ID: 912379090

View in Genome Browser
Species Human (GRCh38)
Location 1:109237212-109237234
Sequence CAGGGTCCCAGAGGGGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 401}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912379090_912379095 -10 Left 912379090 1:109237212-109237234 CCGACTTCCCCTCTGGGACCCTG 0: 1
1: 0
2: 1
3: 34
4: 401
Right 912379095 1:109237225-109237247 TGGGACCCTGTCTTCCCAGGTGG 0: 1
1: 0
2: 6
3: 27
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912379090 Original CRISPR CAGGGTCCCAGAGGGGAAGT CGG (reversed) Intronic
900004235 1:34177-34199 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
900023963 1:204693-204715 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
900313052 1:2043665-2043687 GAGGGTCCCAGAGGCGATGTCGG + Intergenic
900484002 1:2912880-2912902 CAGGGATCCGAAGGGGAAGTTGG - Intergenic
900627099 1:3613322-3613344 CAGGGGCCCAGCGCAGAAGTGGG - Intergenic
901781607 1:11598176-11598198 AGGGGGCCCAGAGGGGAAGGTGG + Intergenic
901917412 1:12510501-12510523 CACAGACACAGAGGGGAAGTGGG - Exonic
902742943 1:18452588-18452610 CAGGGTCCCAGATGGGTAGAAGG + Intergenic
903350444 1:22713413-22713435 GAGGCTCAAAGAGGGGAAGTAGG - Intronic
903878220 1:26490824-26490846 GATGGTCAGAGAGGGGAAGTTGG - Intergenic
904599541 1:31665916-31665938 CAGGGTCCCAGAGGAGAGCGAGG - Exonic
904615736 1:31748568-31748590 CAGGGTCCAAGAGGACAAGGAGG + Intronic
904663161 1:32100174-32100196 AAGGGACCCAGAGAGGAAGAAGG + Intronic
905010925 1:34746636-34746658 CCAGGCCCCAGAGGGGAACTGGG - Intronic
905405358 1:37728800-37728822 CAGGGTTCCAGAGGCAAAGAGGG + Intronic
905633205 1:39530534-39530556 CAGGGTGCCAGAGGTGGAGCTGG + Intergenic
906241171 1:44243113-44243135 CTGGGCCCCAGGGGGGCAGTGGG - Intronic
907026103 1:51121242-51121264 CAGGGTGACAGAGGAGATGTTGG - Intronic
907608986 1:55848575-55848597 CAGAGTCAAAGTGGGGAAGTAGG + Intergenic
908282786 1:62559896-62559918 CAGATTCCCAGAAGGAAAGTAGG - Intronic
912270100 1:108200136-108200158 CATGGTCCCAGAGGCGCAGGCGG + Exonic
912379090 1:109237212-109237234 CAGGGTCCCAGAGGGGAAGTCGG - Intronic
912519699 1:110236810-110236832 AAGGGTACCTGTGGGGAAGTGGG + Intronic
914939860 1:152013289-152013311 CAGGGTCCCAAAGGAGCAGGGGG - Intergenic
915245335 1:154552282-154552304 CAGGGTCCCGGAGCGGGTGTGGG - Intronic
915541208 1:156567399-156567421 GAGGCTCACAGAGGTGAAGTAGG - Intronic
915578761 1:156800515-156800537 TGGGGTCCCAGAGGTGAAGCTGG - Exonic
915626136 1:157115156-157115178 CAGGGGCTCAGAGGGGAGGCAGG + Intergenic
917716318 1:177741381-177741403 CATGGTCCCAGAGGGTGTGTGGG - Intergenic
917966466 1:180182262-180182284 CAGGTAGCAAGAGGGGAAGTCGG - Exonic
919626228 1:199912874-199912896 GGGGGTCCCAGAAGGGAGGTTGG + Intergenic
919809351 1:201399171-201399193 CAGGGTCCCAGGCGGGGAGGAGG + Intronic
920430277 1:205914446-205914468 CAGAGACTCAGAGGGGAAGAGGG - Exonic
922196312 1:223363522-223363544 CCGGGTCCCAGAGCGGAGGAGGG - Exonic
923302135 1:232651136-232651158 CAGGGTGGCAGAGGGAAATTTGG - Intergenic
924507171 1:244696850-244696872 CAGAGTCCCAGAGGGAAAGCAGG - Intronic
924798330 1:247309075-247309097 CTAGGTCCCAAAGGGGAAGAAGG + Intronic
1062904233 10:1169311-1169333 CAGGGTCCCAGCGGGGGTGGAGG + Intergenic
1062974114 10:1671160-1671182 CAGGGACCCAGACGGGGAGAGGG + Intronic
1063050574 10:2442660-2442682 CAGGGTCTCAGATGAGAGGTCGG - Intergenic
1066254733 10:33667410-33667432 CAGGGACTAAGATGGGAAGTTGG + Intergenic
1066452575 10:35544669-35544691 CAGAGTCCCAGAAGGAAAGCAGG + Intronic
1067171087 10:43906547-43906569 GAGAGGCCCAGAGGGGAAGAGGG + Intergenic
1067319694 10:45205899-45205921 CCTGGGCCCAGAGGGGAAGTGGG + Intergenic
1067743498 10:48914716-48914738 CTGGGTCCATGAGGGGAAGAGGG - Intronic
1069856653 10:71444741-71444763 CAGGCTCCCAGAGGGTGAGAAGG - Intronic
1071755831 10:88537949-88537971 CAGGGTTCCCCAGGGGAACTTGG + Intronic
1072606901 10:96991871-96991893 CAGGGCCACACTGGGGAAGTGGG - Intergenic
