCTGGAGATGGG - Intergenic
1179686759 21:43059059-43059081 CAGTGTGACAGGCAGGAGAGCGG - Intronic
1179686772 21:43059108-43059130 CAGTGTGACAGGCAGGAGAGCGG - Intronic
1179774703 21:43653736-43653758 GTGTCTGAGGGACTGGAGAGTGG + Intronic
1179851160 21:44139042-44139064 CTGTCTCAGAGGGTGCAGAGTGG - Intronic
1179919385 21:44499408-44499430 CTGCAGGAGTGGCTGGCGAGAGG + Exonic
1180139483 21:45884042-45884064 CTGCTTGAGAGGCTGGGGTGGGG - Intronic
1180236088 21:46459681-46459703 TTGTATGAGAGGCGGGGCAGTGG - Intronic
1180258050 21:46647536-46647558 TCGTATGAGTGGCTGGAGTGCGG + Intronic
1180765176 22:18341987-18342009 CTGTGTGAGATGCTGCTGAGTGG - Intergenic
1180813854 22:18777697-18777719 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
1180857763 22:19059093-19059115 CTGGAGAAGAGGCTGGGGAGTGG + Intronic
1181200039 22:21212032-21212054 CTGTGTGAGATGCTGCTGAGTGG + Intronic
1181537185 22:23552543-23552565 ATGGATGAGAGGGTGGACAGAGG - Intergenic
1181701696 22:24624927-24624949 CTGTGTGAGATGCTGCTGAGTGG - Intronic
1182269635 22:29145318-29145340 CTGCAGGAGAGGCAGGGGAGGGG + Intronic
1183078404 22:35441181-35441203 CTCTGGGAGAGGCTGGAGAAGGG + Intergenic
1183470943 22:38006427-38006449 CTGAGTGAGCGGCTGGAGGGTGG - Intronic
1183979849 22:41533022-41533044 CTGAAGGAGAGCCTGGAGGGAGG - Intronic
1184910616 22:47531559-47531581 GTGACTGAGAGGCTGGAGTGGGG + Intergenic
1185041982 22:48508970-48508992 GGTTATTAGAGGCTGGAGAGGGG - Intronic
1185070829 22:48654796-48654818 CTGCCTGGGAGGCTGCAGAGTGG - Intronic
1203226797 22_KI270731v1_random:82892-82914 CTGTGTGAGATGCTGCTGAGTGG - Intergenic
1203263953 22_KI270734v1_random:3384-3406 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
949502410 3:4693536-4693558 CTGGATCAGAGTCTGGAAAGAGG - Exonic
950433315 3:12964144-12964166 CTGCATGAGCTGCTGCAGAGAGG - Intronic
951682293 3:25307348-25307370 CTGTCTCAAAGGCTGGAGTGTGG - Intronic
952024597 3:29063686-29063708 GGGTATGAGAGGAGGGAGAGTGG + Intergenic
953773098 3:45793773-45793795 CATTATGAAAGGCTGCAGAGGGG - Intronic
953945287 3:47142049-47142071 CTGTATGAAATGATGGATAGTGG - Intronic
954134199 3:48574648-48574670 CTCTATGGAAGGGTGGAGAGAGG + Intronic
954301094 3:49701227-49701249 CTGTGGGACAAGCTGGAGAGAGG - Intronic
955100787 3:55847833-55847855 CTGTAGCACAGGCTGGAGTGCGG + Intronic
956330451 3:68101160-68101182 CTGTATCAGAGGATGGAGGGTGG - Intronic
956691088 3:71878022-71878044 CTGAATGTGAGGCAGGAGAGCGG - Intergenic
958995230 3:100896440-100896462 TTGGAGGAGAGGCTTGAGAGCGG + Intronic
960536739 3:118823567-118823589 CTGAATGAGAGGGAGGACAGTGG + Intergenic
960569463 3:119171374-119171396 CTGTGTGAGTGGCCAGAGAGAGG - Intronic
960917719 3:122713971-122713993 TTGTATGGGAGGCTGTGGAGAGG + Intronic
961982303 3:131093458-131093480 CTGTCTGTCAGGCTGGAGTGTGG + Intronic
962732104 3:138293024-138293046 CTGGAGGGGAGGGTGGAGAGTGG - Intronic
963827942 3:149974981-149975003 CTGTGTAAGAGTCTGGAGAGAGG - Intronic
