ID: 912379514

View in Genome Browser
Species Human (GRCh38)
Location 1:109239797-109239819
Sequence CTCCTACACCAGTCCCTACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912379514_912379519 2 Left 912379514 1:109239797-109239819 CCGTGTAGGGACTGGTGTAGGAG 0: 1
1: 0
2: 0
3: 16
4: 114
Right 912379519 1:109239822-109239844 TGGCTAGGAAGATGGCTGTATGG 0: 1
1: 0
2: 4
3: 33
4: 306
912379514_912379520 11 Left 912379514 1:109239797-109239819 CCGTGTAGGGACTGGTGTAGGAG 0: 1
1: 0
2: 0
3: 16
4: 114
Right 912379520 1:109239831-109239853 AGATGGCTGTATGGACAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 189
912379514_912379517 -6 Left 912379514 1:109239797-109239819 CCGTGTAGGGACTGGTGTAGGAG 0: 1
1: 0
2: 0
3: 16
4: 114
Right 912379517 1:109239814-109239836 TAGGAGCCTGGCTAGGAAGATGG 0: 1
1: 0
2: 3
3: 26
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912379514 Original CRISPR CTCCTACACCAGTCCCTACA CGG (reversed) Intergenic
900212191 1:1461637-1461659 CTCTCCCTCCAGTCCCTACATGG - Intronic
900212202 1:1461676-1461698 CTCTCCCTCCAGTCCCTACATGG - Intronic
902814573 1:18908839-18908861 CCCCTGCACCAGCCCCTACTTGG + Intronic
907230422 1:52993238-52993260 CTCCTTCACCAGAACCAACACGG - Intronic
912379514 1:109239797-109239819 CTCCTACACCAGTCCCTACACGG - Intergenic
913474229 1:119221415-119221437 CTCCTCCCCCACACCCTACAGGG + Intergenic
916456710 1:164978431-164978453 CTCCTACACCCTTCCCAGCATGG + Intergenic
917616929 1:176755397-176755419 CTCCTAGAACAGTATCTACAGGG - Intronic
918395933 1:184112939-184112961 CTCCAACTCCACTCCCTACTGGG + Intergenic
920263039 1:204702806-204702828 CTCATACACCATTCCCCACAAGG + Intergenic
922269326 1:224017186-224017208 CTGCTCCACCTGCCCCTACAGGG + Intergenic
922427718 1:225514848-225514870 CTCCTCCACCACTCCCACCAGGG - Exonic
922762385 1:228140964-228140986 TTCCCACACCAGTCCTTACTGGG - Intronic
923909165 1:238420455-238420477 CACCTACACTAGTTTCTACAAGG - Intergenic
924456666 1:244224048-244224070 CCCCTTCACCAGTCCCCATAAGG + Intergenic
1062845200 10:698005-698027 CACCTACTCCATTCCCTTCACGG + Intergenic
1067041166 10:42953998-42954020 CTCCTGCATTAATCCCTACAAGG - Intergenic
1067385821 10:45817229-45817251 CTCCTTCACCACTTCCTCCATGG + Exonic
1067449230 10:46371145-46371167 CTCCTTCACCACTTCCTCCACGG - Exonic
1067588140 10:47489620-47489642 CTCCTTCACCACTTCCTCCACGG + Exonic
1067635265 10:47997711-47997733 CTCCTTCACCACTTCCTCCACGG + Intergenic
1068099566 10:52534444-52534466 TTCCTACTCCAGTTCCTTCAAGG + Intergenic
1068506456 10:57906040-57906062 CTCCTCCATCAGTCCCCACAAGG + Intergenic
1076187772 10:128462287-128462309 CCTCAACACCAGTCCCTAGAGGG + Intergenic
1076273138 10:129174239-129174261 CACCTACACCAGTCACTCCAAGG + Intergenic
1077468167 11:2743568-2743590 TCCCTACGCCAGTCCCTGCATGG + Intronic
1077849731 11:6063835-6063857 CTCCTCCAACAGTCCCTCCAAGG + Intergenic
1078764305 11:14279379-14279401 CTCCTTCACCAGAACCAACACGG - Exonic
1088597423 11:111450703-111450725 CTCTTACCCCGGTCCCTGCAGGG + Intronic
1096604190 12:52753320-52753342 CTCCTCCACGAGTGCCTGCATGG + Intergenic
1099253137 12:80283314-80283336 CTCCTACTCCAGTCTTTCCAAGG + Intronic
1103718337 12:122959680-122959702 CTCCTACACCAAGCCCGACGTGG - Exonic
1106326884 13:28700224-28700246 CTCACTCCCCAGTCCCTACAGGG - Intronic
1108019080 13:46107320-46107342 CTCCAACAGGAGCCCCTACAGGG - Intergenic
