ID: 912376250

View in Genome Browser
Species Human (GRCh38)
Location 1:109212248-109212270
Sequence CAGTGGTGAGGGGCCCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 1, 2: 2, 3: 61, 4: 479}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912376240_912376250 12 Left 912376240 1:109212213-109212235 CCACACTCAACACACAACATTTC 0: 1
1: 0
2: 2
3: 26
4: 267
Right 912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG 0: 1
1: 1
2: 2
3: 61
4: 479
912376239_912376250 13 Left 912376239 1:109212212-109212234 CCCACACTCAACACACAACATTT 0: 1
1: 0
2: 2
3: 18
4: 247
Right 912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG 0: 1
1: 1
2: 2
3: 61
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912376250 Original CRISPR CAGTGGTGAGGGGCCCTGGG GGG Intergenic
900144218 1:1150887-1150909 CAGAGGTGAGGGGCCGGGAGGGG + Intergenic
900265374 1:1754502-1754524 CCTCGGTGAGGGGCCCAGGGTGG - Intronic
900474947 1:2871751-2871773 GGGTGGTGAAGGGACCTGGGGGG + Intergenic
900506999 1:3034726-3034748 GAGTGGAGAGGGTCCCTGGAGGG + Intergenic
900550994 1:3255489-3255511 CAGTGGGGCGGAGTCCTGGGAGG + Intronic
900616261 1:3567029-3567051 CTGGGGTGTGGGGCCCTGGTGGG - Intronic
900636366 1:3667937-3667959 CAGTGGCCATGAGCCCTGGGGGG - Intronic
901668200 1:10838419-10838441 CACTGGTGGGGGTCCCTTGGGGG - Intergenic
902219607 1:14956724-14956746 CAGGGAAGAGGGGCCCTGGCAGG + Intronic
903400034 1:23036452-23036474 GAGTGGTGAGGGGGCGGGGGAGG - Intronic
904009961 1:27383754-27383776 CAGCGGTCATGGGGCCTGGGTGG - Intergenic
904385632 1:30140346-30140368 GAGTGGTGAGGGGTGCTGGGAGG + Intergenic
904400979 1:30256581-30256603 CAATGGTGAGGGACCCAGAGGGG + Intergenic
905258914 1:36703951-36703973 CTGCAGTGAGAGGCCCTGGGTGG + Intergenic
905266315 1:36756486-36756508 CAGCAGTGAGGGGGGCTGGGAGG + Intergenic
906076541 1:43056154-43056176 CAGTGGTGAGGGGAGATGGATGG + Intergenic
906436169 1:45798520-45798542 CAGTGGTAGGGGGTCCTGTGAGG - Intronic
906713544 1:47950877-47950899 CAGTGGTGAGGGGGCACTGGTGG + Intronic
907163059 1:52385639-52385661 CAGTGTGGACAGGCCCTGGGAGG - Intronic
907283834 1:53367899-53367921 GAATTGTGAGGGGTCCTGGGAGG - Intergenic
908916228 1:69129649-69129671 GAGGGGTGAGGGGCACTGGGAGG + Intergenic
909043148 1:70677784-70677806 ATGTGGTGAGTGGCCCTCGGAGG - Intergenic
909535801 1:76734895-76734917 CAGGGGTGAGGGGCTAGGGGAGG - Intergenic
912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG + Intergenic
913177601 1:116289077-116289099 GAGTGGAGAGCTGCCCTGGGAGG + Intergenic
913335949 1:117709127-117709149 CAGTGGAGAGGGGCCCAAGGCGG - Intergenic
914061038 1:144208223-144208245 CCGTGGTCTGGTGCCCTGGGTGG + Intergenic
914118112 1:144758146-144758168 CCGTGGTCTGGTGCCCTGGGTGG - Intergenic
915457607 1:156051152-156051174 CAGTGGTGGGGGGCCCTCTCCGG - Exonic
915973333 1:160368794-160368816 GGGTGGAGAGGGGCCCTGAGAGG + Intronic
916497299 1:165356949-165356971 TCGGGGTGAGGGGCACTGGGGGG - Intergenic
916651417 1:166838340-166838362 GAGTGGTCAGGGGACCAGGGTGG - Intergenic
917442914 1:175082723-175082745 CAGTGGTCAGTAGGCCTGGGTGG + Intronic
920023557 1:202975091-202975113 CAATGTTGAGTGGGCCTGGGTGG + Intergenic
920378627 1:205522926-205522948 CAGTGCTGAGGGTCACTGGGAGG + Intronic
920401704 1:205680347-205680369 CAGGGGTGAGGGTCCCGGCGCGG - Intronic
920847267 1:209604611-209604633 CAGTGGTAAGGGGGACTAGGAGG + Intronic
922062836 1:222108122-222108144 CAGAGCTGAGGGGCCCTGCTAGG + Intergenic
922720357 1:227897061-227897083 CAGTGCTGGGGGACTCTGGGTGG - Intergenic
923517603 1:234710407-234710429 CAGTTTTGAGGAGCCCTGGGTGG + Intergenic
923788026 1:237086692-237086714 GGGTGGTGAGGGGTGCTGGGTGG + Intronic
924186618 1:241498404-241498426 CTGTGGTGAGTGGCTCTGAGAGG + Intronic
1062860017 10:803653-803675 AAGTTGGGAGGGGCCCTGCGTGG - Intergenic
1063159303 10:3408217-3408239 CAGGGGTGTGGGGGCCTGGCTGG + Intergenic
1063367784 10:5501472-5501494 GCCTGGTGAGGGGCCCAGGGAGG + Intergenic
1063614968 10:7593350-7593372 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1063614977 10:7593383-7593405 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1063614987 10:7593416-7593438 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1063614996 10:7593449-7593471 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1063615006 10:7593482-7593504 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1063615015 10:7593515-7593537 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1063615025 10:7593548-7593570 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1063615035 10:7593581-7593603 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1063615045 10:7593614-7593636 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1063615055 10:7593647-7593669 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1063615074 10:7593713-7593735 CAGGGGTGAGTGGGGCTGGGTGG - Intronic