966636153 3:182136036-182136058 CTGGATGGGATGCTGGAGAAGGG - Intergenic
967772158 3:193345627-193345649 CTGTATGAGTCGCTGAAGATTGG + Intronic
968090750 3:195896870-195896892 CAGTTGGAGAGGCTGGAGAGGGG - Intronic
968640223 4:1711012-1711034 CTGTCTCACAGGCTGGAGTGCGG - Intronic
969411862 4:7033724-7033746 CTGAGGGAGAGGCGGGAGAGCGG - Intergenic
969486316 4:7474336-7474358 CATAAAGAGAGGCTGGAGAGGGG - Intronic
969509399 4:7609078-7609100 CTGCATGAGGGGCTGGTGAAGGG + Intronic
970202737 4:13626600-13626622 CAGAAAGAGAGGCTGGAAAGGGG - Intronic
970322531 4:14888959-14888981 ATGTTTGGGAGGCTGGAGACTGG - Intergenic
970408099 4:15782867-15782889 CTGTGTGACAGGCAGGAGAGGGG - Intronic
971550992 4:27955268-27955290 CTGTAACCGAGGCTGGAGTGCGG - Intergenic
976221053 4:82757125-82757147 CTGAAAGCGAGGATGGAGAGAGG - Intronic
977990326 4:103433205-103433227 CTGCATGAGAGCCTAGAGAGAGG + Intergenic
979827285 4:125255245-125255267 ATGTGTGAGAGTCTGGAGAAAGG + Intergenic
981735263 4:147942923-147942945 CTGTCTTAGAGGCTGCAAAGGGG - Intronic
983466553 4:168100464-168100486 CTGTATGAGAGGCTTAAGGAGGG - Intronic
985491450 5:182066-182088 CTGTCTGAGATGGTGGAGTGTGG - Exonic
986299664 5:6467988-6468010 CTGGATGAGAGCAAGGAGAGAGG - Intronic
986822342 5:11481584-11481606 CAGAATGAGACCCTGGAGAGAGG + Intronic
988882342 5:35517001-35517023 TTGTATGATAGGCAGGAGTGTGG - Intergenic
989010531 5:36866714-36866736 ATGTAAGAGAGGGTGGAGAAAGG - Intergenic
989461271 5:41701416-41701438 CTGAATGTGAAGCTGGAGAAAGG - Intergenic
993238520 5:85347467-85347489 ATGTATTAGTGGCTGGAGACTGG - Intergenic
994292305 5:98042340-98042362 CAGTGTGAGAGACTGGATAGGGG + Intergenic
994739103 5:103595805-103595827 GTGAATGAGAGGCTAGAGACAGG - Intergenic
995063418 5:107835691-107835713 TTTTATGAGAGGCTGGAGGGTGG + Intergenic
995732408 5:115259744-115259766 CAGAATGGGAGGCAGGAGAGAGG + Intronic
996256140 5:121404898-121404920 CTGAATGTGAGATTGGAGAGAGG + Intergenic
996543530 5:124654113-124654135 CTGGATGAAAGGCTGTTGAGTGG - Intronic
996585643 5:125085312-125085334 CTGTATCCCAGGCTGGAGTGCGG + Intergenic
998830341 5:146150900-146150922 CTGTCTCACAGGCTGGAGTGCGG - Intronic
999921985 5:156331321-156331343 CTGTCTGAGAGGCAGGTCAGAGG - Intronic
1002802886 6:543000-543022 CTGGATGATAAGCTGGAGAGTGG + Intronic
1003127624 6:3368204-3368226 GGGTGTGAGGGGCTGGAGAGGGG - Intronic
1003552983 6:7115357-7115379 CTGTGTGATAGGCTGGGGGGTGG - Intronic
1003997446 6:11556941-11556963 CTGGATCATAGGCTGGAGACTGG - Intronic
1004222180 6:13756505-13756527 CTGTTTGAGAGGAGGAAGAGGGG - Intergenic
1004840747 6:19581355-19581377 AAGTATGAGAGGCTGCAGATTGG - Intergenic
1006247044 6:32746446-32746468 CAGTATGAGAGGGAGGAAAGTGG + Intronic
1006731394 6:36238974-36238996 CTGATTGAGAGGATGGTGAGGGG + Intergenic
1007066462 6:38995820-38995842 CTTTAGGAGAGGCACGAGAGTGG - Intronic
1007784410 6:44271493-44271515 GTGCATGGGAGGCTGGAGTGGGG - Intronic
