ID: 912382229

View in Genome Browser
Species Human (GRCh38)
Location 1:109253855-109253877
Sequence GCACAGGGCTGCCGCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912382223_912382229 4 Left 912382223 1:109253828-109253850 CCTTTGGCAGAGCTGGGGACCAC No data
Right 912382229 1:109253855-109253877 GCACAGGGCTGCCGCCACCCAGG 0: 1
1: 0
2: 0
3: 25
4: 301
912382218_912382229 21 Left 912382218 1:109253811-109253833 CCTGCAGTCTCACACAGCCTTTG 0: 1
1: 0
2: 3
3: 16
4: 211
Right 912382229 1:109253855-109253877 GCACAGGGCTGCCGCCACCCAGG 0: 1
1: 0
2: 0
3: 25
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912382229 Original CRISPR GCACAGGGCTGCCGCCACCC AGG Intronic
900165008 1:1241049-1241071 GCCCAGGGCTCACGCCAACCAGG + Intergenic
900533225 1:3164958-3164980 GCACAGGCCTCCTGCCACCCTGG + Intronic
900593764 1:3471316-3471338 GCACAGGGCTGCCCCAACAGTGG + Intronic
900819194 1:4873241-4873263 GCCCAGGGCTGCGTCAACCCAGG - Intergenic
900918890 1:5658479-5658501 GCTCAGGGCTCCTGCCTCCCAGG - Intergenic
901228945 1:7631272-7631294 GAACTGGGCTGCTGCCACCCGGG + Intronic
901649874 1:10737344-10737366 GCCCAGGGCTGCCGTCAGCCTGG + Intronic
902203745 1:14852448-14852470 TCACAGAGCTGCTGCCTCCCGGG - Intronic
902795548 1:18798713-18798735 GTACAAGGCTGCCGCCAGCTAGG - Intergenic
903680970 1:25096690-25096712 GCACAGGACAGCCCCCACCACGG + Intergenic
904236570 1:29121124-29121146 GCCCCGGGCTGCCCCCACCCTGG - Exonic
904383296 1:30125600-30125622 TCCCAGGGCTGCCTCCACACTGG + Intergenic
904563476 1:31413614-31413636 CCACAGAGCTGCCCCGACCCCGG - Intronic
904799143 1:33080920-33080942 CTACAGGGCCGCCGCCACGCAGG - Intronic
905745639 1:40415040-40415062 GCACAGGGCAGCAGACGCCCAGG - Intronic
906532816 1:46533203-46533225 GCCCGGCGCGGCCGCCACCCTGG + Intergenic
906613730 1:47221046-47221068 GCACAGGACTCCAGCCAGCCTGG - Intronic
910678498 1:89839359-89839381 GCTCAGGCCTGTAGCCACCCTGG + Intronic
912382229 1:109253855-109253877 GCACAGGGCTGCCGCCACCCAGG + Intronic
912561877 1:110556759-110556781 GCACTGGGCTGCCCACTCCCTGG + Intergenic
915320021 1:155051419-155051441 GCAGAGGGCTGCCCGCGCCCAGG - Exonic
916437803 1:164792835-164792857 GCACAGGGATGCCAGCACCTGGG - Intronic
917447646 1:175120124-175120146 AAACAGGGCTCCAGCCACCCAGG - Intronic
920501778 1:206490213-206490235 TCTTGGGGCTGCCGCCACCCTGG + Intronic
920546324 1:206821766-206821788 GCTCTGGTATGCCGCCACCCTGG + Intronic
1063371592 10:5525920-5525942 GCTGAGGGCTGCAGCCCCCCTGG - Exonic
1063376389 10:5557140-5557162 GCGCAGAGCTTCCGCCACCAAGG - Intergenic
1064209261 10:13348879-13348901 GAACATGGCAGCCGCAACCCTGG + Intergenic
1065868396 10:29934231-29934253 GCACACGGCTGTCGCCCCCGTGG + Intergenic
1067774600 10:49153935-49153957 GCAGATGGCTGCAGCCAGCCAGG - Intergenic
1068910464 10:62374197-62374219 GCCCAGGGCTGCCACCTCCGCGG - Exonic
1069718274 10:70534419-70534441 CGACAGGGCTGCCCCCACGCAGG + Exonic
1071164220 10:82786036-82786058 TCACAGGGATGGTGCCACCCCGG + Intronic