1064064085 10:12165852-12165874 CAGTGGTCTGAGGCCCTTGGCGG - Exonic
1064149210 10:12849008-12849030 CAGAGGTGAGCGGCATTGGGGGG - Intergenic
1065361905 10:24896659-24896681 CTGTTGTGAGGAGCACTGGGTGG + Intronic
1065517353 10:26537507-26537529 CAGTTGTGAGGTGCCCAGTGTGG - Intronic
1065834435 10:29644176-29644198 CAGTGGAGTGAGGACCTGGGAGG + Intronic
1069291141 10:66781156-66781178 CAGTGCAGAGGAGCCCTGTGTGG + Intronic
1069823598 10:71242112-71242134 CAGTGGGGAGAGGACATGGGGGG + Intronic
1070153496 10:73819456-73819478 CTGTGGTGGGGGTCCCTGAGGGG + Intronic
1070313962 10:75293962-75293984 CAGTGGGGAGTGGGCCTGGCAGG + Intergenic
1070922061 10:80194276-80194298 CCCTAGTGAGGGGCCGTGGGAGG - Intronic
1071473252 10:86002562-86002584 CAGTGGTTACTGGGCCTGGGAGG + Intronic
1072930610 10:99659228-99659250 CACAGGTGAGTGGCGCTGGGCGG - Intergenic
1073290549 10:102411148-102411170 CTGTGGGAAGGGTCCCTGGGAGG - Intronic
1074769062 10:116721776-116721798 CTGTGTTTAGGGGCCCTGGGAGG + Intronic
1076614402 10:131746531-131746553 CAGGGCTGAGGGGGCCTGTGGGG - Intergenic
1076769812 10:132656761-132656783 CAGTTTGGAGGGGCCCAGGGCGG + Intronic
1077197437 11:1288464-1288486 CAGAGGGCAGGGGCCCTGGGTGG - Intronic
1077225494 11:1437544-1437566 AAGTGGGGAGGGCCCCAGGGAGG - Intronic
1077252277 11:1565959-1565981 CAGTGCTGCGGGCCCCTGGGTGG + Intronic
1077342009 11:2030390-2030412 CTGTGGTGTGGGGCTGTGGGGGG + Intergenic
1077442238 11:2574225-2574247 CCTTGGGGAGTGGCCCTGGGTGG + Intronic
1077670738 11:4154843-4154865 CAGTGATGAGGGGTCCTGTTTGG + Intergenic
1077868367 11:6241143-6241165 CAGAGAGGAGGGGCCCTTGGTGG + Intronic
1078533537 11:12155769-12155791 CACTGGTGAGAGTGCCTGGGTGG + Intronic
1078947868 11:16091402-16091424 CAGTGGTGTGGGGGAATGGGAGG - Intronic
1079114953 11:17634944-17634966 CTGTGGTGAGAGGCCCGGGGTGG + Exonic
1081290141 11:41314647-41314669 CAGGGGTGCGGGGCCGTGGGAGG + Intronic
1081669064 11:44933296-44933318 CAGGGGTGAGGACCCCTGGCAGG + Exonic
1081675716 11:44967870-44967892 GGGTGGAGATGGGCCCTGGGAGG + Intergenic
1081774128 11:45665924-45665946 CCGCGGCGAGGGGCGCTGGGGGG - Intergenic
1083639001 11:64135372-64135394 CAGAGCTGAGCGGCCCTGGCCGG - Intronic
1083713039 11:64560377-64560399 CAGTGCAGTGGGGCCCTCGGAGG - Intronic
1083922606 11:65788573-65788595 CAGCAGTGAGGGGCCCCGTGAGG + Intronic
1084770582 11:71340523-71340545 CAGGGGTGGGGGGCACAGGGAGG - Intergenic
1084773189 11:71357488-71357510 CAGTGGAGAGGCCCCCAGGGAGG - Intergenic
1084891072 11:72237468-72237490 CAGTGGTCCGGGGCCGTGGTGGG + Exonic
1085306195 11:75487380-75487402 CAGTGGGGAGAGGCTCGGGGAGG + Intronic
1088543695 11:110938861-110938883 CACAGGTGATGGGCTCTGGGTGG - Intergenic
1089291992 11:117443125-117443147 GAGTGAGGAGGGGCCCAGGGAGG + Intronic
1089700277 11:120240293-120240315 CAGAGGCGAGGGGCCTGGGGGGG + Intronic
1089775002 11:120829879-120829901 CAGTGGTGAGGGCCTGTGAGGGG + Intronic
1089812603 11:121144031-121144053 CTGGGGTTAGGGGCCCTGGGTGG + Intronic
1090117134 11:123985027-123985049 CAGTGGCGTGGGGTCCTGAGTGG + Intergenic
1090401535 11:126452593-126452615 TCCTGGTGAGGGGCCCTGGAAGG - Intronic
1090750327 11:129741091-129741113 CCGGGGTGAGAGGCTCTGGGAGG + Intergenic
1091282160 11:134387911-134387933 CAGGGGTCAGGAACCCTGGGGGG + Exonic
1202824995 11_KI270721v1_random:85579-85601 CTGTGGTGTGGGGCTGTGGGGGG + Intergenic
1091749795 12:3015106-3015128 CAGTGGGGAGGGGGCCAAGGGGG + Intronic
1091818705 12:3458470-3458492 CTGTGGTGCGTGGCCCTGGCAGG - Intronic
1093523471 12:20077076-20077098 CGGTGGTGAGGGGCAAGGGGAGG + Intergenic
1096001387 12:48133476-48133498 CAGAGGTAAGGGGACTTGGGAGG + Exonic
1096001430 12:48133846-48133868 CAGAGATAAGGGGACCTGGGGGG + Intronic
1096252867 12:50044547-50044569 GAGTGGTCAGAGGCCCAGGGGGG + Intergenic
1096531009 12:52242921-52242943 AAGTTGGGAGGGGCCTTGGGTGG + Intronic
1096980971 12:55728251-55728273 GAGTGGCGAGGGGTCCTGGGGGG - Intronic
1097270268 12:57769751-57769773 AGGTGGGGAGGGGCCCTGGTGGG - Exonic
1097910025 12:64959494-64959516 CAGTGTTGTTAGGCCCTGGGAGG + Intergenic
1100979588 12:100153986-100154008 CAGTGGTGGGAGGGCCAGGGAGG - Intergenic
1101491221 12:105211605-105211627 CAGTGGGGTGGGGCCCAGAGTGG - Intronic
1101827387 12:108231148-108231170 TGGAGGTGAGGGGCCATGGGAGG + Intronic
1102431760 12:112889492-112889514 CAGAGGGGAGGGGCCCTCAGTGG - Intronic
1103572839 12:121856565-121856587 CAAAGGTGAGGTGCCCGGGGAGG - Exonic
1104814670 12:131638809-131638831 GGGTGGTGAGGGGCTCTGAGGGG + Intergenic
1104875072 12:132028149-132028171 CAGTGGCGTGGGTCCCTGGATGG + Exonic
1104904538 12:132206164-132206186 CAGGCGTCAGGAGCCCTGGGGGG - Intronic
1107746689 13:43517752-43517774 CAGTGGTGCGGGCCTTTGGGAGG + Intronic
1109577191 13:64274916-64274938 CAGTGGAGAGGGGGCCTGAGAGG - Intergenic
1112495298 13:99899242-99899264 AAATGGTGGGGGGCCCTGGAAGG - Intergenic
1113798058 13:113070169-113070191 GGGAGGTGAGTGGCCCTGGGTGG + Exonic
