ID: 912383897

View in Genome Browser
Species Human (GRCh38)
Location 1:109261851-109261873
Sequence CAGTGATGGCCAGTGGCATA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 213}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912383886_912383897 11 Left 912383886 1:109261817-109261839 CCACCACGGTGTCCCCATTCGTG 0: 1
1: 0
2: 0
3: 6
4: 75
Right 912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG 0: 1
1: 0
2: 2
3: 11
4: 213
912383887_912383897 8 Left 912383887 1:109261820-109261842 CCACGGTGTCCCCATTCGTGCCC 0: 1
1: 0
2: 0
3: 14
4: 110
Right 912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG 0: 1
1: 0
2: 2
3: 11
4: 213
912383892_912383897 -3 Left 912383892 1:109261831-109261853 CCATTCGTGCCCGGAGGAGTCAG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG 0: 1
1: 0
2: 2
3: 11
4: 213
912383883_912383897 25 Left 912383883 1:109261803-109261825 CCCAGGGGAGTCAACCACCACGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG 0: 1
1: 0
2: 2
3: 11
4: 213
912383890_912383897 -1 Left 912383890 1:109261829-109261851 CCCCATTCGTGCCCGGAGGAGTC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG 0: 1
1: 0
2: 2
3: 11
4: 213
912383882_912383897 26 Left 912383882 1:109261802-109261824 CCCCAGGGGAGTCAACCACCACG 0: 1
1: 0
2: 0
3: 12
4: 558
Right 912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG 0: 1
1: 0
2: 2
3: 11
4: 213
912383891_912383897 -2 Left 912383891 1:109261830-109261852 CCCATTCGTGCCCGGAGGAGTCA 0: 1
1: 0
2: 0
3: 1
4: 28
Right 912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG 0: 1
1: 0
2: 2
3: 11
4: 213
912383885_912383897 24 Left 912383885 1:109261804-109261826 CCAGGGGAGTCAACCACCACGGT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG 0: 1
1: 0
2: 2
3: 11
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912383897 Original CRISPR CAGTGATGGCCAGTGGCATA CGG Exonic
900295447 1:1946894-1946916 CAGTGAGGGCCAGTGGGTTGGGG + Intronic
901360356 1:8693565-8693587 CAGTGGTGGCCAGGGGCTTGGGG + Intronic
902703499 1:18189111-18189133 CAGAGATGGGCAGTGGCAGCAGG + Intronic
903672922 1:25047055-25047077 CAGAGCTGGTCAGTGGCACATGG - Intergenic
904728275 1:32567146-32567168 CAGTGATGGCAAAAGGCACAGGG + Intronic
905662449 1:39737873-39737895 CAGTGGTGGGCACTGGCATTAGG + Intronic
906035739 1:42749322-42749344 CAGTGATGGCCATTGGTACGTGG - Intronic
906237515 1:44220956-44220978 CAGTGACGGCCAGTCACACATGG + Intergenic
906389143 1:45398782-45398804 AAGTTCTGGCCAGTGGTATATGG + Intronic
911282146 1:95942878-95942900 AAGTGATGGCAAATGGCAAAGGG - Intergenic
912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG + Exonic
912417982 1:109523307-109523329 GAGTTCTGGCCAGTGGAATATGG - Intergenic
914673355 1:149888683-149888705 TAGAGATGGGCAGTGGCATGGGG - Intronic
916209817 1:162351388-162351410 CAGTGCTGTTCAGTGTCATAGGG - Intronic
917595620 1:176526354-176526376 GAGTTGTGGCCAGTGGAATATGG + Intronic
919686195 1:200485811-200485833 TAGTGATGGCCAGAGGCTGAGGG + Intergenic