1073291772 10:102416754-102416776 CCACTGGGCAGCCCCCACCCGGG - Exonic
1073467901 10:103704888-103704910 AGAGAGGGCTGCCACCACCCAGG - Intronic
1075082435 10:119393002-119393024 CCACACGGCTGGGGCCACCCTGG - Intronic
1075729106 10:124625788-124625810 ACACACGGCTGAGGCCACCCAGG - Intronic
1075787027 10:125057004-125057026 ACACAGGGCAGCCCCCAGCCGGG + Intronic
1076321627 10:129586808-129586830 GCAGAGGGATGCAGCCACTCTGG - Intronic
1076634445 10:131873230-131873252 GCTCAGTGCTGCCACAACCCGGG - Intergenic
1076791535 10:132779339-132779361 GCCCAGGGCTGCCACCAGCGGGG + Intronic
1077032647 11:476510-476532 CCCCAGTGATGCCGCCACCCAGG - Intronic
1077467890 11:2742282-2742304 GCACAGGGCTTCCCCTGCCCTGG - Intronic
1078591271 11:12642120-12642142 GCACGAGGCTGCCCCCACACAGG + Intergenic
1078987194 11:16607567-16607589 GCTCTGCGCTGCCCCCACCCGGG - Intronic
1079002375 11:16769015-16769037 GACCAGGGCTGCCAGCACCCTGG + Intergenic
1081576044 11:44319157-44319179 GCCCAGGGCGGCCGGCTCCCAGG + Intergenic
1081594341 11:44448848-44448870 GGTCAGGGCTGCCGCCTCCAGGG + Intergenic
1083741308 11:64712941-64712963 GCACCGGGCGGCCGCTCCCCGGG + Intronic
1084223117 11:67697029-67697051 ACACTGGGCGGCCCCCACCCAGG - Intergenic
1084443673 11:69190967-69190989 CCACATGGCTGGCGCCACCCAGG - Intergenic
1084602555 11:70154896-70154918 GCAGAGGGCAGCTGGCACCCGGG - Intronic
1084659043 11:70536428-70536450 CCCCAGGGCTGTCCCCACCCAGG + Intronic
1085294884 11:75425720-75425742 GCCCAGTGCTGCCACCACCTGGG + Intronic
1086959748 11:92969835-92969857 GGACAGCGCTGGAGCCACCCAGG - Exonic
1089173670 11:116533531-116533553 CCTCAGGGCTGCCGGCAACCAGG + Intergenic
1090418690 11:126558486-126558508 GCCCAGGGCTCCAGACACCCAGG - Intronic
1090991181 11:131818226-131818248 TCAGAGGGCTCCCACCACCCAGG + Intronic
1091488976 12:916571-916593 TCACGGGGCTGCCTCCACTCAGG - Intronic
1096260813 12:50089886-50089908 GCACAGGACCGCCACTACCCAGG + Exonic
1098287168 12:68919015-68919037 TCACTGGGCTCCAGCCACCCTGG + Intronic
1100615587 12:96229349-96229371 GCACAGCTCTGCTGACACCCTGG - Intronic
1101706257 12:107223922-107223944 GGACAGGCAGGCCGCCACCCAGG - Intergenic
1101834563 12:108286413-108286435 GCACATGGCTGCCGCATCTCAGG + Intergenic
1102472606 12:113168074-113168096 GCACAGGCCGCCCCCCACCCCGG + Intronic
1102495875 12:113319358-113319380 CTACAGGGCTGCCTCCTCCCAGG - Intronic
1103616134 12:122153718-122153740 GCACAGGACAGCTGTCACCCAGG - Intergenic
1104092578 12:125528022-125528044 GGAGAGGGATGCTGCCACCCAGG + Intronic
1104448644 12:128852900-128852922 GCACAGACCTGCAGCCAACCCGG + Intergenic
1105250843 13:18697703-18697725 TCACAGGGCTGGGCCCACCCTGG + Intergenic
1105885595 13:24638454-24638476 GCCCAGGGCTGCACGCACCCAGG + Intergenic
1108342911 13:49515267-49515289 GCACTGGCCTGTCCCCACCCTGG - Intronic
1108603238 13:52012209-52012231 GCACACGGCTCCCGCCCCCGTGG - Intergenic
1110596504 13:77326487-77326509 GTCCAGCGCTGCCGCCCCCCTGG + Exonic