1113887620 13:113669283-113669305 GAGTGGTGAGGGGGTTTGGGAGG + Intronic
1115399323 14:32939429-32939451 CTGCGGAGAGGGGCCCTCGGCGG - Intronic
1116716352 14:48431381-48431403 CAGTGGAGAGGGGAGCTGGAAGG + Intergenic
1118437723 14:65786765-65786787 CAGGGGTGAGAGGCCTGGGGAGG + Intergenic
1119436581 14:74601438-74601460 CAGTGGTCAGGGGCACCGGTGGG - Intronic
1119679859 14:76584343-76584365 CAGTGGCCAGGGCCCCAGGGAGG - Intergenic
1121091941 14:91188980-91189002 CAGTGGTGATGAGCACTGAGCGG - Exonic
1121234266 14:92380674-92380696 CAGTGTTGTGTGACCCTGGGCGG - Intronic
1121521682 14:94590373-94590395 CAGTGCTGTGTGGCCCTGGTAGG - Intronic
1121715733 14:96072393-96072415 CAGTCCTCAGGGCCCCTGGGAGG - Intronic
1122093103 14:99352916-99352938 CAGTGGGGAGGAGGCCTGGGAGG + Intergenic
1122227986 14:100290825-100290847 CTGTGGTGAGGGGCACTGGCGGG - Intergenic
1122290515 14:100678268-100678290 CTGTGGGAAGAGGCCCTGGGTGG - Intergenic
1122346890 14:101066368-101066390 CAGTGCTGTGAGACCCTGGGTGG + Intergenic
1122372251 14:101235311-101235333 GGGTGGTGAGGGGCCCTGGCAGG - Intergenic
1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG + Intergenic
1122901210 14:104783053-104783075 CAGTGATGCTGGGCCCCGGGTGG - Intronic
1122930851 14:104932524-104932546 CAGTGTTCTGGGGCCCTGTGGGG - Intronic
1123012716 14:105357119-105357141 CAGTGCTGAGAGGGGCTGGGAGG - Intronic
1124346338 15:28923877-28923899 CAGGGATGAGGAGCCCCGGGGGG - Intronic
1125029916 15:35065982-35066004 CAGTGGTAAGGGGCCCTATATGG + Intergenic
1125374424 15:39013527-39013549 CAGCGGTGTGGGTCCCAGGGTGG - Intergenic
1125503835 15:40255452-40255474 AAGTGCGGAGAGGCCCTGGGAGG - Intronic
1125610278 15:40964798-40964820 CAGTGATGAGGGGACCTCAGAGG + Intergenic
1127017894 15:54708689-54708711 CAGCAGAGAGGTGCCCTGGGTGG - Intergenic
1128225405 15:65998026-65998048 CAGGGGTGGGGGGCACTGTGAGG + Intronic
1128304442 15:66588777-66588799 CTGAGGAGAGGGGCCCTGAGAGG + Intronic
1128519955 15:68368676-68368698 CAGAGGTGAGGGGACCTGCCCGG - Intronic
1129226415 15:74172966-74172988 CAGTGGGCAGTGGGCCTGGGTGG + Intergenic
1129458442 15:75688061-75688083 CAGTGGTGACATGGCCTGGGAGG - Exonic
1129725346 15:77898809-77898831 CAGTGGTGACGTGGCCTGGGAGG + Intergenic
1129740452 15:77987227-77987249 CAGTGGGGAGGGTCCCCGCGTGG + Intronic
1129883997 15:79026134-79026156 CAGTGGGGAGGGGGCCTGAAGGG - Intronic
1130230786 15:82095071-82095093 GAGTGGGGAGAGGCCGTGGGGGG + Intergenic
1130256543 15:82328490-82328512 CAGTGGGGAGGGTCCCTGTGTGG + Intergenic
1130273385 15:82464001-82464023 CAGTGGTGACGTGGCCTGGGAGG + Intergenic
1130443184 15:83975586-83975608 CAGTGGTCAGTGACACTGGGTGG + Intronic
1130465736 15:84191372-84191394 CAGTGGTGACGTGGCCTGGGAGG + Intergenic
1130486955 15:84403438-84403460 CAGTGGTGACGTGGCCTGGGAGG - Intergenic
1130498529 15:84482164-84482186 CAGTGGTGACGTGGCCTGGGAGG - Intergenic
1130588025 15:85195968-85195990 CAGTGGTGACGTGGCCTGGGAGG + Intergenic
1130598409 15:85261498-85261520 CAGTGGGGAGGGTCCCTGTGTGG - Intergenic
1131562455 15:93456468-93456490 CAGTTGTGAGCTGCCATGGGTGG - Intergenic
1131593784 15:93775905-93775927 CACTGGTGAGGAGCCATAGGAGG + Intergenic
1131936682 15:97513725-97513747 CAGGGGTGGGGGGCCAGGGGAGG + Intergenic
1132014075 15:98300480-98300502 CAGTGGAGCGGGGCGCGGGGAGG - Intergenic
1132071141 15:98777417-98777439 AGGTGGTGAGGGGCCCGGGGAGG + Intronic
1132112522 15:99112626-99112648 CAGGGGTGAGGGGAGCTGCGAGG + Intronic
1132150196 15:99453516-99453538 CTGTGCTGAGGGGTCCAGGGAGG + Intergenic
1132371262 15:101301004-101301026 TAGTGGTGAGGGGCTTTGGATGG + Intronic
1132463447 16:66837-66859 CATGGGTGAGGGGCCCTGGAGGG - Intronic
1132556680 16:575698-575720 CAGGTGGGAGGGGCCCTCGGTGG - Intronic
1132600988 16:772872-772894 CAGAGGTGAGGGCACCTGGGTGG - Exonic
1132656886 16:1045146-1045168 AGGTGGTGAGGAGCCTTGGGAGG - Intergenic
1132702106 16:1226320-1226342 CAGTGGGGAGGGAGCCTGAGGGG + Intergenic
1132706214 16:1244548-1244570 CAGTGGGGAGGGAGCCTGAGGGG - Intergenic
1132764114 16:1525793-1525815 CTGTGGTGAGGTGGCCAGGGAGG - Intronic
1132837238 16:1960075-1960097 CAGTGGAGGGGTGCCCGGGGCGG - Intronic
1132999315 16:2841145-2841167 CTGAGGTGAGTGGCGCTGGGTGG - Intergenic
1133297664 16:4762811-4762833 GAGGGGTGTGGGGCCCTGCGGGG - Intronic
1134140253 16:11712374-11712396 CAGTGGAGATGGGTGCTGGGGGG - Intronic
1134784991 16:16934138-16934160 AAGTGATGAGGGGCTCTGGGTGG + Intergenic
1136233889 16:28903160-28903182 CTGGGGTGGGCGGCCCTGGGCGG - Intronic
1136384054 16:29911785-29911807 CCGGGGTGCGGGGCACTGGGCGG - Intronic
1137370734 16:47903581-47903603 TAGTGGTGAGGGGCTTGGGGAGG + Intergenic
1137568227 16:49547595-49547617 CAGTGGTGAGTGGGCCCTGGCGG + Intronic
1137588822 16:49681021-49681043 CAGAGCTGAGGGGCCCTGTTTGG - Intronic
1138396755 16:56710377-56710399 CAGTGGTGAGGGTGGCTGGGAGG - Intronic
1139248214 16:65469308-65469330 CAGCAGGCAGGGGCCCTGGGAGG + Intergenic