1072791456 10:98321122-98321144 CAGGGTCCCAGAGAGGAGTATGG + Intergenic
1073051199 10:100668414-100668436 CAGCGTCCCAGGGGGGCAGTTGG - Intergenic
1074479928 10:113809986-113810008 CAGGTTCCCAGATGGAAAATGGG - Intergenic
1074761364 10:116669707-116669729 CAGGGTTCCAGAGTGAAAGGGGG + Intronic
1074948669 10:118306217-118306239 CAGGGTCCAGGAGGGGGTGTGGG + Exonic
1075393394 10:122109698-122109720 CTGGGTAGCAGAGGGAAAGTGGG + Intronic
1076214564 10:128682681-128682703 CAGGCTGCCAGAGGGGAAGATGG - Intergenic
1078112508 11:8408984-8409006 CAGACTCCCAGAAGGAAAGTAGG + Intronic
1078431881 11:11294364-11294386 CAGGCTTCCAGAAGGAAAGTGGG + Intronic
1078625109 11:12948327-12948349 CAAGGTCCAACTGGGGAAGTTGG - Intergenic
1079088354 11:17463216-17463238 CAGGGTCCCAGAGGGAGAGGGGG - Intronic
1080606915 11:33870877-33870899 CAGGAACGCAGAGGGGAAGCGGG + Intronic
1080943970 11:36950516-36950538 CAGGGTCAAAGAGGAGAAGAAGG + Intergenic
1081551034 11:44112844-44112866 CACAGCCCCAGAGGAGAAGTGGG - Intronic
1082062102 11:47869712-47869734 TGGTGTCCCAGAGGGAAAGTGGG + Intergenic
1082880705 11:58034662-58034684 CTGGGTCCCAGTGGGAAAGAAGG + Intronic
1083262204 11:61529246-61529268 CAGGTTTCTACAGGGGAAGTTGG - Intronic
1083272688 11:61580294-61580316 GAGGGTGCCAGGGGGCAAGTGGG - Intronic
1083486174 11:62984276-62984298 CAGGGGCCAAGATGGGAAGATGG - Intronic
1083658928 11:64243186-64243208 CATGGTTCCACAGGGGAAGCTGG + Exonic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084529556 11:69718894-69718916 CAGTGTCCCCGAGGTGAACTTGG + Intergenic
1084572256 11:69966730-69966752 CAGGGTCCCAGGGGGCAGGCTGG - Intergenic
1084717456 11:70882976-70882998 CAGGGTCCCAGAGGTCAAGGTGG + Intronic
1084787739 11:71453227-71453249 CAGGGTCCCAGCGAGGTAGGCGG - Exonic
1085219174 11:74859107-74859129 CAGGGGCACAGATGGGAAGGTGG - Intronic
1085302530 11:75466946-75466968 CTGGGTCCCAGAGGGCAAGGTGG - Intronic
1088816629 11:113425603-113425625 GAGGGGCCCAGAGTGGAAGCGGG + Intronic
1088923837 11:114281052-114281074 CAGGGTCCCACTAGGGACGTAGG + Intronic
1089754339 11:120675240-120675262 GAGGGTCCCATAGGGGAGGCAGG + Intronic
1090628375 11:128625372-128625394 CAGGATCCCAGAGGGCAGGAGGG + Intergenic
1091377659 12:36225-36247 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1092101850 12:5889976-5889998 CAGGTTCACAGATGGGAAATAGG + Intronic
1092720417 12:11435354-11435376 GTGGGTCCCAGAGGGGAACCTGG + Intronic
1092777130 12:11953526-11953548 CAGGGTCACAGAGAGGACCTGGG - Intergenic
1092978015 12:13764477-13764499 CAAGGTCCCACAGGGGAGGATGG - Intronic
1093778608 12:23107086-23107108 AAGGGAGGCAGAGGGGAAGTAGG + Intergenic
1094113599 12:26886078-26886100 CAGGGTCACAGAGGAAAAATGGG + Intergenic
1095048420 12:37534962-37534984 TAGGGTCCCACAGGAGAAGGAGG - Intergenic
1095589996 12:43892407-43892429 CAGGCTCCCAGAAGGAAAGCAGG + Intronic
1096549471 12:52362743-52362765 CAGGGACCCAGAGGGAAGGGAGG - Intronic
1096842009 12:54385461-54385483 CAGGGTCGCAGAAGGGAGCTGGG - Intronic
1097287524 12:57889385-57889407 CAAGGACCCAGAGGGGCAGAGGG - Intergenic
1097376533 12:58849747-58849769 CAGGATCCCACAGGGGAAGCTGG - Intergenic
1098963580 12:76763771-76763793 GGGGGTCCCGGAGCGGAAGTGGG + Exonic
1101071405 12:101079958-101079980 CAGGGTCCAAGAGGGGACCGTGG - Intronic
1102439218 12:112948734-112948756 GAGGCTCAGAGAGGGGAAGTGGG - Intronic
1102567922 12:113809108-113809130 CATGGTGCCAAAGGAGAAGTGGG - Intergenic
1102787501 12:115616685-115616707 CAGGGTCCCAGAGCAGGAGTGGG - Intergenic
1103590237 12:121987022-121987044 CAGGGTCCCAGCTGGGATGGAGG + Intronic
1104531169 12:129572360-129572382 CAGGGTCTAAGGCGGGAAGTGGG + Intronic
1104912714 12:132247445-132247467 CAGGGTCCCTGAGCTGGAGTTGG - Intronic
1105415926 13:20211305-20211327 CACTGTCCCAGTGGGGATGTTGG - Intergenic
1106466448 13:30018358-30018380 CAGGGCCCCAGAATGGAATTAGG - Intergenic
1106478730 13:30120348-30120370 CAGTGTCCCAGAGAGGATCTTGG + Intergenic