1110995281 13:82100147-82100169 TCACAGGGCATCCCCCACCCAGG - Intergenic
1111388462 13:87561153-87561175 GGACTGTGCTGCCGCCACCTCGG + Intergenic
1113079788 13:106506677-106506699 ACACAGGTCTGCCTCCAGCCTGG + Intronic
1113664656 13:112132833-112132855 GCACAGAGCTGGCGCCATCCAGG + Intergenic
1113856550 13:113449396-113449418 GAACAGGGCTGCCTCCTTCCGGG - Intronic
1116862114 14:50003293-50003315 GCTCACGGCTGCAGCCGCCCGGG + Intronic
1117314875 14:54565182-54565204 GCGCAGGGCCGCGGCCACACCGG - Intergenic
1118361507 14:65061317-65061339 GCAAAGAGCTGCCGGGACCCAGG - Exonic
1118702202 14:68444592-68444614 CCACAGGGCTGCACCTACCCTGG + Intronic
1119627160 14:76188158-76188180 GAACAGGGCTGCAGCAAACCTGG + Intronic
1119776035 14:77249376-77249398 CCACATGGCTGCCGTCTCCCAGG + Exonic
1120305438 14:82763877-82763899 GTCCAGGGCTGCAACCACCCAGG - Intergenic
1121432149 14:93895169-93895191 GAACATGCCTGCTGCCACCCAGG + Intergenic
1122066171 14:99175671-99175693 GCATAGGGTTGCCGCGGCCCGGG + Exonic
1122094779 14:99362941-99362963 GCACAGGACAGCCACCACCAAGG + Intergenic
1122138482 14:99648060-99648082 GCACAGGGCTGCCTCCTAACAGG - Intronic
1122243569 14:100384661-100384683 GGACTGGGCTGCAGCCAGCCAGG - Intronic
1122814945 14:104307672-104307694 GCAGAGGGCAGCCCCCTCCCCGG - Intergenic
1122938044 14:104968894-104968916 CCACAGGGCTCCCGCCTCCATGG - Intronic
1124218033 15:27825625-27825647 GCACAGGACAGACGCCAACCAGG + Intronic
1125051174 15:35299488-35299510 GCTCCGCGCTGCCGCCACCGCGG - Intronic
1125374422 15:39013513-39013535 GCACAATGCAGCTGCCACCCTGG + Intergenic
1129664463 15:77571879-77571901 GCACAGGCCTCTTGCCACCCTGG + Intergenic
1129678624 15:77645627-77645649 ACACAGGGCTGCTGCCTCCGTGG + Intronic
1129897902 15:79122244-79122266 GCACAGGGCTGTCTCGACCAGGG + Intergenic
1131277418 15:90994084-90994106 GCCCGGGGCGGCCTCCACCCAGG - Intronic
1131438001 15:92438298-92438320 GCAAAGGGCAGCTGGCACCCTGG + Intronic
1132320015 15:100919090-100919112 GCACCCGGCTGCCTCCACGCGGG - Intergenic
1132414364 15:101610098-101610120 GCACAGTGATGCCACCTCCCAGG + Intergenic
1132804669 16:1769913-1769935 GCAGAGGGCAGACGCCACCCTGG + Exonic
1132814359 16:1818710-1818732 CCACAGGTCTGCAACCACCCTGG + Intronic
1132814960 16:1821322-1821344 GCACAGCGCTCCCACCACCAAGG + Intronic
1132829279 16:1919517-1919539 CCACAGGGCTGGCGCCAGGCAGG + Intergenic
1133127403 16:3655801-3655823 GAGCAGGGCTGGTGCCACCCAGG - Intronic
1135061940 16:19278547-19278569 CCACTTGGCTGCTGCCACCCCGG + Intergenic
1136413616 16:30091075-30091097 GCGGAGGGCTACCGCTACCCCGG - Exonic
1139970129 16:70769190-70769212 GCACAGGACTGCCACCACCATGG + Intronic
1140214144 16:72993924-72993946 GCACTCGGCTGCTGCTACCCTGG - Intronic
1142032560 16:87845813-87845835 GCACAGGGCTGTGGCTGCCCTGG + Intronic
1142184929 16:88690322-88690344 GCACAGGGCTGCCAGCCACCTGG - Intergenic
1142243110 16:88956052-88956074 GCCCAGGGCTGCCAACCCCCAGG + Intronic
1142471139 17:164021-164043 GGACTGGGCTGCGGGCACCCAGG - Intronic
