ID: 912379724

View in Genome Browser
Species Human (GRCh38)
Location 1:109240793-109240815
Sequence TCTGCCTGTCAGACTCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912379724_912379730 14 Left 912379724 1:109240793-109240815 CCAGGATGAGTCTGACAGGCAGA No data
Right 912379730 1:109240830-109240852 CAGACAAATGTACTGCGTGTCGG No data
912379724_912379732 27 Left 912379724 1:109240793-109240815 CCAGGATGAGTCTGACAGGCAGA No data
Right 912379732 1:109240843-109240865 TGCGTGTCGGAGCCTGTGCCGGG No data
912379724_912379731 26 Left 912379724 1:109240793-109240815 CCAGGATGAGTCTGACAGGCAGA No data
Right 912379731 1:109240842-109240864 CTGCGTGTCGGAGCCTGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912379724 Original CRISPR TCTGCCTGTCAGACTCATCC TGG (reversed) Intergenic
No off target data available for this crispr