1110114654 13:71797606-71797628 CAGGAACACAGAGGGGTAGTTGG + Intronic
1113174448 13:107546141-107546163 CAGGGTGCAAGAGGCCAAGTGGG - Intronic
1114007700 14:18332560-18332582 CCTGGGCCCAGAGGGGAAGAGGG - Intergenic
1115460691 14:33657274-33657296 CAGGGTCCCAGAGAGGAGAGAGG + Intronic
1117031279 14:51673355-51673377 CAGAATCCCAAAGAGGAAGTAGG - Intronic
1117442345 14:55771865-55771887 GAGGCTCCCAGTGGGGAAGATGG + Intergenic
1118650012 14:67881497-67881519 CAGAGTACCAGAGAGGAAGCAGG - Intronic
1119044055 14:71301818-71301840 CAGGGAGACAGAGGGGAACTTGG + Intergenic
1119598498 14:75958327-75958349 CAGGGTCTTGGAGGGGAAGTGGG + Exonic
1119805938 14:77482496-77482518 CAGGGCCCCAGGGGAGAAGGGGG - Exonic
1120720934 14:87889094-87889116 CAGGGTTACAGAGCTGAAGTAGG - Intronic
1121573845 14:94967298-94967320 CAGCGTCCCAGAGGGCCAGGGGG - Intergenic
1121735845 14:96217634-96217656 CAGGTTCAGAGAGGTGAAGTGGG + Intronic
1122137535 14:99643601-99643623 CTGAGTCCCAGCTGGGAAGTAGG + Intergenic
1122688315 14:103520418-103520440 CAGGGCCCCAGCAGGGATGTGGG - Intronic
1122742850 14:103881898-103881920 AAGGCTCCCAGAGGGGCAGCGGG - Intergenic
1123017621 14:105382944-105382966 CAGGGACCCCGAGGGGTACTTGG - Intronic
1125439574 15:39687544-39687566 CAGGGAACCAGATGGGAGGTAGG - Intronic
1125691704 15:41601171-41601193 CAGGGTCCAAGAGGGGAGACAGG + Intergenic
1126783718 15:52159824-52159846 CAGGGAGCCAGAGGGGAACAGGG + Intronic
1127417590 15:58771992-58772014 CAGGGTCCCTGAGGAGGAGGAGG + Exonic
1128638474 15:69318178-69318200 CAGGGGCTCAGAGGAGAAGAGGG + Intronic
1128710116 15:69865500-69865522 CAGGGGCCCAGAAGAGAAGCCGG + Intergenic
1128755699 15:70182303-70182325 CTGGGTTCTAGAGGGGAAGATGG - Intergenic
1128807063 15:70538972-70538994 CAGGCTCCCAGAAGGAAAGCAGG - Intergenic
1128887381 15:71301568-71301590 CAGAGTACTAGAGGGGAACTAGG - Intronic
1129288328 15:74543642-74543664 CAGGATCTAAGAGGGGAAATAGG - Intronic
1129465310 15:75721531-75721553 CAGTGTCCCAGGCGGGACGTGGG + Intergenic
1129689837 15:77706903-77706925 CAGAGTCCCAGAGGAGATGCTGG + Intronic
1129850468 15:78790880-78790902 CAGAGGCCCAGCAGGGAAGTGGG + Intronic
1130255710 15:82325181-82325203 CAGTTTCCCTGAGGGGAAGGTGG + Intergenic
1130255930 15:82326063-82326085 CAGTTTCCCTGAGGGGAAGGTGG + Intergenic
1130599252 15:85264805-85264827 CAGTTTCCCTGAGGGGAAGGTGG - Intergenic
1132355838 15:101170665-101170687 CAGGGGCGCGGAGTGGAAGTGGG - Intergenic
1132449269 15:101956767-101956789 CAGAGTCCCAGGTGGGAAGAAGG - Intergenic
1132505495 16:306445-306467 CAGGGTGGCAGATGGGAGGTGGG + Intronic
1132749692 16:1451865-1451887 CACGGTCACAGAGGGCAAGGAGG + Intronic
1133467739 16:6043906-6043928 GAGGGTCCCAGAAGGAAAGGAGG - Intronic
1134511900 16:14855157-14855179 CAGGGTGTCAGGGTGGAAGTGGG + Intronic
1134699542 16:16253656-16253678 CAGGGTGTCAGGGTGGAAGTGGG + Intronic
1134972286 16:18541015-18541037 CAGGGTGTCAGGGTGGAAGTGGG - Intronic
1135354053 16:21754836-21754858 GAGTGCCCCAGAGGGGAAGCAGG - Intronic
1135452541 16:22570975-22570997 GAGTGCCCCAGAGGGGAAGCAGG - Intergenic
1135723422 16:24835982-24836004 AGGGGTCACAGAGGGGAAGAAGG - Intergenic
1136268613 16:29135191-29135213 CATTGTCCCAGAGGGGGATTTGG - Intergenic
1137624685 16:49900191-49900213 CAGGGGCCCAGAGGGCACCTGGG - Intergenic
1137638065 16:50004713-50004735 AGGGGTTCCAGAGTGGAAGTGGG - Intergenic
1137638294 16:50006585-50006607 AGGGGTTCCAGAGTGGAAGTGGG + Intergenic
1137734283 16:50712465-50712487 CAGGGTGGCAGAGGCGAAGCTGG - Intronic
1138100736 16:54250198-54250220 CAGGCTCCCAGAAGGGCAGGGGG - Intronic
1138131281 16:54482146-54482168 CAGGGGCCCAGATTGGAGGTGGG + Intergenic
1138596788 16:58033331-58033353 CAGGGTCCCAGAGCTGATCTGGG - Intronic
1141421718 16:83921995-83922017 CAGGGTTCCTGAGAGCAAGTGGG - Exonic
1141744036 16:85913963-85913985 CAGACTCCCACAGGGGATGTAGG - Intronic
1141829500 16:86501848-86501870 AAGGGTCCCAGAGGTGGAGAAGG - Intergenic