1108141266 13:47424235-47424257 CTCCTTCATCAGTGCCTAGAGGG - Intergenic
1110311644 13:74056882-74056904 CTCCTTTACCAGGCCCCACAAGG - Intronic
1113819508 13:113203278-113203300 CTCCTGCCCCAGTCCATGCAAGG + Intronic
1117083040 14:52171060-52171082 CTCCTGCATCAGTCTCAACATGG - Intergenic
1117445294 14:55798442-55798464 CTCCAACACCAGTGCACACATGG - Intergenic
1122757027 14:103989820-103989842 CTCCTTCTCCAGTCCCTCCAGGG - Intronic
1124344190 15:28910538-28910560 CTCCTTCACCACCCCCTCCATGG - Intronic
1124958312 15:34374638-34374660 CTCCTCCACCAGTCCAAACTTGG - Intergenic
1125287041 15:38105025-38105047 CTCCTACCCCAGACCCTTCCAGG + Intergenic
1125568342 15:40694862-40694884 CTCCTACCCCAGTCCCTCGCGGG - Intronic
1132841897 16:1982144-1982166 CACCTACTCCAGCCCCTTCAGGG + Exonic
1134913959 16:18053578-18053600 CTCCTCCAACAGCCCCTGCAGGG + Intergenic
1138436151 16:57001122-57001144 ATCCTACACCAAGCCCTACCAGG - Intronic
1142414108 16:89932087-89932109 CTGCTACACCTGCCCCTCCATGG - Intronic
1143837033 17:9700909-9700931 CTCCCCCACCAGCTCCTACAGGG - Intronic
1143837220 17:9701880-9701902 CTCCCCCACCAGCTCCTACAGGG - Intronic
1145767056 17:27465916-27465938 CTCCTACCCCACTCCCACCAAGG + Intronic
1145941752 17:28746376-28746398 CTCCTGCACCAAACCCTACCTGG - Intronic
1151730682 17:75909449-75909471 CTCCCACACCAGCACCTACCAGG + Exonic
1158935907 18:62364358-62364380 CTCCTTCAGCAGCCGCTACATGG - Intronic
1160742718 19:694905-694927 CCCCCACTCCAGGCCCTACATGG - Exonic
1164712596 19:30368083-30368105 CTCCTACTCCTGTCCCTCCTGGG + Intronic
1165152723 19:33770452-33770474 CTCCTTCCCCAGTCCCTACCTGG - Intronic
1165291203 19:34887702-34887724 CTCCAACACCAGCTCCTCCAGGG - Intergenic
1165487278 19:36103461-36103483 CCCCTCCACCTGTTCCTACATGG + Exonic
1168515998 19:57010710-57010732 CTCCTGCACCATTCGCTAGAAGG - Intergenic
926046946 2:9716902-9716924 CTCCCTCACAAGGCCCTACAAGG - Intergenic
927783078 2:25954831-25954853 CTCCCACTCCAGTCTCTTCAGGG + Intronic
933701818 2:85260531-85260553 CTCCTACCTCAGTCCCCACCGGG - Intronic
937674855 2:124578661-124578683 CTCCCACCTCAGTCCCCACAAGG - Intronic
941525835 2:166605955-166605977 TTCTTAAACCAGTCACTACAAGG + Intergenic
944400998 2:199326368-199326390 CTGCTACACCTATCCCTAAAGGG + Intronic
947864891 2:233389768-233389790 CTCCCTCTCCACTCCCTACAGGG - Intronic
948259860 2:236595628-236595650 CTCCTACACCAAACGCTCCACGG - Intergenic
1170530697 20:17288122-17288144 CTCCTTCACCAGGCCCTTCCAGG + Intronic
1173441911 20:43085283-43085305 CTCCTACACCAAACTCTACAAGG + Intronic
1178263835 21:31124400-31124422 CTCCTACATCAGCCCCCACCAGG + Intronic
1179584433 21:42365785-42365807 CTCCTCCTCCACTCCCTAGAAGG + Intronic
1181002826 22:19995847-19995869 CCCCTCCACCCTTCCCTACAAGG + Intronic
1183230414 22:36578618-36578640 CACCTCCACCAGTCCCACCAGGG - Intronic
1184979393 22:48085290-48085312 CTCCCACATGAGCCCCTACAGGG - Intergenic
951446126 3:22782484-22782506 CCCCTACACAAGTCCCTCCTTGG - Intergenic
952238491 3:31505679-31505701 CTCCAACTCCTGTCCCTACATGG + Intergenic
952729137 3:36620585-36620607 CACCTCCTCCAGTCCCTCCACGG - Intergenic
958193377 3:90211728-90211750 CTCTTACATCAGCCCCCACATGG - Intergenic
958416678 3:93882650-93882672 CTCTTACGTCAGCCCCTACATGG - Intronic
964812338 3:160679101-160679123 CTCCTACCCCACTTCCAACAAGG + Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967553794 3:190831400-190831422 CTCCTCCACCACTCCCACCAAGG + Intergenic