1142727965 17:1830158-1830180 GCTCGGGGCCGCAGCCACCCCGG - Intronic
1143150798 17:4806969-4806991 GCACAGGGCGGCCCCCTGCCCGG + Intergenic
1143370427 17:6435781-6435803 GCAAAGGGCAGCTGTCACCCCGG - Intergenic
1143443867 17:6996039-6996061 GCCCAGGGCTGCCGGCGCCTCGG - Intronic
1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG + Intronic
1144887973 17:18476913-18476935 GCACAGGGCTGCCTCAGCCAGGG + Intronic
1145144235 17:20467390-20467412 GCACAGGGCTGCCTCAGCCAGGG - Intronic
1145175686 17:20698790-20698812 GCACAGGGCTGCCTCAGCCAGGG - Intergenic
1146577358 17:34006336-34006358 ACTCTGGGCTGCAGCCACCCTGG - Intronic
1146660395 17:34661655-34661677 GCACTGGGCAGCCCCTACCCAGG - Intergenic
1147057689 17:37846799-37846821 GGACCGAGCTGCCGCCACCCTGG - Intergenic
1147359447 17:39921879-39921901 GGCCAGGGCTGCTGCCATCCTGG - Intronic
1147360732 17:39927988-39928010 GCACCTGGCTGCCTCCGCCCTGG + Intergenic
1148106216 17:45120414-45120436 GCACCGGGCTGACTCCAACCAGG - Exonic
1148489171 17:48012304-48012326 GCACAGGGCTGCTGGGAGCCAGG - Intergenic
1148553548 17:48564545-48564567 GCGCAGGGCTGCGGGAACCCCGG + Intronic
1149997033 17:61410965-61410987 GTACAGGGCTGCGGACACCAGGG + Intergenic
1151883827 17:76911663-76911685 TCACAGTTCTGCCTCCACCCTGG - Intronic
1152280574 17:79382786-79382808 GAACAGGGCTCCTGCCATCCTGG + Intronic
1152283423 17:79398622-79398644 GTACAGGGCGGCCTCCACCGTGG + Intronic
1152867406 17:82732441-82732463 CTACAGAGCTGGCGCCACCCAGG - Intergenic
1153227555 18:2909917-2909939 GCTCAGGGAGGACGCCACCCTGG + Intronic
1154175672 18:12086380-12086402 CCATAGGCCTGCCCCCACCCTGG - Intergenic
1154438006 18:14361223-14361245 TCACAGGGCTGGGCCCACCCTGG - Intergenic
1155403989 18:25467745-25467767 GCACAGGGCTCCAGCAGCCCAGG - Intergenic
1156448451 18:37253591-37253613 GCGCAGAGCTGCCGTCACCCCGG - Intronic
1157566590 18:48682794-48682816 GCCCAGGGCTGTCGGGACCCAGG - Intronic
1158962298 18:62596872-62596894 GCAGAGGACAGCGGCCACCCGGG - Intergenic
1159935999 18:74368061-74368083 CCACATGGCTCCTGCCACCCAGG - Intergenic
1161041431 19:2112771-2112793 GGACACAGCTTCCGCCACCCAGG - Intronic
1161059752 19:2209076-2209098 GCACAGCCCTGCCGCCCCTCGGG + Intronic
1161087988 19:2343928-2343950 GCTGAGGGCGGCCCCCACCCCGG - Intronic
1161900153 19:7112482-7112504 GCACAGGGCCGAGGCCACCCAGG + Intronic
1162584816 19:11552252-11552274 GCACAGGTCACCTGCCACCCGGG + Intronic
1164157013 19:22603108-22603130 GCTCAGGGCTGCCGACAAGCAGG + Intergenic
1164532275 19:29057573-29057595 TCTCAGGGCTGCCCACACCCAGG - Intergenic
1164691281 19:30212629-30212651 GCACAGAGCTGCCACCTCACAGG - Intergenic
1165089092 19:33373475-33373497 GCACTAGGCCGCCGCCAGCCCGG + Exonic
1165176008 19:33930344-33930366 CCCCAAGGCTGCAGCCACCCTGG - Intergenic
1165435486 19:35792645-35792667 GCACGGGGGTGCTGCCATCCAGG + Intergenic
1165999540 19:39870254-39870276 GGACAGGGATGCAGACACCCTGG + Exonic
1166428166 19:42698119-42698141 GCACAGTGCGGCGGCCGCCCAGG + Intronic