1139431028 16:66911148-66911170 CAGTGATGGGAGCCCCTGGGAGG - Intronic
1139630730 16:68230532-68230554 CAGTGGTGGGGGAGACTGGGGGG + Exonic
1140580294 16:76223547-76223569 CTGGGGAGAGAGGCCCTGGGAGG - Intergenic
1140936497 16:79675586-79675608 ATTTGTTGAGGGGCCCTGGGCGG + Intergenic
1141614487 16:85202684-85202706 CCCTTGGGAGGGGCCCTGGGGGG + Intergenic
1141717062 16:85732954-85732976 CACTCGTGAGGGGCCGAGGGTGG + Intronic
1141770211 16:86085329-86085351 CAGTGGGGTGGGGCCTGGGGGGG - Intergenic
1141772123 16:86095923-86095945 GAGTGGTGGGAGGCACTGGGAGG - Intergenic
1141996799 16:87641101-87641123 CAGTTGTGATGGGCACGGGGAGG - Intronic
1142001229 16:87665513-87665535 CAATGTTGGGGGGCCTTGGGAGG - Intronic
1142182672 16:88678858-88678880 CAGTGGCCAAGGGCCCCGGGAGG - Intronic
1142200696 16:88759888-88759910 GTGTGGGGAGGGGACCTGGGGGG + Intronic
1142271045 16:89089403-89089425 CCCTGGGGAGGGGCCTTGGGCGG - Intronic
1142276421 16:89121186-89121208 CCGTGGACAGGGCCCCTGGGAGG - Intronic
1142466706 17:140956-140978 CCTTGGTGAGGGGACATGGGGGG + Intergenic
1142466842 17:141287-141309 CCTTGGTGAGGGGACATGGGGGG + Intergenic
1142471970 17:169770-169792 GTGTGGGGAGGGGCCCAGGGTGG - Intronic
1143618127 17:8065471-8065493 CAGGGCTGAAGGACCCTGGGAGG + Intergenic
1143669070 17:8383790-8383812 GGGTGGTGAGGGGCCTTGCGAGG + Intergenic
1143938931 17:10518150-10518172 CAGTGGTGAGGGGCGGGGTGAGG - Intronic
1144656461 17:17040464-17040486 CACTGGGGAGGGGAGCTGGGTGG - Intergenic
1145924217 17:28633711-28633733 CAGTGGTGTGGGGCCCATGCTGG - Exonic
1146183251 17:30710006-30710028 CACTGGCGAGGGGCCCGGGAGGG + Intergenic
1146399854 17:32494080-32494102 CGGTGGTCAGAGGCCCTGGTGGG + Exonic
1146548058 17:33756170-33756192 CTGTGGTCAGGTGCCCTGGCTGG - Intronic
1146920636 17:36707880-36707902 CACTGGTGAGGGGCTCATGGGGG + Intergenic
1147334109 17:39716479-39716501 CAGTGGTGAGGGGGTCTGAGAGG - Intronic
1148085962 17:44994046-44994068 CAGTGGGGATGGGGCCTGAGAGG - Intergenic
1148468501 17:47878849-47878871 CAATGGGGCGGGGCCATGGGAGG - Intergenic
1148777809 17:50105441-50105463 CAGTGAGTGGGGGCCCTGGGTGG + Exonic
1149572896 17:57686168-57686190 CAGTGTTGAGTGTGCCTGGGAGG + Intergenic
1149849799 17:60027553-60027575 GTGTGGGGAGGGGCCCAGGGTGG + Intergenic
1149860369 17:60118971-60118993 GTGTGGGGAGGGGCCCAGGGTGG - Intergenic
1150725767 17:67650089-67650111 CACAGGTGAGGGGCCCTAGATGG - Intronic
1152269661 17:79316599-79316621 TTGTGGGGAGGGGCTCTGGGAGG - Intronic
1152572878 17:81128248-81128270 ACCTGGGGAGGGGCCCTGGGAGG - Intronic
1152575162 17:81136639-81136661 CAGTGCTGGGCGGCCATGGGGGG + Intronic
1152636744 17:81433286-81433308 CTGGGGTGAGGGGCCGTGTGTGG + Intronic
1152646527 17:81471448-81471470 TAGGGGAGAGGGGCTCTGGGAGG - Intergenic
1152788243 17:82263448-82263470 CAGTGCTGAAGGCCCCTGGCAGG - Intronic
1153480509 18:5543144-5543166 CAGAGGCGAGGGGCCCCGGCAGG + Intronic
1154177128 18:12093061-12093083 CACTGGGGAGGGGTCCTGGAGGG + Intergenic
1154300271 18:13185962-13185984 CAGTGGTAAGGCCTCCTGGGTGG + Intergenic
1155508255 18:26551045-26551067 CAGAGGTGGGGAGACCTGGGGGG - Intronic
1155591908 18:27436856-27436878 CAATGGTGAAGAGCCCTGGAGGG - Intergenic
1157272848 18:46289967-46289989 CAGTGGTCAGTGGCACTGAGTGG - Intergenic
1157302948 18:46492985-46493007 CAGTGATGAGGAGCCATTGGGGG - Intronic
1157620894 18:49016989-49017011 GAGTGCTGAGGGGCCAGGGGTGG - Intergenic
1158608743 18:58919542-58919564 GACTGGAGAGGCGCCCTGGGGGG - Exonic
1160096180 18:75875731-75875753 CAGTGGAGAGGAGCCCCGTGTGG + Intergenic
1160699487 19:498914-498936 CTGTGCTGTGGGGCGCTGGGAGG + Intronic
1160797875 19:954114-954136 GGGTGCTGGGGGGCCCTGGGAGG + Intronic
1160805876 19:991947-991969 CATTGGTGACTGGGCCTGGGGGG - Exonic
1160809572 19:1007572-1007594 CAATGGTCAGGGGTCCTGAGGGG + Intronic
1161008357 19:1947806-1947828 CCGTGGAGAGGGGCGCTGTGTGG + Intronic
1161028283 19:2046586-2046608 CCCTGGTGAGGGGCCCGAGGGGG - Exonic
1161104573 19:2436998-2437020 CAGTTGTGAAGGGGCCTGTGGGG - Intronic
1161206213 19:3042400-3042422 GAGGGGTAAGGGGGCCTGGGAGG + Intronic
1161237132 19:3203840-3203862 CACAGGTGAGCGGCCCCGGGTGG + Exonic
1161332462 19:3694831-3694853 GTGTGGTGAGGGCACCTGGGAGG - Intronic
1161573052 19:5040846-5040868 CAGGGGACAGAGGCCCTGGGAGG - Intronic
1162291938 19:9786551-9786573 CAGTGGTGAGGGTCTCGGTGAGG - Intronic
1162533199 19:11247615-11247637 TGGTGTGGAGGGGCCCTGGGCGG + Intronic
1162806279 19:13139435-13139457 CAGGGGTGGGGGGCCTTGGAAGG + Exonic
1162927491 19:13937719-13937741 CAGTGGTGAGGGGAGCTGGAGGG - Intronic
1163443563 19:17333878-17333900 GAGTGGTGAGGAGCCCTGGCGGG - Intronic
1163509832 19:17727864-17727886 CAGTGGTGGGGGGACCTTGAGGG - Exonic
1163632688 19:18425300-18425322 CGCTGGTGAGCGGCCCCGGGAGG - Intronic
1163649498 19:18509152-18509174 CTGTGGGGAAGGGCCCTGGTGGG - Intronic
1163666197 19:18605240-18605262 GAGCCGTCAGGGGCCCTGGGAGG + Intronic
