ID: 912383941

View in Genome Browser
Species Human (GRCh38)
Location 1:109262045-109262067
Sequence CTGGGCATTCCCACCCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912383941 Original CRISPR CTGGGCATTCCCACCCCACT GGG Intronic
900944142 1:5820197-5820219 CTGGGCATTCCCTCCCCTGGGGG - Intergenic
902527602 1:17069228-17069250 CTGGGCATCCCCAAGCCATTCGG - Exonic
905212585 1:36385109-36385131 CCGCCCATTCCCACGCCACTTGG - Intronic
907501391 1:54884105-54884127 CTGGGTATTCCCAACACACTAGG + Intronic
907843339 1:58177987-58178009 CTGAGCTTTACAACCCCACTGGG - Intronic
912383941 1:109262045-109262067 CTGGGCATTCCCACCCCACTGGG + Intronic
915074555 1:153297756-153297778 CTGGGCATTCACAGCCCTCTTGG - Intergenic
918187150 1:182138032-182138054 CTTGGCATTCCCACCCCTAAGGG - Intergenic
921163567 1:212489949-212489971 CCAGGCATTCCCTCACCACTAGG - Intergenic
924463895 1:244283465-244283487 CTTGGCATGCCCACAACACTGGG - Intergenic
1064346450 10:14537076-14537098 TTGGTCGTTCCCACCTCACTCGG - Intronic
1064493326 10:15883354-15883376 CTGGCCATCCCAACCCAACTTGG - Intergenic
1065050695 10:21788299-21788321 CTGGGCAGTCACACCCCTTTAGG + Intronic
1065161597 10:22928117-22928139 TTGGGCCTCCCCACCCCACGGGG - Intronic
1066423436 10:35283017-35283039 CTGGGTGTCACCACCCCACTGGG + Intronic
1069921645 10:71819214-71819236 CCTGGCATTCCCAGCCCACTGGG + Intronic
1070211949 10:74333171-74333193 TTGTGTATTCCCAGCCCACTAGG - Intronic
1070685252 10:78475839-78475861 TTGGGGCCTCCCACCCCACTGGG + Intergenic
1070711131 10:78683985-78684007 CTAGGGAGTCCCACCCCACCTGG + Intergenic
1072722822 10:97791455-97791477 CTGGCCTTTCCCACCACACCAGG + Intergenic
1075230426 10:120671645-120671667 CTGACCAATCCCACCTCACTGGG + Intergenic
1076941468 10:133612843-133612865 CTGGACATTTCCACCCCCCATGG - Intergenic
1076980911 11:204276-204298 CTGGGCCTTCCCTGTCCACTGGG - Exonic
1077354700 11:2109736-2109758 CTGGGCAGTCCCAGCCCTCCAGG + Intergenic
1082752386 11:57033051-57033073 TTGGGCAATCCCAAACCACTGGG - Intergenic
1082997124 11:59263343-59263365 CTGGGCCTCCTCATCCCACTGGG + Intergenic
1084375360 11:68773172-68773194 TCGGGCCTTCCCTCCCCACTGGG + Intronic
1086801689 11:91184037-91184059 CTGGGCAGGACCTCCCCACTGGG - Intergenic
1092365506 12:7873310-7873332 CTGGGCCTTCCCAGCCCAGCCGG - Intronic
1093753820 12:22830566-22830588 CTGGGCCTTCCCACAACACGTGG - Intergenic
1096500444 12:52061276-52061298 CTGGCTATTCCCACCTCACAGGG + Intergenic
1097478334 12:60087485-60087507 CTGGGCCTTCCCACAACACCTGG - Intergenic
1099970516 12:89495487-89495509 ATGGGCATTCCCATGCCAGTGGG - Intronic
1102811418 12:115827479-115827501 CTAGGGATTCCCAACCCTCTTGG - Intergenic
1104130493 12:125888966-125888988 CAGGCCTTTCCCACCCCACATGG - Intergenic
1104655543 12:130571702-130571724 CTGTGCCGTCCCACCCCACTTGG + Intronic
1106456871 13:29935429-29935451 GTGGGCAGCCCCAGCCCACTTGG + Intergenic
1107819573 13:44274079-44274101 CTGTGCTTTCCCACCACACCGGG + Intergenic
1112429435 13:99337723-99337745 CTTGGCCTTCCCAACCCACATGG + Intronic