1142071923 16:88095558-88095580 CATTGTCCCAGAGGGGGATTCGG - Intronic
1142363436 16:89637833-89637855 CAGGGTCCCTGAGGGGCTGGAGG + Exonic
1142600574 17:1051623-1051645 CAGGGTACCAGAGGTGGTGTGGG + Intronic
1144286833 17:13785322-13785344 CAGGGTCCCAGTGGGGCCTTGGG + Intergenic
1144485610 17:15661813-15661835 CAGGGTCAGAGTGGGAAAGTGGG - Intronic
1144797896 17:17904872-17904894 CATGGTCCCAGAGGGAAAGGTGG - Intronic
1144835781 17:18156026-18156048 CTGGGTCAGAGAGGGGAAGCAGG + Intronic
1144847447 17:18227257-18227279 GAGGGGCCCAGAAGGGAAGCTGG + Intronic
1145266425 17:21381658-21381680 CAGTGTCCCACAGGGGAATCAGG - Intronic
1145411682 17:22671141-22671163 TAGGGTCCCACAGGAGAAGGAGG - Intergenic
1145980653 17:29009430-29009452 CAGAGTCCCTGCTGGGAAGTAGG + Intronic
1145995585 17:29103159-29103181 CTGGGTTCCAGAGAGCAAGTAGG - Intronic
1146471119 17:33125863-33125885 CAGGGATCTAGAGGGGAGGTAGG - Intronic
1146573270 17:33970590-33970612 CTGGGTCCCAGAGGCCAAGGAGG + Intronic
1146796325 17:35783840-35783862 CAGGGTCCCAGAGGCGAGTTAGG - Intronic
1147190270 17:38734333-38734355 CTGGGGCCTAGAGTGGAAGTGGG - Exonic
1147293390 17:39461696-39461718 CAGGGCCCCAGAGCTGGAGTCGG + Intronic
1148773344 17:50079419-50079441 CAGGGTCCTGGAGAGGAAATAGG - Exonic
1151552675 17:74831109-74831131 GGGGGTCCCAGAGGGGAAGCAGG - Intronic
1153508840 18:5831295-5831317 CTGAGGCCCAGAGTGGAAGTGGG - Intergenic
1153719998 18:7892039-7892061 ATAGGTCCCAGAGGGGCAGTGGG - Intronic
1154173086 18:12064400-12064422 CAGGGTCCCACAGGGTCAGCAGG - Intergenic
1154529761 18:15331403-15331425 CCTGGGCCCAGAGGGGAAGAGGG + Intergenic
1156475692 18:37404061-37404083 CCGGGCCCCAGAGGGGAATCCGG - Intronic
1158038965 18:53069718-53069740 CAGGGTCAGAGAGGGGAGGATGG - Intronic
1158847798 18:61463158-61463180 AAGGATCCCAGAGGGGAAAAGGG - Intronic
1160010600 18:75104733-75104755 CTGGGACCCTGAGGGGCAGTAGG - Intergenic
1160178725 18:76616656-76616678 CAGGGTCCCAGCGGTCAAGCAGG + Intergenic
1160635987 19:75786-75808 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1160701208 19:508303-508325 CAGGCTCCCAGCGGGCAGGTGGG + Intronic
1160765528 19:805967-805989 CCCGGTCCCAGAAGGGAAGCGGG - Intronic
1160911006 19:1473794-1473816 CAGTGTCCCAGGGTGGAAGGTGG - Exonic
1161718722 19:5891917-5891939 CAGGCTCCCTGAGGGGCTGTGGG - Exonic
1161801804 19:6420428-6420450 CAGGGTCCCAGACGGCATGGTGG - Exonic
1161984844 19:7647477-7647499 CAGGGCCACCGAGGGCAAGTGGG + Exonic
1162070051 19:8147923-8147945 CAGGGTCCCGGGGGGGAAACAGG + Intronic
1162403082 19:10457709-10457731 CAGGAAACCAGAGGGGATGTGGG - Intronic
1162909952 19:13843145-13843167 CAGGGTCCAGAGGGGGAAGTTGG - Intergenic
1163676712 19:18659017-18659039 CAGAGACCCAGAGGGGAACAGGG - Intronic
1163774178 19:19208272-19208294 CAGGGCCCCAGTGGGGTGGTGGG + Intergenic
1163786452 19:19277273-19277295 CAGGGTCCCACACAGGAAGGAGG + Intronic
1165141439 19:33702587-33702609 CAGGGTCCAGGAGGGGCAGGCGG + Intronic
1166258307 19:41620942-41620964 CAAGGCCCCAGAGGGAAAGCAGG + Intronic
1166270362 19:41709744-41709766 CAATGTCGCAGAGGGGAAGGAGG + Exonic
1166276310 19:41756664-41756686 CAATGTCGCAGAGGGGAAGGAGG + Exonic
1166281570 19:41797653-41797675 CAGTGTCGCAGAGGGGAAGGAGG + Exonic
1167348399 19:48960987-48961009 CAGGGTCCCAGAGGAGTGGCGGG - Exonic
1167459224 19:49615544-49615566 CAGAGTCCCAGAGAGGGAGGGGG + Intronic
1167459232 19:49615568-49615590 CAGAGTCCCAGAGAGGGAGGGGG + Intronic
1167459254 19:49615678-49615700 CAGGGACCCTGAGGAGAATTTGG + Intronic
1167483780 19:49748308-49748330 CAGGCTCCAAGAAGGGAACTTGG + Intronic
1168091212 19:54085819-54085841 CAGGGTCTGAGATGGGAAGGAGG - Intergenic
1168111937 19:54197546-54197568 CAGGGTGCCAGAGGTGGAGGAGG - Intergenic
1168313692 19:55474370-55474392 CAGGGACCCAGATGGGGAGGTGG - Intergenic
925306653 2:2851536-2851558 CAGTGTCCCGGAGGGGAGGGAGG - Intergenic
925948184 2:8886065-8886087 CAGGCTCCCAGAAGGAAAGCAGG - Intronic