1164593133 19:29517066-29517088 CAGAGTTGATGGGCTCTGGGAGG - Intergenic
1165596564 19:37014722-37014744 CAATGGTGGTGGTCCCTGGGAGG - Intronic
1165793522 19:38506031-38506053 GAGAGGAGAGGGGCCCAGGGAGG + Intronic
1165949964 19:39468857-39468879 CTGTGGTGAGGGTCCCAGAGGGG + Exonic
1166636029 19:44452554-44452576 CAGAGGTGAGGAGCACAGGGAGG + Intergenic
1166719136 19:44987549-44987571 CTGTGGAGAAGGGACCTGGGAGG - Intronic
1166852686 19:45768024-45768046 AAGAGGTGAGGGGCCTCGGGCGG - Exonic
1167115465 19:47486997-47487019 CTGTAGCGAGGGGCCCTGCGCGG + Intergenic
1167233392 19:48298838-48298860 CAGTGGGGAGAGGCCCTGGAGGG - Intronic
1167411844 19:49348814-49348836 CAGGGGTGAGAGGGCTTGGGGGG + Exonic
1167421620 19:49407292-49407314 CTGAGGTAAGGGGCCCCGGGAGG + Exonic
1167491953 19:49798231-49798253 CAGTGGTGGAGAGCTCTGGGGGG + Intronic
1167721583 19:51183673-51183695 GAGTGGTGGGGGACCCTGGGAGG - Intergenic
1167772413 19:51529610-51529632 CAGTTGTGAGGGGTCTGGGGAGG + Intronic
1168683973 19:58336798-58336820 TAGTGGTTAGTGGCCCTGGAAGG + Intronic
925061894 2:897784-897806 CACTGGGGGGGGGCCCGGGGTGG + Intergenic
925142413 2:1559254-1559276 TGCTGGTGAGGGGCCCTGTGTGG - Intergenic
926226587 2:10971311-10971333 CAGCGGTGAGGGGCTCTCGCTGG - Intergenic
926644591 2:15275525-15275547 CAGTGATGAGGTCACCTGGGTGG + Exonic
927277132 2:21271841-21271863 CAGTGGGGAGAGGACCTGGATGG - Intergenic
927636281 2:24819643-24819665 CAGTGGTCAGGGCCCCTCAGGGG + Exonic
927932072 2:27051789-27051811 GAGAGGTGAGGGGCTCTGCGCGG + Exonic
927982037 2:27380447-27380469 CAGGGGTCAGGGGCCTTGAGGGG - Intronic
928021761 2:27710912-27710934 CAGTGGGAAGGAGCTCTGGGTGG + Intronic
929589814 2:43137581-43137603 GGGTGGTGAGGGGTCCCGGGTGG - Intergenic
929863222 2:45696942-45696964 GTGGGGTGTGGGGCCCTGGGAGG - Intronic
930124317 2:47783821-47783843 GGGTGGGGAGGGGGCCTGGGAGG + Intronic
930403400 2:50921761-50921783 CATTGGTAATGGGCACTGGGAGG - Intronic
932404115 2:71502661-71502683 CACTCCTGAGAGGCCCTGGGCGG - Intronic
934618515 2:95790059-95790081 GAGGCCTGAGGGGCCCTGGGCGG + Intergenic
934642378 2:96034500-96034522 GAGGCCTGAGGGGCCCTGGGCGG - Intronic
934857458 2:97738116-97738138 CAGTGGGGAGGGGACCCGGCTGG + Intronic
937141504 2:119605671-119605693 CAGTGGGGTGAGGCTCTGGGGGG + Intronic
937264569 2:120607798-120607820 GAGAGGGCAGGGGCCCTGGGTGG - Intergenic
937281807 2:120722424-120722446 CCCGGGTGAGGGGCTCTGGGTGG + Intergenic
937340513 2:121087824-121087846 CAGTGGAGAGGGGCTCAGAGGGG + Intergenic
937760310 2:125592840-125592862 GAGTGATGAGGGGCAATGGGAGG + Intergenic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
938707506 2:133945234-133945256 AAGCAGTGAGGTGCCCTGGGTGG - Intergenic
938943586 2:136190799-136190821 TAGGGGTGAGGGGACCTGTGGGG + Intergenic
940170766 2:150827746-150827768 TAGTGCTGAAGGGCCCTGGCAGG - Intergenic
940175820 2:150876878-150876900 CAGAGCTGAGGGGCCCAGGAAGG - Intergenic
942669423 2:178358081-178358103 CAGGGGTGAGGGGCTGGGGGAGG + Intronic
943022974 2:182597503-182597525 GAGAGCTGAGGGGTCCTGGGAGG + Intergenic
944217337 2:197269615-197269637 CAGAGCTGAGGGGCTCTTGGTGG + Intronic
944563256 2:200963048-200963070 CAGTGGTAAAGTGCCCTGTGAGG - Intronic
946232703 2:218302420-218302442 CAGAGGGGATGGGCCGTGGGGGG + Intronic
946366370 2:219251657-219251679 CAGTGATGAGCTGCTCTGGGTGG + Exonic
946609282 2:221440454-221440476 AAGTAGTGAAGGGCTCTGGGCGG + Intronic
947989119 2:234473224-234473246 CAGGGGTAAGGGGCTCTGGGGGG - Intergenic
948232967 2:236365468-236365490 CAGCGGTCAGGGGCCCTGAAAGG + Intronic
948674905 2:239591541-239591563 CAGTGTTAAGGGGCACTGAGGGG + Intergenic
948982428 2:241501192-241501214 CAGTGGTGAGTGGGCCTGTGAGG - Intronic
1169191277 20:3660508-3660530 CTTGGGTGAGGGGCCCGGGGGGG - Exonic
1170601728 20:17846451-17846473 CAGAGGGCAGGGGCCCTGGAAGG + Intergenic
1172600504 20:36179653-36179675 CAAGGGGGAGGGGCCCTGGGTGG - Intronic
1172699760 20:36845835-36845857 TGGGGGTGGGGGGCCCTGGGAGG + Intronic
1172937242 20:38629138-38629160 CAGTAGGGAGGAGCCCTGAGGGG + Intronic
1173174624 20:40754955-40754977 CAGTGGTGATAGGGCCTGGCTGG - Intergenic
1173456838 20:43209613-43209635 TAGTGGTCAGGGGCCCAGTGCGG + Intergenic
1174080845 20:47969657-47969679 CTGTGGAGAGGGGCCATGGTGGG + Intergenic
1175831067 20:61965782-61965804 CAGGGGCGGGGGGCCCGGGGAGG - Intronic
1175859926 20:62144359-62144381 TAGTGGTGAGGGGCCCGGGTCGG + Intronic
1176131942 20:63499899-63499921 CAGCGGGGTGGGGCGCTGGGCGG - Intergenic
1177347076 21:19887183-19887205 AGGTGGTGAGGGGCCATTGGTGG - Intergenic
1178619092 21:34158612-34158634 GAGGGTGGAGGGGCCCTGGGAGG + Intergenic
1179482870 21:41689393-41689415 CAGTGATGAGGGCCCGTGGGGGG - Intergenic
1179594512 21:42433415-42433437 GTGAGGTGAGGGGCCCTGTGAGG - Intronic
1179839021 21:44058342-44058364 CAGCGGTGAGGAGGCCTTGGTGG + Intronic
1179891325 21:44336495-44336517 CAGGGGTGAGGTGCCCGGGGTGG + Intronic