921722333 1:218487121-218487143 CAGTGATGGCTGATGGCATCAGG - Intergenic
922039118 1:221878663-221878685 CAGGGATGGCTATTGGTATAGGG + Intergenic
923854860 1:237835385-237835407 CAGTGATGACCGGGGGCATTTGG - Intergenic
1064369683 10:14740430-14740452 CAGTGGTGGCCATTGGGGTACGG + Intronic
1066214205 10:33270101-33270123 AAGTGTTGGCCAGTGTTATAAGG - Intronic
1066549842 10:36544418-36544440 CAGTGTTGGCCAGTGGAATGTGG + Intergenic
1067556881 10:47278882-47278904 CTGTCATGGGCAGAGGCATAGGG - Intergenic
1067799283 10:49347932-49347954 CAGTGAGGGCCTGTGGCCAAAGG - Intergenic
1069722342 10:70557721-70557743 CAAAGATGGCCAGTGGCTGAAGG - Intronic
1069775752 10:70926246-70926268 CGATGGGGGCCAGTGGCATAGGG - Intergenic
1069874869 10:71555622-71555644 CAGTGATGGCAGGTGGCACTGGG + Intronic
1070645096 10:78196292-78196314 CAGTGATGTCCAGCAGCATCAGG + Intergenic
1071073114 10:81717878-81717900 TAGTGATTGCCAGAGGCTTATGG + Intergenic
1074413024 10:113244024-113244046 CAGTGCTGGCCAGAGGCCTGGGG - Intergenic
1076134594 10:128036668-128036690 CAGTGGTGGTCAGTGGGATGTGG - Intronic
1077325349 11:1961471-1961493 CAGTCATAGCCAGGGGCAGAAGG - Intronic
1080504689 11:32900965-32900987 CAGTGATGGTTAGTGGTATCGGG - Intronic
1081050472 11:38333652-38333674 GAGTGTTGGCCAGTGCCATAAGG - Intergenic
1081127926 11:39342493-39342515 CAGGGATGGCCAAAGGCATATGG + Intergenic
1083241127 11:61389756-61389778 CAGTCCTGGCCAGTGCAATAAGG + Intergenic
1085181864 11:74543050-74543072 CAGGGGTGGCCAAAGGCATATGG - Intronic
1085303474 11:75472271-75472293 CAGGAATGCCCAGTGGCATCTGG + Intronic
1085318697 11:75561718-75561740 CAGCGATGGCCAGAGGGAGAGGG - Intergenic
1087166487 11:95009593-95009615 CAGTGATTGCCAGGGGCACTGGG - Intergenic
1088228671 11:107650222-107650244 CAGAGATGGATACTGGCATAAGG - Intronic
1088397595 11:109385616-109385638 CAGTGGTTGCCAGTGGCTAATGG - Intergenic
1088805464 11:113348135-113348157 TAGAGATGTCCAGTGGCAGAAGG - Intronic
1089093908 11:115902149-115902171 CGGTGATGGTCATTGACATAGGG - Intergenic
1091213588 11:133885446-133885468 CAGTGAGGGACAGTGGTATCTGG - Intergenic
1202808330 11_KI270721v1_random:16650-16672 CAGTCATAGCCAGGGGCAGAAGG - Intergenic
1091800182 12:3320176-3320198 CATTGCTGGCGAGTGGCATGTGG - Intergenic
1094850894 12:34381911-34381933 CAGGGATGCCCAGGGTCATATGG + Intergenic
1095188986 12:39234194-39234216 CAGTGATGGCCTGTGGAAGGAGG - Intergenic
1095982212 12:47980083-47980105 CAGTGAGGCCCAGTGGCCCAAGG + Intronic
1099848043 12:88054771-88054793 GAGTGATGGCAAGTAGTATAGGG + Intronic
1101122195 12:101593841-101593863 CAGTGTTTGCCAGTGGCCTAAGG - Intronic
1105219083 13:18308955-18308977 CAGTGTTTGCCAGTGTCAAAGGG - Intergenic
1105294713 13:19077731-19077753 CAGAGATGGCCACTGGAATCGGG - Intergenic
1105608540 13:21947477-21947499 CAGTGATGACCAGGGTCATTTGG + Intergenic
1106134397 13:26963131-26963153 GTTTGATGGCCAGTGACATAGGG + Intergenic
1107114443 13:36731652-36731674 GAGTCATGCCCAGTGGAATATGG - Intergenic