1113416083 13:110129718-110129740 CTGGACATTCCCACCCCACCCGG - Intergenic
1115167880 14:30470166-30470188 CTATGCATTCCAAGCCCACTTGG + Intergenic
1117920431 14:60722329-60722351 GGGGGCGCTCCCACCCCACTGGG - Intronic
1122033502 14:98931094-98931116 CAGGACATGCACACCCCACTGGG + Intergenic
1123405043 15:20014426-20014448 CTGGGCCTCCCCGGCCCACTGGG - Intergenic
1123476517 15:20595325-20595347 GTGGGCTTTCCCACCCCTCCAGG + Intergenic
1123514374 15:21021074-21021096 CTGGGCCTCCCCGGCCCACTGGG - Intergenic
1123641494 15:22405039-22405061 GTGGGCTTTCCCACCCCTCCAGG - Intergenic
1124256454 15:28146653-28146675 CTGGGCATTCCCACAGCCCCTGG - Intronic
1124567776 15:30832440-30832462 CTGGGCATTCCCACAGCCCCTGG + Intergenic
1128229271 15:66023653-66023675 ATGGGCACGCCGACCCCACTTGG - Intronic
1130213755 15:81949546-81949568 CTGGGCACTTTCACCCCTCTGGG + Intergenic
1130381722 15:83377795-83377817 CTGGGCATTCCCAGTCCAGTGGG - Intergenic
1130997127 15:88910148-88910170 CTGGACACTCCCAGGCCACTTGG - Intronic
1131068094 15:89447225-89447247 CTGTACATGCCCACCCCAGTGGG + Intergenic
1132300185 15:100770291-100770313 CTAGGCTCTCCAACCCCACTAGG - Intergenic
1132400285 15:101501054-101501076 CTGAGCAATCCCACTTCACTTGG - Intronic
1132592012 16:730194-730216 CTGGGCCACCCCACCCCACCTGG + Exonic
1132604293 16:787295-787317 CTCAGGATTCCCACCCCACTTGG - Intronic
1132726384 16:1340740-1340762 CTGGGCATGCCCAGGCCCCTTGG + Intronic
1136072027 16:27793088-27793110 CTAGGAATTCCCACCTCAATGGG - Intronic
1141094469 16:81153305-81153327 CTGGGTATTTCAACCCAACTTGG + Intergenic
1141699591 16:85636292-85636314 CTTGGCATTCCCAGCTCAATAGG - Intronic
1141754541 16:85982576-85982598 CTGGTGGTTCCCACCCCACCGGG - Intergenic
1142645636 17:1312420-1312442 CTGGGCTTTGCCTCCTCACTGGG + Intergenic
1144162161 17:12570226-12570248 CTGGGCACCACCACCCAACTGGG + Intergenic
1144763699 17:17721818-17721840 CTGGGCAGCCCCGCCCCACTCGG - Intronic
1148747267 17:49925679-49925701 ATGCTCATCCCCACCCCACTGGG - Intergenic
1149863553 17:60137977-60137999 CTTGCCACTCCCTCCCCACTGGG - Intergenic
1150229528 17:63542455-63542477 CTGGGCATTTCCACCCACCCTGG - Intronic
1151197950 17:72445361-72445383 CAGGGAAATCTCACCCCACTGGG + Intergenic
1152110478 17:78355060-78355082 CTGGGGAGCCACACCCCACTGGG + Intergenic
1152376204 17:79920100-79920122 CGGGGCACCCCCGCCCCACTCGG - Intergenic
1154087554 18:11322242-11322264 CTGGTCCTTCCCACCACACGAGG + Intergenic
1157433677 18:47651306-47651328 CTGGGCAGTCCCGTCCCTCTGGG - Intergenic
1157452928 18:47801553-47801575 CTGGCCTTTCCCGCCCCATTGGG + Intergenic
1158611470 18:58944501-58944523 CTGGCCACTCCCACACCCCTGGG + Intronic
1160928804 19:1560084-1560106 CTGGGGATTCCCTCGGCACTTGG + Intronic
1161077993 19:2295822-2295844 CTGGGCATTCACATGCCACGTGG + Intronic
1161699652 19:5787763-5787785 TTGGCCGTTCCCTCCCCACTGGG + Intronic
1162376898 19:10310284-10310306 CTGGGGAAGGCCACCCCACTAGG + Intronic
1162722841 19:12672764-12672786 CTGTGCCTTCCCAGCCCAGTGGG - Intronic