1166641924 19:44500679-44500701 GCACAGGTGTGGCGCCCCCCCGG - Intergenic
1166894698 19:46016180-46016202 GCGCAGGGCGGCCCCGACCCCGG - Exonic
1167265123 19:48479253-48479275 GCCCAGGGGTCCGGCCACCCAGG - Exonic
1167503635 19:49860523-49860545 GCAGAGGCCTGGCCCCACCCAGG - Exonic
925186751 2:1852176-1852198 GGCCAGGGCTGCGGCCAGCCTGG + Intronic
925614890 2:5735425-5735447 GCACAGTGATGGAGCCACCCAGG - Intergenic
925714220 2:6770224-6770246 GCACAGTCCAGCCGCCTCCCAGG + Intergenic
925867858 2:8244685-8244707 GCACAGGGATGGCTCCTCCCTGG + Intergenic
925999781 2:9321430-9321452 GCCCAGGGAGGCCCCCACCCAGG + Intronic
926130832 2:10302539-10302561 GCGCAGGGCTGGCCCCTCCCGGG + Intergenic
928373832 2:30759404-30759426 GCTGAGGGCTGCCGGCTCCCGGG - Intronic
932293758 2:70607427-70607449 GAACAGGGCTGACGTCAGCCTGG + Intergenic
935341602 2:102064147-102064169 ACACAGCGGTGCCCCCACCCTGG - Intergenic
937312613 2:120911373-120911395 GCACAGGGCTTCCTTCACACTGG - Intronic
938103542 2:128514195-128514217 GCACAGGGCACCCCACACCCAGG + Intergenic
938169296 2:129060619-129060641 GCACAGGGCACACGCCACCATGG + Intergenic
938386862 2:130872863-130872885 GCTCAGGGCTGGCTCCACACAGG - Intronic
946378962 2:219331775-219331797 GCCCAGCGCCGCCGCCACGCTGG - Intronic
947374559 2:229482513-229482535 CCACCGTGCTGCAGCCACCCAGG + Intronic
947506747 2:230713330-230713352 GGCCGGGGCCGCCGCCACCCAGG - Intronic
947909029 2:233789697-233789719 GCACAGGGCTGTGGGCATCCTGG - Intronic
948399045 2:237669713-237669735 CCACAGTGATGCCTCCACCCCGG + Intronic
948920453 2:241063814-241063836 CCCCAGGGCTGCGGCCACCTTGG + Intronic
949017840 2:241723491-241723513 GCAGAGGGATGCCGTCACCCAGG + Intronic
949026377 2:241768221-241768243 GGGCAAAGCTGCCGCCACCCCGG - Exonic
1169278352 20:4248306-4248328 GCGCAAGGCGGCCGCCATCCTGG - Exonic
1171446336 20:25207207-25207229 GCACCGGGCCACCGCCACCCAGG + Exonic
1173461222 20:43244881-43244903 GGACAGGGCTGCAGCAAGCCTGG - Intergenic
1173789992 20:45822371-45822393 TCACAGGGCTGCAGCCACACTGG - Intergenic
1173985814 20:47260419-47260441 TCACTGGGATGCAGCCACCCTGG + Intronic
1174065363 20:47860730-47860752 GCCCAGGGCTGGAGGCACCCAGG - Intergenic
1174728468 20:52890049-52890071 GCACATGGCTGCCCCCTTCCTGG - Intergenic
1175082950 20:56436743-56436765 ACACATGCGTGCCGCCACCCCGG - Intronic
1175246120 20:57583104-57583126 GCACAGAGCAGCCCCCACACTGG - Intergenic
1175703475 20:61157622-61157644 GGACAGAGCTGGGGCCACCCTGG - Intergenic
1175744232 20:61442889-61442911 GCACAAGGCAGCCCCCACCATGG - Intronic
1175824135 20:61927561-61927583 GCTCAGGGCTTCCAGCACCCTGG + Intronic
1176234280 20:64047115-64047137 CCACAGCGCTCCCCCCACCCGGG - Intronic
1176457672 21:6928246-6928268 TCACAGGGCTGGGCCCACCCTGG + Intergenic
1176835844 21:13793330-13793352 TCACAGGGCTGGGCCCACCCTGG + Intergenic
1178189655 21:30265788-30265810 GCTAAGGGCTGCCACGACCCAGG + Intergenic
1179886362 21:44315878-44315900 GCACAGGGCTGCAGCTCCACGGG - Intronic