1107157008 13:37179565-37179587 CAGTGTTTGCCAGGGGCAGATGG - Intergenic
1108177349 13:47806674-47806696 CAGTGATTGCCAGGGGCTTAAGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108703177 13:52960854-52960876 CAGTGGTTGCCAGGGGCTTAGGG - Intergenic
1110132052 13:72021491-72021513 CAGGGGTGGCCAAAGGCATATGG - Intergenic
1110440103 13:75518144-75518166 CAGTGGTTGCCAGGGGCTTATGG + Intergenic
1115776198 14:36717922-36717944 CAGTGGCGACCAGTGGGATAGGG + Intronic
1121005920 14:90490687-90490709 CAGTGAAGGCGAGGGGCAGATGG - Intergenic
1122198559 14:100108121-100108143 CATTGATGCCCAGTGGCCCAGGG + Intronic
1122648323 14:103209697-103209719 CAGGGATGGCCAGAGCCACATGG + Intergenic
1122693147 14:103540997-103541019 CAGTGCTGGCCACTGGCCTGGGG - Intergenic
1124406944 15:29401504-29401526 CAGTGATGGCAAAGGGCAGAGGG + Intronic
1127627766 15:60797115-60797137 TAGTGGTTGCCAGTGGCAGAAGG + Intronic
1129290488 15:74563196-74563218 TAGAGGTGGCCGGTGGCATAGGG + Intronic
1132094382 15:98971011-98971033 AAGTGATGGCCAGAGGCAGTGGG - Intronic
1135279466 16:21141398-21141420 CAGTGATGGGCAATGGCCTTGGG + Intronic
1140709207 16:77660879-77660901 CAGTGATTGCCAGGGGCTGAGGG + Intergenic
1141458839 16:84164169-84164191 CAGTGAGGGCGGGTGGTATATGG - Intronic
1146068951 17:29661214-29661236 CAGAGAAGGCCAATGGAATAAGG - Intronic
1147215943 17:38899036-38899058 CCCTGATGGTCAGTGGCATCTGG + Intronic
1151443165 17:74146804-74146826 CAGTGCTTGCCAGTGGCTCATGG - Intergenic
1151478338 17:74356017-74356039 GTGTGAAGGCCAGTGGGATAGGG - Intergenic
1152035130 17:77867654-77867676 CAGGGCTGGCCAGAGGCAGAGGG - Intergenic
1152523488 17:80873976-80873998 AAGGGATGGGCAGTGGAATAAGG + Intronic
1152875385 17:82783611-82783633 CAGTGAAGGCCAGACGCAAAAGG - Intronic
1153147456 18:2050039-2050061 CAGTGATGGCCTCTGACCTAAGG + Intergenic
1153617816 18:6950781-6950803 CAGTGATGGCAAGTGGCACACGG - Exonic
1156504951 18:37584457-37584479 CAGTAATGGCGGGTGGCAGAGGG + Intergenic
1163263710 19:16206076-16206098 CAGGGATGGCAGGTGGCACAGGG - Intronic
1163549864 19:17960192-17960214 CATTGGAGGCCAGTGGCATGAGG - Intronic
1163827968 19:19534183-19534205 CAGAGATGGCCAGAGACAGATGG + Intronic
1165881516 19:39047339-39047361 CAGTGATGGGCTCTGGCATTAGG + Intergenic
1167884319 19:52487919-52487941 CAGGGATGGCCCGTGGCATCTGG + Intronic
925476593 2:4223666-4223688 CAGCAATGGCCTGTGGCAAAAGG - Intergenic
927723531 2:25403415-25403437 CAGTGAAGACTAGTGGGATACGG - Intronic
928918377 2:36499556-36499578 CCTTGATGGCCAGTTGCATCAGG + Intronic
932215886 2:69965748-69965770 CAGTCATGGCCAAGGGCACACGG + Intergenic
933799660 2:85950603-85950625 GAGTAAAGGCCAGTGGCAGAGGG - Intergenic
934184974 2:89663558-89663580 CAGTGTTTGCCAGTGTCAAAGGG + Intergenic
934295242 2:91737681-91737703 CAGTGTTTGCCAGTGTCAAAGGG + Intergenic
937978079 2:127593563-127593585 CAGTGATGCCCAGGGTCATCTGG - Exonic
939069696 2:137524328-137524350 CAGTGATTTCCAGTGGCCCATGG - Intronic
939189281 2:138897307-138897329 CAGGGGTGGCCATAGGCATAGGG + Intergenic
