ID: 912380751

View in Genome Browser
Species Human (GRCh38)
Location 1:109247038-109247060
Sequence CAGAGCCTCCACTGTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912380745_912380751 -1 Left 912380745 1:109247016-109247038 CCAAGCAGGTTTCCTTCCTTCCC No data
Right 912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG No data
912380744_912380751 11 Left 912380744 1:109247004-109247026 CCGCAAGGCTAGCCAAGCAGGTT No data
Right 912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG No data
912380741_912380751 28 Left 912380741 1:109246987-109247009 CCAGAGCTAAAGGACAGCCGCAA No data
Right 912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912380751 Original CRISPR CAGAGCCTCCACTGTGAAGT GGG Intergenic
No off target data available for this crispr