1007838482 6:44696527-44696549 ATGTGTGTGAGGATGGAGAGAGG + Intergenic
1008354660 6:50537862-50537884 GTATATGAGAGGGTGGAGTGTGG + Intergenic
1011763969 6:90599023-90599045 CTGAGTGAGGGGCTGGAGACTGG + Intergenic
1011997295 6:93608420-93608442 CTGGATGAGAATCTGGAAAGAGG + Intergenic
1013995908 6:116307692-116307714 CTGTGTAAGAGGGTAGAGAGGGG - Intronic
1014510856 6:122320405-122320427 GTGTATCAGAGGGTGGAGGGTGG - Intergenic
1015091240 6:129362028-129362050 CAGTATGGGAGGCTTGAGATGGG - Intronic
1015484901 6:133758299-133758321 CTGTTGGAGAGGCTGGAGAAAGG - Intergenic
1016328982 6:142936227-142936249 CTGTCAGACAGGCTGGAGTGCGG + Intronic
1017725405 6:157273470-157273492 CTCAATGAGAGGCTGGGGGGAGG - Intergenic
1018862827 6:167723262-167723284 CTGTGTGTGAGTGTGGAGAGGGG - Intergenic
1019446264 7:1073189-1073211 CTGTGTGTGAAGCTGCAGAGTGG - Intronic
1019535905 7:1529908-1529930 GTGGAGGACAGGCTGGAGAGGGG - Intergenic
1019922189 7:4170021-4170043 CGGTATGTGAGACTGAAGAGAGG - Intronic
1019937922 7:4268408-4268430 CTGAAGGCGAGGCTGGGGAGAGG - Exonic
1021344086 7:19501986-19502008 GGTTATGAGAGGCTGGAGATGGG + Intergenic
1021453900 7:20808386-20808408 CTGTATATGGGGCAGGAGAGGGG - Intergenic
1021598907 7:22344429-22344451 CTGTACTGGAGGCTGGAGAGAGG + Intronic
1022881158 7:34588749-34588771 GGGTCTGAGAGGCTGGAGGGAGG - Intergenic
1023581341 7:41687074-41687096 CTGCATGAGAAGCTTGAGAGTGG - Exonic
1023970298 7:44986193-44986215 CCGCAAGAGAGGCTGTAGAGTGG - Intergenic
1024345684 7:48310758-48310780 CTGCAGGAGAGAGTGGAGAGTGG + Intronic
1026846920 7:73703780-73703802 CTGGAGGACATGCTGGAGAGTGG - Exonic
1027429022 7:78090473-78090495 GTGTATGGGAGACTGGAGGGGGG + Intronic
1027535147 7:79390532-79390554 CAGTATGAGATGCTGGAGGAGGG + Intronic
1028167607 7:87556606-87556628 CTGGAGCAGAGGCAGGAGAGGGG - Intronic
1028480616 7:91300794-91300816 CTGTATGTGAGCCTGGAGTCAGG - Intergenic
1029609409 7:101618723-101618745 CTGCGTGAGAGGCTGGTGGGAGG - Intronic
1029841051 7:103363552-103363574 TTTTTTGAGAGGGTGGAGAGAGG + Intronic
1031018241 7:116598487-116598509 CTGACTGAGAGGCTGGACTGTGG - Intergenic
1032017108 7:128387356-128387378 CTGCAGGAGTGGCTGGAGAGAGG - Intergenic
1033249959 7:139749999-139750021 CTGGACGGGAGGTTGGAGAGCGG - Intronic
1033466683 7:141597317-141597339 CTGTATGTGGGGGTGGGGAGTGG + Intronic
1034822530 7:154230161-154230183 CTGTGTGGGAGGATGGGGAGAGG - Intronic
1034848203 7:154467333-154467355 TTGAATGAGAGGCTGGTGGGAGG + Intronic
1035063753 7:156090675-156090697 CTACCTGAGAGGCTGGAGAAGGG + Intergenic
1036720428 8:11169610-11169632 GTTTATCAGAGGCTGGAGAAAGG + Intronic
1039621415 8:39000280-39000302 CTGTGAGAGAGGCTGGGGCGCGG - Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043185631 8:77145289-77145311 CTGTATGAAACACAGGAGAGTGG + Intergenic
1043251881 8:78085248-78085270 GTGTATGAGAGACTGCATAGAGG + Intergenic
1043877704 8:85505206-85505228 CTGTCTGTCAGGCTGGAGTGCGG + Intergenic