939521897 2:143241854-143241876 AAGTGATGGGCAGTGGTACAGGG + Intronic
940370496 2:152895807-152895829 CAGTGAAGGACTGTGCCATAAGG + Intergenic
940527360 2:154833707-154833729 CAGTGATTGCCAGGGGTTTAGGG - Intronic
941636464 2:167940367-167940389 CAGTGTTGGGCAGTGACATCTGG + Intergenic
942114742 2:172717096-172717118 CAGGGTTGGCCAATGGAATATGG + Intergenic
942916910 2:181320988-181321010 AAGTGATGGTCAGTGGGACAAGG + Intergenic
943336631 2:186623108-186623130 GAGGAATGGACAGTGGCATAGGG - Intronic
946345995 2:219110842-219110864 CTGTGATGAACAGTAGCATATGG - Intronic
946413149 2:219525778-219525800 CAGAGAGGGCCAGTGGAATGGGG - Intronic
946782618 2:223206313-223206335 CAGTGATGGCCAGTTCCAGGTGG - Intergenic
948267201 2:236643629-236643651 CAGTGATGGCCAGGGGACCATGG - Intergenic
1171879287 20:30605075-30605097 CAGAGATGGCCACTGGAATCGGG - Intergenic
1172757876 20:37299968-37299990 CAGTGGTGGCCAGTGGTGCAAGG - Intronic
1175045782 20:56103823-56103845 CAGTCATAGCCAGTGACATGTGG + Intergenic
1175190074 20:57205794-57205816 CAGTGCTGGCCTGTAGCATCTGG - Intronic
1178229140 21:30761080-30761102 CAGGAATGGCCAGTGAGATAGGG - Intergenic
1179154095 21:38834951-38834973 CACTGCTTGCCAGTGGCCTAAGG - Intergenic
1180182953 21:46126073-46126095 CAGTGACGGCCATCGGCATCGGG + Exonic
1180816678 22:18793811-18793833 CAGTGTTTGCCAGTGTCAAAGGG - Intergenic
1181202869 22:21228158-21228180 CAGTGTTTGCCAGTGTCAAAGGG - Intergenic
1181332381 22:22103331-22103353 CTGTGGTGGCCATTGGCATTGGG + Intergenic
1183158806 22:36096482-36096504 TAGTGATGGCCAGGGGCTGAGGG - Intergenic
1183428759 22:37753178-37753200 CTGTCATGGCCCTTGGCATAGGG - Intronic
1203224050 22_KI270731v1_random:67268-67290 CAGTGTTTGCCAGTGTCAAAGGG + Intergenic
1203266777 22_KI270734v1_random:19532-19554 CAGTGTTTGCCAGTGTCAAAGGG - Intergenic
949581001 3:5388231-5388253 CACTGCTGGCAAGGGGCATATGG - Intergenic
949718270 3:6958988-6959010 CCATGATGTCCAGGGGCATATGG + Intronic
950404988 3:12798608-12798630 CAGAGCTGGCTAGTGGCCTAGGG + Intronic
950444366 3:13027703-13027725 CAGGGATGGCCAGTGGGAGCAGG + Intronic
951810117 3:26689426-26689448 CAGGGATGGCCACTGTCAGAAGG - Intronic
952362972 3:32649417-32649439 CAGTGATGGCCAGGGGCTGGAGG - Intergenic
953443679 3:42943150-42943172 AAGTGAAAGCCAGTGGCAAAAGG - Intronic
956584663 3:70851835-70851857 CAGGGATGGGCAGTGGCTTTCGG + Intergenic
959239546 3:103771902-103771924 TAGTGATAGCCAGGGGAATATGG + Intergenic
959681556 3:109102165-109102187 CAGGGAAGGCCACTGGCAGATGG + Intronic
960510638 3:118544928-118544950 AAGTGAAGGGCAGAGGCATACGG + Intergenic
960571234 3:119187312-119187334 AGGTGATGGCCAGAGTCATATGG - Intronic
961681887 3:128604862-128604884 AACTGAGGGCCACTGGCATACGG + Intergenic
961821634 3:129578340-129578362 CAGTGTTGGCCAGAGGCACCAGG + Exonic
962752716 3:138445565-138445587 CAGTGGTGGCCAGAGGCACTAGG + Intronic
964432823 3:156623821-156623843 CAGGGGTGGCCAAAGGCATATGG - Intergenic
964858858 3:161178148-161178170 CAGTGAAGCCCACTGGCAGATGG - Intronic