1179982823 21:44905432-44905454 GCACAAGGATGCCCCCACTCAGG + Intronic
1180594821 22:16966229-16966251 CCACAGGGATGCAGACACCCTGG + Exonic
1180970627 22:19813177-19813199 GCACAGGTCAGCGGGCACCCAGG + Intronic
1181044875 22:20209760-20209782 GGTCAGGGCTGCCACCTCCCTGG - Intergenic
1183540516 22:38426927-38426949 GCCCAGGCCTGCGGCCACCGCGG + Exonic
1183771790 22:39932995-39933017 GCTCAGTGCTGCCGCCATCTGGG - Intronic
1184132331 22:42524316-42524338 GCACAGCCCTGCCGACACCTTGG + Intergenic
1184533297 22:45070544-45070566 GCAGAGGGCTGGAGACACCCAGG + Intergenic
1184862051 22:47177707-47177729 GCACAGGATGGCCTCCACCCAGG + Intergenic
1185028264 22:48427803-48427825 GCCGAGGGCTCCCGGCACCCTGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949891183 3:8734545-8734567 GGACAGGGCAGACGGCACCCGGG + Intronic
952863466 3:37834040-37834062 GCACAGTGCTGCCTTCACCTTGG - Intergenic
952919610 3:38275700-38275722 CCACAGGGCTGCAGCCTCCCTGG + Intronic
954292028 3:49654842-49654864 ACACAGGGCTACCCCCACCCTGG - Exonic
954394583 3:50286756-50286778 ACACAGGGCTGCAGCCAGCCTGG - Exonic
954701970 3:52455348-52455370 GCCCAGAGCTGTCACCACCCGGG + Intronic
961505851 3:127370096-127370118 GAACAAGGCTGTCACCACCCTGG - Intergenic
961594615 3:128006650-128006672 GAACAGGGCTGCGGCCCCTCAGG + Intergenic
962847243 3:139283469-139283491 GCCCGGGGCTGCAGCCACCTGGG + Intronic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
964657356 3:159082605-159082627 GCACAGTGCTTCAGCCACACAGG - Intronic
969645713 4:8427727-8427749 GGACCGGCCTGCCACCACCCTGG + Intronic
971703625 4:30012393-30012415 GCACATGGCTGCCACCACTGGGG - Intergenic
972671038 4:41214315-41214337 GCACGCTGCTGCCGCTACCCGGG + Intronic
974744734 4:66057312-66057334 GGACAGGGCTGCCTCCACTTCGG - Intergenic
975696035 4:77013978-77014000 GCACAGGGCTGGGGGCAGCCGGG + Intronic
978576667 4:110196608-110196630 GCACAGGGCTGGTGCCCTCCCGG - Intronic
982083159 4:151809619-151809641 GCACAGTGCTGCTGCCATCATGG - Intergenic
982122779 4:152158475-152158497 GCTCTGGGCTGCAGCCACCCTGG - Intergenic
985579649 5:689939-689961 ACCCAGGGCAGCCCCCACCCAGG - Intronic
985594495 5:781998-782020 ACCCAGGGCAGCCCCCACCCAGG - Intergenic
985635500 5:1033843-1033865 GCACAGGGCTTCCGTTTCCCGGG + Intronic
985802412 5:2013375-2013397 GCTCAGGGCTCCCACCCCCCAGG - Intergenic
986241264 5:5961824-5961846 GCACAGTCCTGCCGACACCTCGG - Intergenic
986291986 5:6407458-6407480 GCTCAGGGCTGGCGACACCGTGG - Intergenic
986423064 5:7603341-7603363 CTACAGGGCTTCTGCCACCCAGG + Intronic
990561383 5:56986796-56986818 GCACATGGCTGACAGCACCCAGG + Intergenic
992865719 5:80955306-80955328 GCACAGAGCTGTAGCCATCCAGG + Intergenic
993716558 5:91280653-91280675 GCCCCGGGCTGCGGCCGCCCAGG - Intergenic
994148719 5:96423430-96423452 GGGCAGGGCTGCCGTCATCCTGG + Exonic
997152212 5:131510090-131510112 ACACAGGGCTGCAGCCATCCAGG - Intronic
998456405 5:142277180-142277202 GCTCATGGCTGCCACTACCCAGG - Intergenic
1001923340 5:175617686-175617708 CCACAGGGCAGGCCCCACCCGGG + Intergenic