1179985796 21:44919755-44919777 CAGAGGAGAGGGGCCCCGGATGG + Intronic
1180581804 22:16845375-16845397 CAGTGGACAGGGTCCCTGAGTGG + Intergenic
1180758167 22:18177709-18177731 GGGTGGTGAGGGGCCCTTGAAGG + Intergenic
1181196725 22:21192456-21192478 GGGTGGTGAGGGGCCCTTGAAGG - Intergenic
1181312490 22:21952774-21952796 CAGGGGTGAGGAGGCCGGGGGGG - Exonic
1181439858 22:22930208-22930230 CAGTGGTCTGGGGACCTGGATGG - Intergenic
1182091287 22:27596664-27596686 CATTGAGGAGGGGGCCTGGGAGG - Intergenic
1182246383 22:28961233-28961255 AAGAGGTGGGGGGCCTTGGGAGG - Intronic
1182465935 22:30516204-30516226 CAGTGGTGGGGAGCCATGGAAGG + Intergenic
1183662894 22:39231813-39231835 CAATGGTCAGGGAACCTGGGAGG + Exonic
1183788279 22:40044742-40044764 CAATGGAGTGGGGCTCTGGGCGG + Intergenic
1184225680 22:43127824-43127846 ACCTGGGGAGGGGCCCTGGGCGG + Intronic
1184266033 22:43346563-43346585 CAGTCGTCAGGGGCCCAGAGTGG + Intergenic
1184389623 22:44195747-44195769 GAGTGGAGTAGGGCCCTGGGAGG + Intronic
1184486827 22:44784915-44784937 CAGGTGTGAGGGTCCCAGGGTGG - Intronic
1184640586 22:45867991-45868013 GAGTGGTGGGGGGCCCGGGGGGG - Intergenic
1184840348 22:47048811-47048833 TAGGGGTGAGGGGCCCTGCACGG + Intronic
1185038646 22:48492665-48492687 CAGGGGAAAGGGGCCCTGGATGG + Intronic
1185052029 22:48559096-48559118 CAGTGCCGAGGGGCCCAAGGAGG + Intronic
1185130588 22:49036383-49036405 CATAGGAGAGAGGCCCTGGGCGG - Intergenic
1185222417 22:49635819-49635841 CAGGGGTGAGGGGTGCAGGGTGG + Intronic
1185294276 22:50045687-50045709 CAGAGGCCAGGGGCCCCGGGAGG - Intronic
1185380660 22:50506267-50506289 CACTGGTGAGGGGCCCGGTCTGG - Exonic
949184005 3:1168591-1168613 GAATGTTGAGGGGCTCTGGGTGG + Intronic
950055132 3:10018057-10018079 CAGTGGAGAGCTTCCCTGGGTGG + Intergenic
950522840 3:13506745-13506767 CAGTGGGAGGGGGCCCTGGCAGG + Intergenic
950545771 3:13637162-13637184 CACTTGGGAGGGACCCTGGGAGG + Intronic
950609426 3:14116388-14116410 CCCTGGTGTGGGTCCCTGGGAGG + Intronic
951630657 3:24716521-24716543 CAGTGGGGAGGGGGGCGGGGGGG + Intergenic
952203330 3:31152901-31152923 CAGTGGTGGGGGGCAATTGGTGG + Intergenic
952409041 3:33031064-33031086 CAGTGGTGAAGGCCCCCAGGCGG - Intronic
953891648 3:46755811-46755833 AAGTGGTCAGGGGTCCTGAGGGG - Intronic
953897129 3:46811486-46811508 AAGTGGTCAGGGGTCCTGGAGGG - Intronic
953905713 3:46867375-46867397 CAGTGGGAAGGGGCACCGGGGGG + Intronic
954619451 3:51987192-51987214 CAGAGGTGAGGCAGCCTGGGAGG + Exonic
954630736 3:52046455-52046477 CTCTGGGGAGGGGCCCTGTGGGG + Intergenic
954894476 3:53964034-53964056 CAGTGGTGAGGGGAATTGAGGGG - Intergenic
955416462 3:58696532-58696554 CAATGGTGAGGGGCAGAGGGAGG - Intergenic
955702925 3:61700035-61700057 CAGTGGTGAGGGGGTCTGTGTGG + Intronic
956574799 3:70740381-70740403 CAGTGCTGAGAGGCCCTGACTGG - Intergenic
956790100 3:72673612-72673634 CCATGGTTTGGGGCCCTGGGTGG + Intergenic
957038904 3:75321025-75321047 CAGAGGAGAGTGGACCTGGGTGG + Intergenic
958850486 3:99319012-99319034 CAGTGTTCAGGGGCTCTGTGTGG + Intergenic
959019764 3:101175792-101175814 CAGGGGTGGGGGGCCAGGGGAGG + Intergenic
960583846 3:119302980-119303002 CAGTGGGCAAGGGACCTGGGAGG - Intronic
961512442 3:127411323-127411345 GTGTGGTGTGGGGACCTGGGAGG - Intergenic
961674429 3:128555925-128555947 CAGGGGCGGGGGGCGCTGGGGGG - Intergenic
962019848 3:131487298-131487320 CAGCGGTGAGGGGCTGGGGGAGG + Intronic
963604841 3:147405318-147405340 CAGTGGTGTGGGTCGCTGCGAGG + Intronic
967135699 3:186510846-186510868 CAGGGGAGAGGGGCCGTGTGAGG - Intergenic
967774127 3:193368746-193368768 CAGTGGGGTGGGGCGGTGGGGGG - Intronic
967920136 3:194608348-194608370 CAGTGGTGAGGGCCCCTGCCAGG - Intronic
967990507 3:195126800-195126822 CAGAGCAGAGGGCCCCTGGGAGG - Intronic
968150686 3:196335167-196335189 GAGGGGAGAGGTGCCCTGGGAGG + Intronic
968656964 4:1782850-1782872 CCGAGGTGAGGGGCTCAGGGAGG + Intergenic
968726655 4:2251015-2251037 CAGTGGTGCAGCTCCCTGGGTGG - Intronic
968739347 4:2319512-2319534 CAGTGATCAGGGGCCGTGGTAGG + Intronic
969597068 4:8155548-8155570 CAGGGGTGCGGGGCCAAGGGCGG - Intronic
969686020 4:8674708-8674730 CCGTGGGGTGGGGCCCTGTGGGG + Intergenic
970446279 4:16125753-16125775 CAGAGGTGAGAGGCCCTGGCCGG - Intergenic
970826171 4:20278802-20278824 CAGTGGTGGGGGGCGGTGGGGGG + Intronic
971099490 4:23447598-23447620 CAGTGGTGATGAGCACTTGGGGG + Intergenic
971318393 4:25585987-25586009 CATTGTTTAGGGGCCCTGGTAGG - Intergenic
971769631 4:30879615-30879637 CAGTGGTCAGGGTCCCTGTGAGG - Intronic
972933841 4:44106865-44106887 CAGTGGTGAGGCGGGATGGGAGG + Intergenic
973330308 4:48905932-48905954 CAATGGTGAGGGGCTCTTGCAGG + Intronic
975798597 4:78035206-78035228 CACTGGTGAGAGGCACTGGAAGG + Intergenic
978623856 4:110662378-110662400 GAGGGGTGAGGAGCTCTGGGTGG + Intergenic
980794474 4:137663177-137663199 CAGTGGGGATGGGCAGTGGGTGG - Intergenic
981582218 4:146261249-146261271 CACTGGTGAAGGGGCCTGGCAGG - Intronic