965009817 3:163073379-163073401 CAGTGATGGCCTGAAGCATGGGG + Intergenic
965029625 3:163348535-163348557 CAGTGATTGCCAGAGGTAAATGG + Intergenic
965484793 3:169265619-169265641 CAAGGCTGGCCAGTGGCCTATGG - Intronic
967878154 3:194280789-194280811 CAGCAATGGCCAGTGGAACAGGG - Intergenic
968901190 4:3432717-3432739 CAGTTCTGGCCAGTGGCAGTCGG - Intronic
968939813 4:3631905-3631927 CACTGCTGGCCAGTGACAAAGGG + Intergenic
970001005 4:11366192-11366214 CAGTGGGGGCAAGTGGCATGAGG - Intergenic
970725611 4:19040809-19040831 CAGTGATGAAGAGTGGCAAAAGG - Intergenic
971250336 4:24968940-24968962 CAGTGGTGGCCAAAGGAATATGG - Intronic
974023434 4:56711544-56711566 CAGGGATGGCCAGAAGCCTAGGG + Intergenic
977865199 4:102017254-102017276 CAGAGATGGTCAGAGGCATTTGG + Intronic
979441867 4:120759172-120759194 CAGTGTTGGCGGGTGGCATGGGG - Intronic
980320513 4:131266959-131266981 TACTGATGGCCAGTGGAATTGGG - Intergenic
981317939 4:143359772-143359794 CAGGGGTTGCCAGTGGCAAAGGG + Intronic
983074808 4:163312997-163313019 CAGTGTTTTCCAGTGGCAAAGGG - Intergenic
984451242 4:179905722-179905744 CAGGGATGGCCAGAGGCAGATGG - Intergenic
986030305 5:3887225-3887247 CAATGTTGGCCATGGGCATATGG - Intergenic
986585223 5:9309456-9309478 GAGTTATGGCCAGTGGAATTTGG + Intronic
987758695 5:22130604-22130626 CAGAGATGTCCAGTGGGATCTGG - Intronic
988324269 5:29741591-29741613 AAGTGCTGGCCAGAGGCATCAGG + Intergenic
988527527 5:31999995-32000017 CTGTGATGGCCAGAGGCAGTTGG - Intronic
991218748 5:64187793-64187815 CAGTTATGGCCAGATGCCTATGG - Intronic
991423323 5:66464072-66464094 CCCTGATGACCAGTTGCATAGGG + Intergenic
991749453 5:69784742-69784764 CAGAGATGTCCAGTGGGATCTGG - Intergenic
991801033 5:70364551-70364573 CAGAGATGTCCAGTGGGATCTGG - Intergenic
991827567 5:70645490-70645512 CAGAGATGTCCAGTGGGATCTGG + Intergenic
991893396 5:71364043-71364065 CAGAGATGTCCAGTGGGATCTGG - Intergenic
993355326 5:86899754-86899776 CAGTGATGGCAATTTGAATAGGG - Intergenic
993615764 5:90110239-90110261 CAGTTCTGGACATTGGCATAGGG + Intergenic
994632478 5:102302964-102302986 AAGTTTTGGTCAGTGGCATATGG - Intergenic
995656181 5:114428739-114428761 CAGTGATTGCCAGGGGATTATGG - Intronic
995788648 5:115859611-115859633 CAGTTCTGGCCAGTGGAATGTGG - Intronic
997965117 5:138350709-138350731 AAGTGGTGGGCAGTGGCATGTGG + Intergenic
999199160 5:149803930-149803952 CAGTGAGGGCCAGAGGCCAAGGG - Intronic
1000246563 5:159453248-159453270 CAGTGATGGCAAGTGGGACCCGG + Intergenic
1000410988 5:160934891-160934913 CAGGGGTGGCCAAAGGCATATGG + Intergenic
1001161008 5:169313175-169313197 TAGTGGTTGCCAGTGACATAGGG + Intergenic
1003229725 6:4241137-4241159 CACTGATGGCAACTGGGATATGG + Intergenic
1004107096 6:12676044-12676066 GAGTGATGGCCAGAGGTCTAGGG - Intergenic
1008039921 6:46786520-46786542 CAGTGGTTGCCAGTGGCCAAAGG - Intergenic
1010080722 6:71857752-71857774 CAGTGATTGCCAGTGGGAAGGGG - Intergenic
1011716970 6:90116680-90116702 CAGTGATGGTCAATACCATATGG + Intronic
1012048343 6:94307513-94307535 CAGAGATGGTCAGTAGCACAAGG - Intergenic