1002091672 5:176810152-176810174 GCCCGGGGCTGCGGCGACCCCGG - Intergenic
1002169525 5:177367347-177367369 GCGCTGGGCTGCCTGCACCCAGG - Intronic
1002258519 5:177977995-177978017 GCCCAGGGCGGCCGCCCCCAGGG + Intergenic
1002419359 5:179137658-179137680 GGGCAAGGCTGCCGCGACCCTGG - Intronic
1002501349 5:179649551-179649573 GCCCAGGGCAGCCGCCCCCAGGG - Intergenic
1002540445 5:179902994-179903016 GCACAGGGCGGGCGGCACCCCGG - Intronic
1002567594 5:180120446-180120468 GCCCAGCGCTGCCTCCAGCCTGG + Intronic
1002791981 6:443759-443781 ACCCAGGACTGCCTCCACCCAGG + Intergenic
1003869657 6:10391395-10391417 GCACCGCGCTGCCTCCTCCCAGG + Intergenic
1004213261 6:13674597-13674619 GCTGAGGGCAGCCACCACCCAGG + Intronic
1007238947 6:40411402-40411424 GCCCAGGGCTGCTTCCACGCTGG - Intronic
1007496451 6:42263212-42263234 GCAAAGGGATGTCCCCACCCAGG + Intronic
1008090459 6:47288916-47288938 GCATGGGCCTGCAGCCACCCAGG + Intronic
1014561654 6:122898460-122898482 GCTCAAGGCTGCTGGCACCCTGG - Intergenic
1015181485 6:130366173-130366195 ACAGAGGGCCGCCGCCATCCGGG - Intronic
1016453574 6:144209233-144209255 GCACAGGGAGGCAGGCACCCTGG - Intergenic
1017112037 6:150941259-150941281 CCACGGGGCTCCAGCCACCCTGG - Intronic
1017889854 6:158629069-158629091 GCGCAGGGCTGTTGCCTCCCGGG + Intronic
1018235723 6:161721731-161721753 TCAGAGGGCTGCTGCCTCCCTGG + Intronic
1018643828 6:165929791-165929813 GCTCAGAGCTGCTGTCACCCAGG + Intronic
1019145414 6:169972576-169972598 GGAAAGGGCTGCCTCCACCCTGG + Intergenic
1019389307 7:776770-776792 GGACAGGGCCCCCGCCACCCAGG + Intronic
1019443907 7:1061082-1061104 GCACTGGGCTGCCTCTGCCCGGG + Intronic
1019501463 7:1366936-1366958 ACGCAGGGCTGCCGTCAGCCAGG + Intergenic
1020462862 7:8443510-8443532 GAACACGGCTGGAGCCACCCAGG + Intronic
1021444674 7:20719628-20719650 GCACGGGGCTGCCACCACACTGG - Intronic
1021538270 7:21728963-21728985 GGACAGGGCTGCTGCCCCCAAGG - Intronic
1021637923 7:22709572-22709594 TCCCAGGCCTGCCCCCACCCGGG + Intergenic
1021668659 7:23013635-23013657 GCACAAAGCTGCCGCCCTCCAGG + Intronic
1022113790 7:27246284-27246306 GCCCCGGGCTGCCGCCGCCTCGG + Exonic
1022559754 7:31336274-31336296 GCGCAAGGCAGCCGCCACCGAGG - Intergenic
1024835671 7:53515114-53515136 GCACATGCCAGCCGTCACCCAGG - Intergenic
1026911135 7:74092653-74092675 CCCCAGGGCTGCCGCATCCCTGG + Intronic
1029551335 7:101238595-101238617 TCACAGGGCTGAGGCCACCAGGG + Exonic
1031413334 7:121466471-121466493 GCACAGGCCTGCTGACACCTTGG - Intergenic
1032526086 7:132578979-132579001 GCCCTGGGCTTCCTCCACCCTGG - Intronic
1034275648 7:149822713-149822735 GCGCAGGGCAGCAGCCACCAAGG + Intergenic
1034302390 7:150028246-150028268 GCACAGGGCTCCAGCCCCCGTGG - Intergenic
1034347130 7:150393551-150393573 GCAAAGTGCTGCCACCACTCTGG - Intronic
1034514299 7:151562284-151562306 GCACAGAGCTGCCGTGGCCCAGG - Intronic
1034803671 7:154069072-154069094 GCACAGGGCTCCAGCCCCCGTGG + Intronic