984485710 4:180366713-180366735 CAGTAGTGAGAGGCCCCAGGGGG - Intergenic
984758479 4:183344657-183344679 AAGGGGCGATGGGCCCTGGGCGG - Intergenic
985478948 5:95339-95361 CAGAGTTGAGGGGCACAGGGTGG - Intergenic
985550499 5:531161-531183 CAGAGGTGAGCCGGCCTGGGTGG - Intergenic
985553685 5:545873-545895 CAGTGGTCAGGGGCCCACTGTGG - Intergenic
985619931 5:948896-948918 CAGTGAGGAGGGGCCCACGGGGG - Intergenic
985648486 5:1096488-1096510 GAGTGGGGAAGGGCCCTGGATGG - Intronic
985919279 5:2956965-2956987 CACTGGTGATGGGCATTGGGCGG + Intergenic
986449361 5:7850441-7850463 CAACGAGGAGGGGCCCTGGGAGG - Intronic
990339501 5:54808524-54808546 CAGTGGTGAAGAGCCCAGTGTGG - Intergenic
990502216 5:56407906-56407928 CAGTGGCCAGGGGACCAGGGTGG + Intergenic
991489145 5:67166046-67166068 CAGTGGTGGGCGGCCCCTGGAGG + Exonic
991630899 5:68655536-68655558 CTGTGGTGAGGGGCCGGGGCAGG - Intergenic
994418659 5:99505700-99505722 CAGGGGTGGGGGGCTATGGGAGG - Intergenic
997091462 5:130863873-130863895 CATTTGGGAGGGGCCATGGGTGG - Intergenic
997787671 5:136728535-136728557 CAGGGGTGTGGGCCCCAGGGTGG + Intergenic
998690021 5:144577171-144577193 AACTGGTGAGTGGCCCTGGGGGG + Intergenic
1000702772 5:164473735-164473757 CATTTTTGGGGGGCCCTGGGGGG + Intergenic
1001603849 5:172946311-172946333 CTGTGGGGATGGGGCCTGGGAGG - Intronic
1001645509 5:173278805-173278827 GAGTGGTGAGGGGGCCTGGGTGG + Intergenic
1001906519 5:175478339-175478361 CGGTGGTGTGGGGCTCTGCGCGG - Intronic
1002197732 5:177510242-177510264 CAGTGGTGAGGGGGCCCTGGAGG - Intronic
1002524444 5:179807273-179807295 CGGGCGTGAGGGGCTCTGGGTGG + Intronic
1002607520 5:180391766-180391788 TAGTGAGGAGGGGCTCTGGGGGG + Intergenic
1002612697 5:180431906-180431928 CAGTGGGGAGGGGACCTAGATGG + Intergenic
1002637098 5:180613908-180613930 GAGAGGTGGGGGGCCCTTGGTGG + Intronic
1002639824 5:180625495-180625517 CAGCGGGGTGGGGACCTGGGGGG - Intronic
1002709219 5:181184167-181184189 CCGGGGCGAGGGACCCTGGGCGG + Intergenic
1002782669 6:379422-379444 ACGTGGGGAGCGGCCCTGGGAGG - Intergenic
1003419198 6:5940507-5940529 ACATGGTGAGGGGCACTGGGAGG - Intergenic
1003500194 6:6696799-6696821 CTGTGGTGAGGGGATTTGGGTGG + Intergenic
1005991895 6:30908399-30908421 GAGTGGTGAGGGGACCTAGGAGG + Exonic
1006002183 6:30973806-30973828 CAGCTGTGAGGGGCACTGAGAGG - Intergenic
1006603403 6:35240517-35240539 AAGAGGTGAGGGGGCCAGGGTGG - Intronic
1006613563 6:35310237-35310259 CTGTTGTCAGGGGGCCTGGGTGG + Intronic
1006638893 6:35478763-35478785 CAGCGGTGATGGGCACTTGGGGG - Intronic
1006738371 6:36291257-36291279 CAGTGGCCAGGGGCCAAGGGAGG - Intronic
1007211594 6:40197083-40197105 CAGTGGTGAGGGGATGTGGCTGG + Intergenic
1007605942 6:43118169-43118191 CAGTGCTCAGGGGCCATAGGTGG - Intronic
1007610099 6:43143616-43143638 CAACGGTGAGGGGCCCTGGACGG + Exonic
1007654984 6:43446450-43446472 TAGGGGTGAGGGGTCCTGGGTGG - Intronic
1008218711 6:48827644-48827666 CAGTGGGGTGGGGCTTTGGGGGG + Intergenic
1013337890 6:109183629-109183651 CAGAGGTGAGGGGTGGTGGGGGG + Intergenic
1013670719 6:112399617-112399639 CAGTGGAGAGGGCATCTGGGAGG + Intergenic
1013740378 6:113276877-113276899 CAATGGTTAGCGGCCTTGGGAGG + Intergenic
1014928009 6:127297844-127297866 TAGTGGAGAGGGGGCCTGAGTGG - Intronic
1018088168 6:160322941-160322963 CAGAGGTGAGGGGCCAAGGAGGG - Intergenic
1018938196 6:168287747-168287769 CAGTGGTGAGGGACCATATGGGG + Intergenic
1018966999 6:168497133-168497155 CTGTGGTTAAGGGCCCTGGTTGG + Intronic
1019196683 6:170287297-170287319 CCTTGGAGAGGGGCTCTGGGAGG - Intronic
1019290327 7:247139-247161 TTGTGATGAGGGGGCCTGGGAGG + Intronic
1019428807 7:989127-989149 AGGTGCTGGGGGGCCCTGGGGGG - Exonic
1019497788 7:1348441-1348463 GCGGGGTGAGGGGCTCTGGGAGG - Intergenic
1019532762 7:1511823-1511845 CTGGCCTGAGGGGCCCTGGGAGG - Intergenic
1019625082 7:2011833-2011855 CAGTGCAGCGGGGTCCTGGGGGG + Intronic
1019717316 7:2545389-2545411 AAGAGGTGAGGGGACCTGGTAGG + Intronic
1019737218 7:2656530-2656552 AAGAGGTGAGGGGCCCTGGGGGG + Exonic
1019931485 7:4226235-4226257 CAGCGGTGAGGGCCCCTGTGTGG - Intronic
1020247810 7:6443691-6443713 TGGTGGTGAGGTGCACTGGGAGG - Intronic
1023885030 7:44348436-44348458 CAGTGGTGAGGGGATCTTGTTGG + Intergenic
1023926009 7:44670344-44670366 CACTGGTGAGGGGTGCTGTGAGG - Intronic
1024084350 7:45881260-45881282 GGGTGGTGAGAGGGCCTGGGTGG - Intergenic
1024549154 7:50546382-50546404 CAGGTGAGAGGGTCCCTGGGTGG + Intronic
1024583875 7:50824095-50824117 CAGTGGGGAGGGTGCCTGAGAGG - Intergenic
1025230482 7:57200807-57200829 CAGTGGTGAGGGTTTCTGGTAGG - Intergenic
1025928781 7:65979381-65979403 CAGTGGTGAGGGCTTCTGGTAGG - Exonic
1027236651 7:76302525-76302547 CAGCGTTCAGGGGCCGTGGGCGG - Exonic
1029443877 7:100602480-100602502 CAGTGAGGAGGGGCCCCAGGAGG - Exonic
1029529752 7:101117446-101117468 CAGTGGTGAGGAGAGCTGAGGGG + Intergenic
1031923776 7:127619825-127619847 AAGTGGTAAAGGGCCCTGGCAGG + Intergenic