1012711085 6:102606180-102606202 AAGTGTAGGCCAGTGCCATAAGG + Intergenic
1014122816 6:117745954-117745976 CAGTGATGGACTGTGCCATGAGG + Intergenic
1014395427 6:120922359-120922381 CAGAGAAGGCCACTGGCAGATGG - Intergenic
1014495895 6:122122064-122122086 CAGTAATGCCCTGTGGCATGAGG + Intergenic
1015102990 6:129503259-129503281 CAATGATGGCCAGTGGCACAAGG + Exonic
1017871451 6:158489974-158489996 CAGTGATGGTGGGTGGCAGAGGG + Intronic
1019062130 6:169264008-169264030 CAGTGATGGACACTGGCTGAGGG + Intergenic
1020845806 7:13281609-13281631 CAGAGCTGGCCAGTGGCAGATGG + Intergenic
1021030343 7:15725064-15725086 CAGCAATGGCCAGAGGTATAGGG - Intergenic
1021495029 7:21264977-21264999 CAGTTATGGGCATGGGCATAGGG + Intergenic
1021768082 7:23969305-23969327 CAGCGATGGACTGTGGCATTTGG + Intergenic
1023802199 7:43844819-43844841 CAGTGCTGCCCAGTGGGATGGGG + Intergenic
1024370002 7:48571779-48571801 CAGTGCTGGCCAGTGCAATAAGG - Intronic
1024426568 7:49232782-49232804 CAGTGATGGGCAGTGGGACATGG - Intergenic
1028302942 7:89225001-89225023 CAGCTATAGCCAGTGTCATAAGG - Intronic
1030592115 7:111494279-111494301 CAGTGATTTCCAGTAGCAAAAGG + Intronic
1035853356 8:2944385-2944407 CAGTGATGTCCAGTGACAAGGGG + Intronic
1037228024 8:16619464-16619486 CTGTGAGGGGCAGTGGCACAGGG - Intergenic
1038647842 8:29375912-29375934 CAGTGATTGCCTGTGGCAGGGGG - Intergenic
1040761847 8:50855742-50855764 CAGTGATTGCCAGGGGTTTAGGG + Intergenic
1041527740 8:58826482-58826504 CAGTAAAGGCCAATGGCATGGGG + Intronic
1048224386 8:132570677-132570699 CAGTGATGGACAGATGCAGAGGG + Intergenic
1049804660 8:144533470-144533492 CAGGGATGGACAGTGGCCTGGGG - Intronic
1050109898 9:2203874-2203896 AAGGGATGGACAGTGGCAGATGG + Intergenic
1054343171 9:63887296-63887318 CAGTGATTGCCAGGGGCTCAGGG + Intergenic
1054450947 9:65403405-65403427 CACTGCTGGCCAGTGACAAAGGG - Intergenic
1056882300 9:90407757-90407779 CAGTGATAGCCAGTGTTAAAAGG - Intergenic
1057006448 9:91564955-91564977 CAGAGATGGCCAGAGGCAGAGGG + Intronic
1057332739 9:94130769-94130791 CAGTCATGGCCAAAGGCAAAGGG - Intergenic
1058052280 9:100418994-100419016 CAGTGCTGCCCCATGGCATAAGG + Intergenic
1060758532 9:126229640-126229662 TAATGATGGCAAGTGTCATACGG + Intergenic
1060822177 9:126667784-126667806 CAAAGGTGGCCAGTGGCAGAGGG + Intronic
1061323516 9:129847791-129847813 CAGTGATTGCCTGGGGCAAAGGG - Intronic
1188250294 X:27885007-27885029 CTGAGATGGCCTGTGGCAGATGG - Intergenic
1188639528 X:32482850-32482872 CAGTGTTGGAAAATGGCATAAGG - Intronic
1189198202 X:39169245-39169267 CTGTGAAGGCCACTGGTATAGGG - Intergenic
1194045005 X:88991837-88991859 GAACGATGGCCAGTGGCACAGGG - Intergenic
1194763726 X:97824920-97824942 CAGTGATTGCCCGTAGCATTAGG - Intergenic
1194785006 X:98072444-98072466 TAGTGAGGACCAGCGGCATAAGG - Intergenic
1197231778 X:124013043-124013065 CAGTGATGCCCAGTGTGAAATGG + Intronic
1197452700 X:126640078-126640100 CAATGATGGCCAATGAGATATGG + Intergenic
1197861951 X:130980244-130980266 CAGTGGTGTGCAGTGGCAAATGG + Intergenic