1034937533 7:155209675-155209697 GCACAGGGCCGACGCCAACACGG - Intergenic
1035327610 7:158075145-158075167 GCTCAGGGCTGGCAGCACCCAGG - Intronic
1035388274 7:158488961-158488983 TCCCAGGGCAGACGCCACCCGGG - Intronic
1035892395 8:3359179-3359201 ACACACGGCGGCCCCCACCCAGG + Exonic
1036692531 8:10952781-10952803 GCACAGGGCTCCCAACCCCCGGG + Intronic
1037760688 8:21739643-21739665 GAGCAGGGCTGCCTCCCCCCTGG + Intronic
1037858049 8:22385595-22385617 TCACTGGGCTCCAGCCACCCAGG - Intronic
1037993511 8:23337243-23337265 CCACGGGGCCCCCGCCACCCTGG + Intronic
1038258167 8:25970161-25970183 GCAGAGGGCTGCAGCCAGGCAGG + Intronic
1045847885 8:106658320-106658342 GCCCCCGGCGGCCGCCACCCCGG - Intronic
1047570389 8:126092233-126092255 GAACAGAACTGCAGCCACCCAGG + Intergenic
1049208002 8:141372282-141372304 CCACTGGGCTCCCACCACCCCGG + Intergenic
1049241818 8:141541662-141541684 GCACCTGGCTGGCCCCACCCAGG - Intergenic
1049545050 8:143226662-143226684 GCACAGGGCTGCCTCTCCCAGGG + Intergenic
1049563519 8:143325296-143325318 GCACTGGACCCCCGCCACCCGGG - Intronic
1049866973 8:144945699-144945721 GGAGAGGGCTGCCACCAGCCTGG + Intronic
1050204410 9:3181729-3181751 GCTCAGGGCTGCCGCCCCGCTGG - Intergenic
1051482463 9:17575395-17575417 GCACAGAGCTGCTGCATCCCTGG - Intergenic
1051855347 9:21559366-21559388 GCACACGGCAGTCGACACCCGGG - Intergenic
1058995166 9:110292334-110292356 GGGCAAAGCTGCCGCCACCCCGG + Intergenic
1059409532 9:114123481-114123503 GTCCTGGGCTGCCACCACCCTGG + Intergenic
1060110652 9:120904282-120904304 CCACAGGGCACCTGCCACCCTGG - Exonic
1060297201 9:122350853-122350875 GAACAGGGCAACCCCCACCCAGG - Intergenic
1061809143 9:133152325-133152347 TCACAGGGCTGCAGTGACCCTGG + Intergenic
1061898160 9:133659168-133659190 GCACAGCCCTGACTCCACCCCGG - Exonic
1062037426 9:134389007-134389029 ACACAGGCCTGAGGCCACCCTGG - Intronic
1062207385 9:135344715-135344737 CCACAGCCCTGCAGCCACCCTGG - Intronic
1062378309 9:136274882-136274904 GCACAGGGATGGCCACACCCAGG - Intergenic
1062444068 9:136586026-136586048 GGACTGGGCATCCGCCACCCTGG - Intergenic
1062490568 9:136803138-136803160 GCCCAGGGCTGGGGCCCCCCAGG + Intronic
1062490619 9:136803273-136803295 GCCCAGGGCTGGGGCCCCCCAGG + Intronic
1062497953 9:136840475-136840497 GCCCCGGGCGGCCGCCACCCTGG + Exonic
1062621772 9:137426064-137426086 GGGCAGGGCTGTCGCCACTCAGG - Intronic
1185474065 X:403239-403261 GCACAGGGGAGCGGCCACGCAGG + Intergenic
1185727235 X:2431812-2431834 GCACAAGGATCCCGTCACCCAGG - Intronic
1187367303 X:18675648-18675670 GGCCAGGGCCGCTGCCACCCTGG - Intergenic
1192189768 X:68983712-68983734 GCACAGGGCTGGGGCTGCCCTGG - Intergenic
1193308491 X:79977025-79977047 GCATATGGATCCCGCCACCCAGG - Intergenic
1195151142 X:102071662-102071684 GCACAGGGCTGCCAAGCCCCAGG + Intergenic
1197911930 X:131492297-131492319 GCACAGGGGTGCCGTTGCCCCGG + Intergenic
1198714089 X:139537834-139537856 ACACTGGGCTCCAGCCACCCTGG + Intronic
1199848589 X:151709239-151709261 GCACATGGCTGGCCCAACCCTGG - Intergenic