925964656 2:9052773-9052795 CAGAGTCCCAGAGAGAAAGATGG + Intergenic
926012220 2:9417329-9417351 CAGGGGCCTACAGGAGAAGTGGG - Intronic
926612835 2:14963553-14963575 CAGGTTCCCAGAAGGAAAGTAGG - Intergenic
927940709 2:27101401-27101423 CCCGGGCCCAGAGGGGAAGCTGG - Exonic
927940728 2:27101452-27101474 CCCGGGCCCAGAGGGGAAGCTGG - Exonic
927940746 2:27101503-27101525 CCTGGGCCCAGAGGGGAAGCTGG - Exonic
928102262 2:28445935-28445957 CAGGACCCCAGAGGGGAGTTAGG - Intergenic
928211376 2:29326402-29326424 CTGTGTCCCAGCTGGGAAGTAGG + Intronic
928320994 2:30282787-30282809 AAGGGTCCCAGAGTGGGACTGGG - Intronic
929535807 2:42783574-42783596 CAGGGAACCAGAGGGAATGTTGG + Intronic
929537736 2:42793807-42793829 GAGGGTCTCAGTGGGGAATTCGG - Intergenic
931692424 2:64846505-64846527 CAGGGTCCCAGAGGGCAGGGAGG - Intergenic
933695826 2:85216390-85216412 GAGGTTCCCAGATGGCAAGTGGG - Intronic
936114729 2:109692630-109692652 CCGGGCCGCAGTGGGGAAGTGGG - Intergenic
936565493 2:113579266-113579288 CAGAGTCCCAGGTGGGAAGAAGG - Intergenic
937952598 2:127400389-127400411 CAGGGGCCAAGAGGGGAGGATGG + Intergenic
938518088 2:132037538-132037560 CAGGGTCCCTTGGGGGAGGTGGG - Intergenic
938528855 2:132162843-132162865 CCTGGGCCCAGAGGGGAAGAGGG + Intronic
938835086 2:135094072-135094094 CAGGCTCCCAGAAGGAAAGCAGG + Intronic
941575789 2:167228374-167228396 CATGTTCCCATAGGGGAAGGAGG - Intronic
943106127 2:183546760-183546782 CAGGAGCCCAGGGGGGAGGTGGG + Intergenic
944404502 2:199367748-199367770 CAGGGTCCCTGAGGGGATTTGGG - Intronic
945653120 2:212589772-212589794 CAGGAACCCAGAGAGGCAGTGGG + Intergenic
946178318 2:217935374-217935396 TAGGGTCCCAGCTGGGAACTTGG + Intronic
946386254 2:219386205-219386227 CAGGGTACCCGTGGGGAAGAGGG - Intronic
946395818 2:219443187-219443209 CAGGGACCAAGAGGAGGAGTAGG - Intronic
946411476 2:219517318-219517340 CAGGGTACCAGAGGGCCTGTGGG - Intronic
946900654 2:224368459-224368481 CAGGGTCCCTTTGGAGAAGTAGG - Intergenic
947157347 2:227175639-227175661 CAGGGTACCACAGAGGAGGTGGG + Intronic
948808811 2:240464819-240464841 CAGGGTCCTTGGGGGGTAGTGGG - Intronic
948942047 2:241201564-241201586 TGGGGTCCCGGAGGGGAACTGGG - Intronic
1168939222 20:1694896-1694918 TAGGGGCCCATAGGGGAGGTGGG - Intergenic
1169503576 20:6184679-6184701 CATGGACACAGAGGGGAATTTGG - Intergenic
1170125578 20:12959820-12959842 CAGGATCCCAAATGGGAAATAGG + Intergenic
1171010942 20:21509129-21509151 CAGGTTTCCAGAGAGGAAGGGGG - Intergenic
1171087874 20:22255073-22255095 AAGAGTCCCAGAGGGGGATTGGG - Intergenic
1171479372 20:25441419-25441441 CAGGATTTCAGAGGGGAAGGAGG + Intronic
1171542950 20:25978441-25978463 TAGGGTCCCACAGGAGAAGGAGG - Intergenic
1171845989 20:30275086-30275108 TAGGGTCCCACAGGAGAAGGAGG - Intergenic
1172270846 20:33654985-33655007 GAGGGTCCCAGACAGGGAGTGGG - Intergenic
1172884806 20:38223703-38223725 CAGGAGCACAGAGGGGAGGTGGG + Intronic
1173529524 20:43758304-43758326 CAGGGTCCAAGTGAGGAAGGAGG - Intergenic
1173537564 20:43827781-43827803 CAGACTCCCAGAAGGAAAGTAGG - Intergenic
1173595614 20:44257120-44257142 CAGGGTCAGAGCGGGGAAGGCGG - Intronic
1173727484 20:45307633-45307655 CAGGGTGCCAGGTGAGAAGTTGG - Intronic
1174373767 20:50112317-50112339 CAAGGTCCGAGTGGGGCAGTTGG - Intronic
1174571694 20:51506655-51506677 CAGGGTACCAGAAGGGCAGCAGG + Intronic
1174615040 20:51828999-51829021 CAGGGGGCCAGAGCAGAAGTGGG - Intergenic
1174662141 20:52222561-52222583 CAGCATGCCAGAGAGGAAGTGGG - Intergenic
1175541933 20:59753413-59753435 CAGGGTCCCAGGCAGGAAATGGG + Intronic
1175903316 20:62368347-62368369 CATGGTCCCAGATGGGCTGTGGG + Intergenic
1176145167 20:63562246-63562268 CTGGGGGCCAGAGGGGAAGCTGG + Intronic
1176296306 21:5075303-5075325 GAGGGGGCCAGAGGGGAAGGAGG - Intergenic
1176767651 21:13037069-13037091 CCTGGGCCCAGAGGGGAAGAGGG - Intergenic
1177261032 21:18730242-18730264 CTGGGTTCCAGTGGGGAAGAAGG - Intergenic
1178754735 21:35337687-35337709 GAGGGTCCCAGAGGTAAACTGGG - Intronic