1031969079 7:128050834-128050856 CCGTGATGAAGGGCTCTGGGAGG + Intronic
1032268566 7:130384665-130384687 CAGTGGTGAGGAGCCATTCGAGG - Intronic
1034032790 7:147786360-147786382 CAGTGAGGAGGGGGTCTGGGAGG + Intronic
1034186292 7:149179690-149179712 CAGTTATGAGGGGACCTGGTGGG - Exonic
1034275729 7:149823058-149823080 CAGGAGTGAGGGGCCTTGGCAGG - Intergenic
1034471226 7:151255386-151255408 CAGCAGTGAGGGGCAATGGGGGG - Intronic
1035263368 7:157675377-157675399 GTGTGGTCCGGGGCCCTGGGGGG - Intronic
1035472659 7:159120064-159120086 CAGAGGTGAGGGGCCCACGTTGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1035595561 8:854692-854714 CAGGGGTGAGGGGACATGGAGGG + Intergenic
1035620005 8:1029470-1029492 CAGTGCTGAGAGGTTCTGGGGGG + Intergenic
1036709316 8:11068192-11068214 GAGCTGGGAGGGGCCCTGGGAGG - Intronic
1038071868 8:24026072-24026094 CAGAGGTGTGAAGCCCTGGGTGG + Intergenic
1038963435 8:32547837-32547859 CCGTGGTCAGGAACCCTGGGAGG - Intronic
1039467918 8:37797137-37797159 GCGTGGAGGGGGGCCCTGGGCGG - Intronic
1039912792 8:41838043-41838065 CACTGGTGAGGGGGCCAGGGAGG - Intronic
1040948094 8:52906127-52906149 CAGTGGTGCAGGGAACTGGGAGG + Intergenic
1042253551 8:66780664-66780686 CAGAGGCGAGAGGCCCTGGTGGG + Intronic
1044519905 8:93187336-93187358 AAGTGGTGGGGGGTCCTGGGGGG + Intergenic
1048300437 8:133247493-133247515 CAGGGGAGAGAGGCACTGGGAGG - Intronic
1048471005 8:134704122-134704144 CAGGGAAAAGGGGCCCTGGGGGG - Intronic
1048553876 8:135457297-135457319 CAGTGGAGAGCGGCCCCAGGAGG + Intergenic
1049332702 8:142063649-142063671 CAGGGCTGAGGGCTCCTGGGAGG + Intergenic
1049386055 8:142343737-142343759 CAGTGGTGATGGGGAGTGGGGGG + Intronic
1049597041 8:143489497-143489519 CAGGGGAGAGGGGCCAGGGGAGG + Intronic
1049696208 8:143985469-143985491 CAGTGGTGGGGGGCCCCTGGAGG - Exonic
1049796621 8:144500000-144500022 CTGGGCTGAGGGGCCCTGGCGGG + Intronic
1052183911 9:25566041-25566063 CAGTGGTGGTGGGCCGTAGGGGG - Intergenic
1052365657 9:27609207-27609229 CAGTGGTGAGGGACCATATGGGG + Intergenic
1053351199 9:37414473-37414495 CAGTGAGGTGTGGCCCTGGGGGG - Intergenic
1055474044 9:76643711-76643733 CAGTGGTCAGGTTCCCTGGGTGG + Intronic
1056465421 9:86848916-86848938 CGGTGGTGAGGGGCTAAGGGAGG - Intergenic
1056546208 9:87616089-87616111 GAAAGGTGAGGGGCCCTGGGAGG - Intronic
1057757446 9:97849192-97849214 CCGTGGAGAGGGGCGGTGGGTGG + Intergenic
1058746431 9:107995922-107995944 CAGGTGGGAGGGGACCTGGGAGG + Intergenic
1059391523 9:114002340-114002362 CAGTGATGAGATGTCCTGGGAGG - Intronic
1059411014 9:114132400-114132422 CAGTGATGGGAGGCCCTGGATGG + Intergenic
1060402153 9:123355506-123355528 CAGGGGTGAGGTGCCCTGCAGGG + Intergenic
1061061874 9:128254531-128254553 CAGTGGTGGGAGGGCCGGGGAGG - Intronic
1061166398 9:128925082-128925104 CAGAGCTGAGGGGCCCATGGTGG + Intronic
1061453631 9:130682024-130682046 CTCTGCTGAGGGGCCCTCGGGGG - Exonic
1061816047 9:133197205-133197227 CAGAGGTGAGGGGCTGGGGGAGG + Intergenic
1061863057 9:133477912-133477934 CAGTGGGGAGAGGCACTGGCTGG - Intronic
1061884562 9:133585079-133585101 CTGTGGCAAGGGGGCCTGGGCGG + Intronic
1061897008 9:133653472-133653494 CAGAGGTGCGGGGACCTGGGAGG + Intronic
1061902092 9:133678172-133678194 CAGTGCTGTGTGGCCCAGGGAGG - Intronic
1061908936 9:133712743-133712765 CATGGGTGGGGGACCCTGGGGGG - Intronic
1062003266 9:134227270-134227292 CTTTGGGAAGGGGCCCTGGGAGG + Intergenic
1062255504 9:135618980-135619002 GAGGGGTGAGGGGCCCAGGCAGG - Intergenic
1062382900 9:136296159-136296181 CCGTGGGGAGGGGCACTGCGTGG - Intronic
1062462386 9:136667336-136667358 CACCCGTGAGAGGCCCTGGGTGG + Intronic
1062504631 9:136866604-136866626 CCGGGGTGCGGGGCCCGGGGAGG - Intronic
1185458021 X:320069-320091 CAGACGTGGGGGCCCCTGGGCGG - Intergenic
1185736874 X:2501575-2501597 CAGGGGTCTGGGGTCCTGGGGGG - Intronic
1187127608 X:16469018-16469040 CAGGGGTGTGGGGTGCTGGGTGG - Intergenic
1187273835 X:17801645-17801667 CAGTTGCACGGGGCCCTGGGTGG + Exonic
1187280250 X:17853041-17853063 CAGTGGGGAGGGGCTGGGGGTGG + Intronic
1189227669 X:39426981-39427003 CTGTGGGGAAGGGCCCTGTGGGG + Intergenic
1189930658 X:46005683-46005705 TAGTGGGGAGGGGCAGTGGGGGG - Intergenic
1190050497 X:47145512-47145534 CGGAGGTAAGGGGCCCGGGGCGG + Intronic
1190260753 X:48795395-48795417 CAGTGGCAAGGGGCCCAGCGGGG + Intergenic
1191841902 X:65519240-65519262 CTGTGCTGAGGAGCCGTGGGAGG + Intronic
1191859785 X:65656853-65656875 CTGTGCTGAGGAGCCGTGGGAGG + Intronic
1195885959 X:109637549-109637571 GAGGGGTGAGGGGCACAGGGAGG - Intronic
1198956587 X:142137927-142137949 CAGGGGTGGGGGGCGGTGGGGGG + Intergenic
1199843794 X:151676159-151676181 CAGTGATGAGGGGAAATGGGGGG + Exonic
1200138816 X:153887221-153887243 AAGTGGTGTGGGGCCCTGGAGGG + Intronic
1200780363 Y:7210124-7210146 AAGTGGGGAGTGGGCCTGGGTGG - Intergenic
1202369494 Y:24187343-24187365 CAGTGGTGATGTGGCCTGGGAGG - Intergenic
1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG + Intergenic