967869745 3:194220250-194220272 CTCCTAGGCCATTCTCTACATGG - Intergenic
976663564 4:87565707-87565729 CTCCTGGACCAGCTCCTACAGGG - Intergenic
986234163 5:5892384-5892406 CTCCTACACCAGCCCCTCAAAGG + Intergenic
987384965 5:17320343-17320365 CTCCAACACCAGGCCAGACAGGG - Intergenic
989187723 5:38641361-38641383 CTCCCAAAACAGTCCCTAAAAGG + Intergenic
991430605 5:66541015-66541037 CTCCTACTCCAGGCTCTTCAAGG + Intergenic
997408940 5:133675500-133675522 CCCCAACACCAGTGCCCACAGGG + Intergenic
999211596 5:149894202-149894224 CTCATACACAAGCCCCAACAAGG - Intronic
1006183153 6:32166065-32166087 CTCCAGCACTAGTCCCTCCAAGG - Intronic
1007219178 6:40265056-40265078 CTCCAACACCAGCACCTTCAGGG + Intergenic
1008008037 6:46433334-46433356 CTCCTACCCGAGTCCCACCAAGG + Intronic
1014746623 6:125208460-125208482 CTCCTCCACCAATCCCTTCTGGG - Intronic
1016845337 6:148563387-148563409 CGCCTGCCCCAGTGCCTACATGG - Intergenic
1017311828 6:152983938-152983960 CTCCTACACCTGGCCCTTTAAGG - Intergenic
1017913370 6:158814060-158814082 CTCCTACAACTCTCCCTAGATGG + Intronic
1021941862 7:25686228-25686250 CCCCCACACCAGCCCCTATAAGG - Intergenic
1022192481 7:28030129-28030151 ATCCTGCGCCAGCCCCTACAGGG - Intronic
1022212141 7:28221883-28221905 CTCCAAAACCTGTCCCTTCAAGG + Intergenic
1022522454 7:31016904-31016926 TGCCCACACCAGTCCCTTCAGGG - Intergenic
1022544442 7:31173184-31173206 CTCCTTCACCTCTCCCTACAAGG - Intergenic
1024121524 7:46245954-46245976 CACCTACCCCATTTCCTACAGGG + Intergenic
1024799701 7:53061922-53061944 CTGCTCCACCAGTTCCTGCAAGG + Intergenic
1026058857 7:67008384-67008406 CTCCTACCCCAGCCCCAACAGGG - Intronic
1026461681 7:70620303-70620325 TTCCTACACCAGTAAGTACAGGG - Intronic
1026470659 7:70692289-70692311 CTCCTGCACCATCCCCTACAGGG - Intronic
1030613702 7:111716156-111716178 CTCCCACACCACTCTCTACTGGG + Intergenic
1032853220 7:135812968-135812990 CTTCCACCCCAGTCCCTACTGGG + Intergenic
1033570577 7:142624617-142624639 TTCCTACACCAGCCCCTTCAGGG - Intergenic
1033995538 7:147341712-147341734 CTCCTACCCCAAACCCAACAAGG + Intronic
1036789529 8:11708780-11708802 CTCCTACTCCAGCCCCTACCCGG + Exonic
1037386825 8:18352053-18352075 CTCCTCCACCACTCCCTGGAGGG + Intergenic
1037824606 8:22153898-22153920 CTCCCACACCACTCCCTCCAGGG + Intronic
1039763215 8:40600412-40600434 TTCCTACACCACTTCATACAGGG + Intronic
1040680289 8:49800975-49800997 CTCCTAAAACTGTCCCCACAGGG + Intergenic
1047034087 8:120915438-120915460 CTCCAACTCCAGTGCCCACAAGG + Intergenic
1048299005 8:133237937-133237959 CTCCTACTCCGGCCCCTGCAAGG + Exonic
1050205723 9:3194419-3194441 CTCCTAAATCAGTGCCTCCAGGG + Intergenic
1052882891 9:33615732-33615754 TTCCTACACCAGCCCCTTCAGGG - Intergenic
1055910289 9:81343043-81343065 CCCCTACACTAGTCACAACAAGG + Intergenic
1059786531 9:117592210-117592232 ATCCTACACCAGTACCTATGTGG - Intergenic
1061092481 9:128434331-128434353 CTCCCACACCCGCTCCTACAGGG - Intronic
1062376079 9:136262461-136262483 CTCCTGCACCATTTCTTACAGGG - Intergenic
1185765945 X:2726011-2726033 CTCCTGCTCCACTCCCTCCATGG + Intronic
1187050936 X:15695066-15695088 CTCCTGCACCAATCACTCCACGG - Intronic
1188929717 X:36092487-36092509 CAGCTACATCAATCCCTACATGG - Intronic
1189560068 X:42183323-42183345 CTCCTTCCCCACTCCCTCCAGGG + Intergenic
1198025466 X:132701684-132701706 CTCCTACCTCAGTTCCTACCTGG + Intronic
1198717965 X:139582489-139582511 CTCCGACACAGGTCTCTACAAGG + Exonic