1179860743 21:44186818-44186840 GAGGGGGCCAGAGGGGAAGGAGG + Intergenic
1179974809 21:44858587-44858609 CAGGGTCCCGCAGGGGAACAGGG - Intronic
1180085601 21:45506753-45506775 GAGGGTTCCAGAGGGAAGGTGGG - Intronic
1180958444 22:19751474-19751496 CAGGGACCCAGTGGGGAAGCCGG + Intergenic
1181014759 22:20062468-20062490 CAGAGGCCCAGAGGAGAAGGAGG - Intronic
1181620349 22:24086882-24086904 CAGGGTCCCAGAGAGAGAATGGG + Intronic
1182281709 22:29221169-29221191 CAGGCTCCCAGAGTGGAGCTGGG + Intronic
1182856428 22:33521472-33521494 CAGGCTCCCAGAGTGGCAGGGGG + Intronic
1183972202 22:41486000-41486022 CAGGGTCGCAGAGGGCAACCAGG - Intronic
1184633326 22:45803778-45803800 CAGGTTATCAGAGGAGAAGTGGG + Intronic
1184918155 22:47587418-47587440 CAGTGTCCCAGAGGGGCTGTGGG - Intergenic
1185400612 22:50613674-50613696 GAGGCTCCCAGAGCAGAAGTGGG - Intronic
949412746 3:3783713-3783735 CAGGGTGGCAGAAGGGAGGTGGG - Intronic
949571772 3:5300606-5300628 CAGGCTCCCAGAAGGAAAGGAGG + Intergenic
950517707 3:13478542-13478564 CAAGTTCCCTGAGGGGAAGTCGG + Intergenic
950787393 3:15448048-15448070 CAGGGTCTCAGAGATGCAGTTGG - Intronic
950797023 3:15518549-15518571 CTGGGTCCCAGAGGAGAACCAGG - Intronic
950988523 3:17404382-17404404 CAGGGTTGCAGTGGGGAATTGGG - Intronic
952250628 3:31649691-31649713 CAGGGTCCCAGAAGGCAAAGAGG + Intergenic
953829043 3:46279491-46279513 CAGTGTGCCAGAGGGGATGGAGG - Intergenic
953876500 3:46669773-46669795 CAGAGTCCCAGAGATGATGTGGG - Exonic
954367995 3:50156231-50156253 AGGGGTCCCAGTGGTGAAGTGGG + Intronic
954717791 3:52534923-52534945 CAGGGCCCCAGTGAGCAAGTGGG + Intronic
954992328 3:54852170-54852192 CAGTGTCCAGGAGTGGAAGTGGG + Intronic
955750465 3:62181213-62181235 CAGGGTCCCACATCGGAAGAAGG + Intronic
955835667 3:63052129-63052151 TTGGTTCCCAGAGGGGAGGTGGG + Intergenic
957894868 3:86409265-86409287 CAGGTTTCAAGAGGGGAACTTGG - Intergenic
958021585 3:88003911-88003933 CAGGGTCCCATAAGTAAAGTAGG - Intergenic
960020205 3:112941884-112941906 CATGGTCTCTGAGGAGAAGTTGG - Intronic
961556917 3:127702174-127702196 CAGTGGCCCAGAGGGGAAAGAGG - Intronic
961556952 3:127702316-127702338 CAGGGTGGCAGAGGGGAGATAGG + Intronic
961626124 3:128264909-128264931 CAGGCAGCCAGAGGGGAGGTGGG - Intronic
962649196 3:137471578-137471600 CAGACTCCCAGAAGGAAAGTAGG - Intergenic
962986709 3:140542995-140543017 TAGGCTTACAGAGGGGAAGTAGG - Intronic
963103329 3:141625267-141625289 CAGGGGCCCAGAAGGGAACCTGG + Intergenic
963260435 3:143186654-143186676 GTGTGTCCCAGAGGAGAAGTTGG + Intergenic
963700024 3:148613976-148613998 CACTGTTCCAGAGGGGAAATTGG - Intergenic
964309995 3:155382490-155382512 CAGGATCCCATAAGGAAAGTGGG + Intronic
964471786 3:157064456-157064478 GAGGGTGCCTGAGGGGAACTGGG - Intergenic
964643536 3:158934596-158934618 CATGGGCCTAGAGGGGGAGTAGG - Intergenic
964851965 3:161104967-161104989 AAGGGGCCCAGTGGGGCAGTGGG - Intronic
966932525 3:184685163-184685185 CAGGGAGCAGGAGGGGAAGTGGG + Intergenic
967527268 3:190509178-190509200 CAGGGCACCACAGAGGAAGTGGG + Intergenic
968662368 4:1804043-1804065 TGGGGACCCAGATGGGAAGTGGG - Intronic
968827622 4:2911191-2911213 CAGGTTCTCAGATGGGAAGCAGG - Intronic
969172709 4:5376833-5376855 CATGGGGCCAGAGGGGATGTGGG - Intronic
969240134 4:5892298-5892320 GAGGTTCTGAGAGGGGAAGTTGG - Intronic
969263208 4:6046597-6046619 CAGGGTGCAAGCGGGGAGGTGGG + Intronic
969280395 4:6166915-6166937 CAGGGTGGAGGAGGGGAAGTTGG - Intronic
969926714 4:10592453-10592475 CAGAGACCAAGTGGGGAAGTGGG - Intronic
970463988 4:16304814-16304836 AAGGGTCCCAGAGAGCCAGTGGG + Intergenic
972559568 4:40214826-40214848 CAGGGACTCAGAGTGGAAGGAGG - Intronic
973942378 4:55924002-55924024 CAGAGTCTCAGATGGGGAGTTGG - Intergenic
976968197 4:91071308-91071330 AAGGGTGCCAGAAGTGAAGTAGG + Intronic
979278933 4:118842841-118842863 CAGGGTTCAAGAGGGGTAGGTGG - Intergenic
979566726 4:122162468-122162490 CAGGTTCACAGATGGGAATTGGG + Intronic