1046657848 8:116914357-116914379 CTGTATGAAAAGATGAAGAGAGG - Intergenic
1047053166 8:121136040-121136062 GTGGATGAGAGCATGGAGAGAGG + Intergenic
1048232754 8:132659906-132659928 GTGTATGGGAGGATGGGGAGAGG - Intronic
1048787599 8:138066933-138066955 CAGCATCAGAGGCTGGAGGGTGG + Intergenic
1049312468 8:141940483-141940505 CTGTCAGAGCAGCTGGAGAGGGG - Intergenic
1049398778 8:142415469-142415491 CTGTCTGAGTGGCTGGGCAGTGG + Intergenic
1049671358 8:143871488-143871510 CTGTACGAGCGGCTGGAGCATGG - Exonic
1050019844 9:1271538-1271560 CTCAATGACAGGCTGGAGAAGGG - Intergenic
1051095753 9:13463567-13463589 CTGTCTGCCAGGCTGGAGTGCGG - Intergenic
1051823852 9:21197277-21197299 CAGGCTGAGAGGCTAGAGAGAGG - Intergenic
1053003109 9:34588737-34588759 CTGGAGGAGAGGCTCGGGAGAGG + Intronic
1053086921 9:35232856-35232878 CTGGAGTAGAAGCTGGAGAGTGG + Intronic
1053395324 9:37768622-37768644 ATGTATGAGATCCTAGAGAGAGG - Intronic
1053440201 9:38109719-38109741 CTGGAGGACAGGCTGAAGAGAGG + Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1056812355 9:89774678-89774700 CTAGATGAGAGGCCGCAGAGGGG + Intergenic
1057874081 9:98740196-98740218 CTGTGTGGGGGTCTGGAGAGGGG - Intronic
1058734687 9:107883494-107883516 CTTTATGAGAAGCTGGGGAGGGG + Intergenic
1059104458 9:111499783-111499805 CTGTAGCACAGGCTGGAGTGCGG - Intergenic
1059476081 9:114548822-114548844 CTGTAAGCCAGGCTGGAGTGCGG - Intergenic
1059963353 9:119589262-119589284 GGAAATGAGAGGCTGGAGAGAGG + Intergenic
1060506612 9:124202648-124202670 CAGTGTGTGAGGGTGGAGAGGGG - Intergenic
1060797342 9:126521849-126521871 CTGACGGAGAGGCTGGTGAGGGG - Intergenic
1060863506 9:126975874-126975896 CTGGCTGAGAGGTGGGAGAGAGG - Intronic
1061256523 9:129456757-129456779 CTGTATGAGTGGGTGGTGAGTGG + Intergenic
1061325007 9:129858372-129858394 CTTACTGAGAGGCTGGGGAGCGG + Intronic
1187474823 X:19601639-19601661 CTGTGGGTGAGGCTGGAGAGGGG + Intronic
1187669786 X:21656982-21657004 CTGCATGAGCGGCTGGCGGGAGG + Exonic
1188537262 X:31211223-31211245 CTGCGTGGGAGGCTGGAGCGAGG + Intronic
1189141327 X:38609858-38609880 ATGTCTGAAATGCTGGAGAGAGG + Intronic
1190126305 X:47708638-47708660 CTGTAGTCCAGGCTGGAGAGCGG - Intergenic
1190708194 X:53048239-53048261 CTTTCTGAGATGCTCGAGAGAGG - Intergenic
1190822384 X:53985773-53985795 CTGTCTGATAGCCTGGAAAGGGG + Intronic
1192559133 X:72113922-72113944 CTGTATGAGGGGCTGGACTAGGG + Intergenic
1192717591 X:73660365-73660387 CATTATTAGAGGCTGGAAAGGGG + Intronic
1195481078 X:105345961-105345983 CTTTATGGCAGGCTTGAGAGAGG + Intronic
1199558992 X:149142682-149142704 TTGTCTGAAAGGCTGGAGGGTGG - Intergenic
1199848231 X:151706943-151706965 CAGGATGGGAGGCTGGGGAGAGG - Intergenic
1199964005 X:152803293-152803315 GCCTATTAGAGGCTGGAGAGTGG - Intergenic
1202140831 Y:21720118-21720140 CTGTCTGCCAGGCTGGAGTGCGG - Intergenic
1202146034 Y:21783680-21783702 CTGTCTGCCAGGCTGGAGTGCGG + Intergenic