ID: 912381822

View in Genome Browser
Species Human (GRCh38)
Location 1:109251661-109251683
Sequence CAGGCTATCGACGCTGATGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912381813_912381822 17 Left 912381813 1:109251621-109251643 CCTGGAGAGTGTCCCCTTAGGCT 0: 1
1: 0
2: 0
3: 9
4: 124
Right 912381822 1:109251661-109251683 CAGGCTATCGACGCTGATGCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
912381817_912381822 3 Left 912381817 1:109251635-109251657 CCTTAGGCTACCTGGTTCTCCAT 0: 1
1: 0
2: 2
3: 17
4: 168
Right 912381822 1:109251661-109251683 CAGGCTATCGACGCTGATGCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
912381816_912381822 4 Left 912381816 1:109251634-109251656 CCCTTAGGCTACCTGGTTCTCCA 0: 1
1: 0
2: 0
3: 10
4: 140
Right 912381822 1:109251661-109251683 CAGGCTATCGACGCTGATGCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
912381815_912381822 5 Left 912381815 1:109251633-109251655 CCCCTTAGGCTACCTGGTTCTCC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 912381822 1:109251661-109251683 CAGGCTATCGACGCTGATGCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
912381819_912381822 -7 Left 912381819 1:109251645-109251667 CCTGGTTCTCCATGTCCAGGCTA 0: 1
1: 0
2: 1
3: 16
4: 192
Right 912381822 1:109251661-109251683 CAGGCTATCGACGCTGATGCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
912381811_912381822 29 Left 912381811 1:109251609-109251631 CCAGGCTACTGTCCTGGAGAGTG 0: 1
1: 1
2: 0
3: 178
4: 6507
Right 912381822 1:109251661-109251683 CAGGCTATCGACGCTGATGCTGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912381822 Original CRISPR CAGGCTATCGACGCTGATGC TGG Exonic
903220148 1:21864936-21864958 CAGGCTGACTGCGCTGATGCTGG + Exonic
912381822 1:109251661-109251683 CAGGCTATCGACGCTGATGCTGG + Exonic
924625304 1:245692478-245692500 CAGGGCATCGAGGCTGAGGCAGG + Intronic
1066270809 10:33820815-33820837 CAGGCTCTGGGAGCTGATGCAGG + Intergenic
1074003116 10:109392239-109392261 CAGGGTAAGGACGCTGGTGCTGG + Intergenic
1077444661 11:2585402-2585424 CAGGCCAGCCAAGCTGATGCAGG - Intronic
1077918015 11:6623469-6623491 CATGCAATCGACGGGGATGCTGG - Exonic
1077918738 11:6627385-6627407 CAGGCTCATGACCCTGATGCTGG - Exonic
1083880446 11:65545849-65545871 CAGGCTATGGGGGCTGAGGCTGG - Intronic
1092649671 12:10620168-10620190 GAGGCTCTCCACTCTGATGCCGG + Exonic
1106242659 13:27923144-27923166 CAGGCTGTGGACGCTGGCGCGGG - Intronic
1121018961 14:90567266-90567288 TCGTCTATCGACGCTGAGGCTGG + Intronic
1123016709 14:105379150-105379172 CACACTATCCACACTGATGCAGG - Intronic
1126901466 15:53318939-53318961 CAGGCTGTCTATGCTGCTGCTGG - Intergenic
1128376045 15:67076767-67076789 CAGGCTCAAGACACTGATGCAGG - Intronic
1128693456 15:69743014-69743036 CAGGCTATGGAGGTTGAAGCTGG - Intergenic
1130236010 15:82134149-82134171 CAGGCTGTCCACACAGATGCAGG - Intronic
1146941392 17:36846484-36846506 CAGGCTATCTCCGTTGATGGTGG - Intergenic
1163831165 19:19547811-19547833 CAGCCTATCGAGGGTGAGGCTGG - Intergenic
926088071 2:10032536-10032558 CATGCTATCCACGCGCATGCGGG - Intergenic
931515517 2:63048662-63048684 CGGGCTATGGACGCGGACGCCGG + Intergenic
932766644 2:74474747-74474769 CAGGCTATTGAGGCAGCTGCTGG + Exonic
941648490 2:168067505-168067527 CAGGCTGTATAAGCTGATGCTGG - Intronic
1175673156 20:60923629-60923651 CAGGTGATCAAGGCTGATGCAGG - Intergenic
1175890333 20:62313166-62313188 CTGACTGTCGAAGCTGATGCGGG + Exonic
1178671593 21:34595908-34595930 CAGTCCATCTACGCAGATGCAGG + Intronic
956469182 3:69547696-69547718 CAGGCTATCCACGATGGAGCTGG - Intergenic
956562837 3:70600963-70600985 CAAGCAATAGAAGCTGATGCTGG + Intergenic
961689540 3:128658626-128658648 CAGGCTCTGGAGGCTGAGGCAGG + Intronic
977785505 4:101029165-101029187 GAGGCTATTGAGGCTGATGAAGG - Exonic
989202959 5:38783919-38783941 CAGGCTAGCTATGCTGATACAGG + Intergenic
1007679641 6:43625384-43625406 CAGGATCTCGAAGCTGATGCTGG + Exonic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1018167033 6:161107926-161107948 CCCGGTGTCGACGCTGATGCAGG - Exonic
1036654507 8:10669041-10669063 CATGCTATCAACACTGCTGCAGG - Intronic
1049191877 8:141292814-141292836 CACCCTATCAACGCTGATGAAGG + Intronic
1049420519 8:142514340-142514362 CAGGGTGTCGGCGCAGATGCGGG + Intronic
1052404680 9:28044664-28044686 CATGCTATCAATGCTGGTGCAGG + Intronic
1057761317 9:97876891-97876913 CAGGCTGTTGAGGCTGCTGCTGG - Intergenic
1058814381 9:108669858-108669880 CAAGGTATCAACACTGATGCAGG + Intergenic
1188060080 X:25590440-25590462 CAGGCTATGGCCACTGAGGCAGG - Intergenic