979732856 4:124045555-124045577 CAAGTTCCCAGAGGGAAAGGTGG - Intergenic
985492180 5:186533-186555 GAGGGGCCCACAGGGGACGTGGG + Exonic
985670930 5:1206338-1206360 CAGAGTCACAGAGGGGGAGATGG - Intronic
988504468 5:31809878-31809900 CAGGGTACCAGAGGAGGAGCAGG - Intronic
988993123 5:36690435-36690457 CAGCGTCCTAGAGGGAAAGCGGG + Intergenic
990385233 5:55253920-55253942 CAGGCTCCCAGAAGGAAAGCAGG - Intergenic
992001076 5:72437235-72437257 CAGGGACCAGGAGAGGAAGTGGG + Intergenic
996919378 5:128749786-128749808 CAGTGTCCCAAAGGGGGACTCGG + Intronic
999270133 5:150291924-150291946 GAGGGTGGCAGAGGGGAAGAGGG + Intergenic
999779373 5:154836601-154836623 CAGGGTGTCAGAGGGGATGTTGG + Intronic
1000155782 5:158550110-158550132 TAGTGTCCCAGAGGGGCTGTGGG + Intergenic
1000214354 5:159140294-159140316 CATCATCCCAGAGGGGAACTCGG - Intergenic
1000224838 5:159250470-159250492 CTGGGCCACAGAAGGGAAGTGGG - Intergenic
1001571304 5:172732344-172732366 CTGGGGCCCAGAGGAGGAGTGGG - Intergenic
1002070072 5:176673947-176673969 CAGGGTGTCAGAGCAGAAGTGGG + Intergenic
1002280501 5:178127350-178127372 AAGGCTCCCGGAGAGGAAGTGGG + Intergenic
1002562242 5:180090400-180090422 GAGGGTCCGTGAGGGGAAGGAGG + Intergenic
1002644815 5:180647968-180647990 GAGGGGCCCAGAGGGCAAGGGGG - Intronic
1003571408 6:7258700-7258722 TTGGGTCCCACTGGGGAAGTCGG + Intergenic
1003969305 6:11282793-11282815 CAGGGAGCCAGAGGGAAAGCAGG - Intronic
1004098351 6:12582334-12582356 GAGGGTCCCAGAGGGACAGCAGG - Intergenic
1005912917 6:30326725-30326747 AAGGGACCCAGAGGGGCAGGTGG - Intronic
1006122387 6:31815302-31815324 CAGGGACCCTGAGAGGAAGGGGG - Intergenic
1006914407 6:37585222-37585244 CAGGATCCCAGAGAGGAAGGTGG - Intergenic
1007282326 6:40721763-40721785 CAGGGCCCCAGGGAGGAAGACGG - Intergenic
1007599372 6:43072258-43072280 CAGAAGCCCAGAGGGGAAGGAGG + Intronic
1008556048 6:52673568-52673590 CAGGGTCCCAGCTGGGACCTTGG - Intronic
1009752101 6:67887245-67887267 CAAAGTCCCAGAGGGGCTGTTGG + Intergenic
1013301636 6:108809651-108809673 CAAGATCCCAGATGGGAAATGGG + Intergenic
1013500736 6:110748603-110748625 CAAGGTCCCAGAGGGCATATGGG + Intronic
1013617454 6:111858227-111858249 CAGAGTCCCAGAGAGGAGGCAGG + Intronic
1015143167 6:129958319-129958341 GAGGGTCCCTGAGGTGAAGCTGG + Intergenic
1016027947 6:139307926-139307948 TAGGGACCCAGAGTGGAAGTGGG + Intergenic
1019447438 7:1078744-1078766 CGGGGTCCCAGTGGGCAGGTGGG - Intronic
1023146895 7:37160483-37160505 CAGGGTGCCAGTGGGGAAACAGG - Intronic
1023939635 7:44761342-44761364 CAAGGTCCCTGCGGGGAAGGTGG + Intronic
1023995464 7:45156794-45156816 CAGGGTCCCTGAGGCGAAGGAGG - Intergenic
1024318450 7:48042981-48043003 CAGGTTTCCAGATGGGAAGTAGG - Intronic
1024633184 7:51265643-51265665 GAGGTGCCCAGAGGGGAAGAAGG + Intronic
1025195728 7:56931229-56931251 CAGAGTCCTGGAGGGGTAGTGGG - Intergenic
1025676221 7:63645706-63645728 CAGAGTCCTGGAGGGGTAGTGGG + Intergenic
1025962339 7:66233813-66233835 CAGTGACCAAGAGGGAAAGTGGG - Intronic
1026447603 7:70499215-70499237 AAGGGTCCCAGAGGAGGAATTGG + Intronic
1029202693 7:98849588-98849610 CAGGGGCCCAGAGTGGGATTGGG + Intronic
1031087818 7:117321068-117321090 CAGGGGCACAGAGGCAAAGTCGG + Intronic
1032436576 7:131905865-131905887 CATGGTCCTAGAGGGTAATTTGG + Intergenic
1032851779 7:135801609-135801631 CAGGGTCCTACAGAGGAATTTGG - Intergenic
1033241444 7:139682931-139682953 CAGGGCCACAGACAGGAAGTGGG + Intronic
1034161033 7:148994497-148994519 CAGGGTCCCATGGGGGAGCTGGG + Intergenic
1034189942 7:149206366-149206388 CAGGGTGACAGAGGGGTAATGGG - Intronic
1034452229 7:151143153-151143175 CAGGCACACAGAGGGGCAGTGGG - Intronic
1035158766 7:156935587-156935609 CTGGGTCCCAGGGGGCCAGTGGG - Intergenic
1036404545 8:8442921-8442943 GAGGTTGCCAGAGGGGAAATAGG - Intergenic
1036614753 8:10379578-10379600 CAGGGTGCCAGAGGGGAAGAGGG - Intronic
1037985616 8:23288899-23288921 CTGGGACCCAGAGGGGCAGAAGG + Intronic
1038661876 8:29504567-29504589 CCGGGACCCAGAGTGGAAGAAGG - Intergenic
1039346841 8:36713965-36713987 CAGGGTCCCAGGTGGGAGTTGGG + Intergenic
1039553590 8:38460787-38460809 CAGGGTCCCAGACAGCATGTTGG - Intronic
1041383699 8:57278379-57278401 CTGGGGCCCAGAGGGGAAGCGGG - Intergenic
1041423236 8:57692811-57692833 CAGGGTCCCAGAGGTCATGGAGG + Intergenic
1041964187 8:63656001-63656023 CAAGGACACAGAGAGGAAGTGGG - Intergenic
1042932008 8:74023150-74023172 CATGGTGCCAGCAGGGAAGTGGG - Intronic
1044526394 8:93256522-93256544 CAGAGTCCGAGAAGGGAAGGAGG + Intergenic
1045290395 8:100827841-100827863 CAGTGTCCCAAAGAGGAAGCTGG + Intergenic
1047218468 8:122898892-122898914 CAGGAGCCCACAGGTGAAGTGGG - Intronic
1047996898 8:130345555-130345577 CAGGGTGGCAGTGGGGAGGTGGG + Intronic
1049012254 8:139894897-139894919 CTGGGTCCCAGAGTGGAAGGGGG + Intronic
1049178067 8:141206206-141206228 CAGGGTCCCAGATGGCAAATGGG + Intergenic
1049231562 8:141487602-141487624 AAGGGACCGAGAGGTGAAGTGGG + Intergenic
1049285657 8:141773788-141773810 CAGGGTCAGAGAGAGGCAGTGGG - Intergenic
1049397005 8:142405498-142405520 CCAGGTCCCAGAGGGAATGTGGG + Intergenic
1049448238 8:142641457-142641479 CAGGACCTCAGAAGGGAAGTGGG + Intergenic
1049566050 8:143339727-143339749 CAGGGACAGGGAGGGGAAGTGGG + Intronic
1049566624 8:143343588-143343610 GATGGTCCCAGAGGGGACCTGGG - Intronic
1049886932 9:33960-33982 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1050933784 9:11366877-11366899 CAGGCTCCCACAGGGGCAGAGGG - Intergenic
1050998109 9:12245346-12245368 CAGGGTCTGAGATGGGAAATGGG + Intergenic
1052095330 9:24377086-24377108 CATGGTCTAGGAGGGGAAGTTGG + Intergenic
1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG + Exonic
1053707470 9:40769172-40769194 CCTGGGCCCAGAGGGGAAGAGGG + Intergenic
1054162089 9:61680756-61680778 TAGGGTCCCACAGGAGAAGGAGG + Intergenic
1054417382 9:64889940-64889962 CCTGGGCCCAGAGGGGAAGAGGG + Intergenic
1055944460 9:81680395-81680417 CAGGATCCAACAGGGGGAGTTGG - Intronic
1056210450 9:84360226-84360248 CAAGGGCCCAGATTGGAAGTTGG + Intergenic
1057621266 9:96637826-96637848 CATGGTTTCTGAGGGGAAGTTGG + Intergenic
1057794116 9:98143453-98143475 CAGTGTAGCAGAGGTGAAGTGGG + Intronic
1058869675 9:109191120-109191142 AAGGGTCCTAGAAGGGAAGAGGG - Intronic
1058952503 9:109916784-109916806 CTGGGTCCCAGAGGGCACGATGG - Intronic
1059777053 9:117486627-117486649 CAATGTCCCTGAGGGGAAGCTGG - Intergenic
1060550108 9:124481023-124481045 CAGGGTCCCAGGGATGAGGTGGG + Intergenic
1061074408 9:128332447-128332469 CAGGAGCCCTGAGGGGCAGTGGG - Intronic
1061497122 9:130981516-130981538 CTGTGGCCCTGAGGGGAAGTGGG - Intergenic
1061973472 9:134056761-134056783 CAGAGTCCCAGTGGGGAGGGAGG + Intronic
1062166986 9:135112829-135112851 CAAGGTCCCTGAGGGGGAGAAGG + Intronic
1062536319 9:137022612-137022634 GAGGGGCCCAGAGTGGATGTGGG + Intronic
1186126856 X:6423813-6423835 CAGGTTTCCAGAGTGGAAGTAGG + Intergenic
1186413010 X:9360320-9360342 AATGTTCCCAGAGGGGCAGTGGG + Intergenic
1186709172 X:12174568-12174590 AAGGGTCCCAGAGTGGAAGAAGG - Intronic
1187525242 X:20048216-20048238 CAGGTTCCCAGAAGGAAAGCAGG - Intronic
1187795558 X:23000066-23000088 CTGGGCCCCAGAGTGGAAGAGGG + Exonic
1189084043 X:38001428-38001450 TAGGGTGCTGGAGGGGAAGTTGG - Intronic
1189274140 X:39772543-39772565 CAGGGTCACAGAGGGCAAAATGG - Intergenic
1189302189 X:39960111-39960133 GAGGGTCCGAGAGGGGAACTGGG + Intergenic
1189704013 X:43742011-43742033 CATGATCCCAGGAGGGAAGTAGG - Exonic
1190685853 X:52872494-52872516 CAGATTCCCAGAAGGGAAGCTGG - Intergenic
1192043240 X:67644995-67645017 CAGGGTCTCACTGGGGAAGTTGG - Intronic
1192152313 X:68719887-68719909 CATTGTCCCAGAGGAGAAATGGG - Intronic
1193070256 X:77298916-77298938 CAGGTTACCAGATGGGAAGGTGG + Intergenic
1194887921 X:99340883-99340905 CAGAGGCTCAGAGGGGAAGAGGG - Intergenic
1201788853 Y:17815924-17815946 CAAGGTCCCAGAAGAGCAGTAGG + Intergenic
1201812700 Y:18090063-18090085 CAAGGTCCCAGAAGAGCAGTAGG - Intergenic