1164506219 19:28863567-28863589 AAGGGCATTCCCAACCCCCTGGG + Intergenic
1165006543 19:32812169-32812191 CTGGGCCTTCCCACTCCAGCTGG - Intronic
1165006567 19:32812250-32812272 CTGGGCCTTCCCACCCCACCTGG - Intronic
1165486331 19:36098827-36098849 CTGGGCATTCCCAGCACTTTGGG + Intronic
1167632229 19:50632331-50632353 CTGGGCAAGCCCCCACCACTGGG + Exonic
925044314 2:760165-760187 CTGGGCACACCCACCACAATTGG + Intergenic
925656152 2:6151596-6151618 GTGTGCACTACCACCCCACTTGG + Intergenic
925716094 2:6785708-6785730 TTGGGCCTTCCCTTCCCACTTGG - Intergenic
928106174 2:28471907-28471929 CTGGGAAGCCCCACCCCACCTGG + Intronic
929024409 2:37585792-37585814 CTGGGCATGCCTGCCCTACTGGG - Intergenic
933701198 2:85256474-85256496 CTAGGCATTCCCAGGCCTCTAGG - Intronic
1169428074 20:5511621-5511643 CTTAGCATCCCCACCACACTCGG + Intergenic
1169903342 20:10575101-10575123 GTTGGCATTCCTGCCCCACTAGG + Intronic
1170177399 20:13487466-13487488 CTGGACATTCCCACGGCCCTAGG + Intronic
1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG + Intronic
1172230241 20:33331450-33331472 CTGGGCCTCCCCTCCCTACTAGG - Intergenic
1172600047 20:36177258-36177280 CTGGGCACTCCAAACCCACAGGG - Intronic
1173678907 20:44862242-44862264 CTGAGCTTTGCCAGCCCACTGGG + Intergenic
1173736537 20:45365622-45365644 CTGGGCTTTTCCACCCCTCCAGG + Exonic
1176148676 20:63577586-63577608 CTGGGCATTCCCGGTCCATTGGG - Intergenic
1177369391 21:20181888-20181910 CTTGGCATTCCCCACCCAATTGG + Intergenic
1177407601 21:20690611-20690633 TTGGTCCTTCCCACCACACTGGG + Intergenic
1178103799 21:29297981-29298003 CTGGGCACGCCAACCCCACGAGG - Intronic
1181513264 22:23398232-23398254 CTGGGCAGTCCCTGCCCTCTAGG + Intergenic
1182125041 22:27810111-27810133 ATGGCCCTTCCCACCCAACTAGG + Intergenic
1183282888 22:36942122-36942144 CTGGCCATTTCCACCCAACATGG - Intergenic
1184453938 22:44598641-44598663 ATGGCCAGCCCCACCCCACTGGG + Intergenic
1184495280 22:44837572-44837594 CTGGGCATCCCCACCCAGCCAGG + Intronic
1185096445 22:48808560-48808582 TGGGGCTTTCCCACCCCCCTGGG - Intronic
950426642 3:12928001-12928023 CTGGGGCTTCTCAGCCCACTCGG - Intronic
953597083 3:44327012-44327034 CTAGGTATTCCCACCTCCCTAGG - Intronic
954377813 3:50204285-50204307 CAGGGCATTCCCCCCGCACTGGG + Intergenic
955339239 3:58112188-58112210 CGGGGCTTTCCCAGCCCCCTTGG - Exonic
958680040 3:97317799-97317821 CTGGGCATTCCCAGTGCACAAGG + Intronic
961005669 3:123403740-123403762 TTGGGCTTTCCCAGCCCACCAGG + Intronic
961087074 3:124077280-124077302 CTGAGCCTTCCCACCCATCTGGG - Intergenic
970981645 4:22105983-22106005 CTGGGCCTTCACACTCTACTAGG - Intergenic
978282550 4:107035626-107035648 CTTTGCATTCCCACCCCTCCGGG - Exonic
978351499 4:107824952-107824974 CTGGGTCTCCCCGCCCCACTCGG - Intronic
981229568 4:142336727-142336749 CTGGGCTTTCTCTGCCCACTTGG - Intronic
983490755 4:168386217-168386239 CGGGGAATTCCAACCACACTTGG + Intronic
983934500 4:173491801-173491823 CTGGACATTCACTCCCCAGTAGG - Intergenic
984870083 4:184317716-184317738 GTGGGAATTCCCACTCCATTCGG + Intergenic
986282703 5:6336643-6336665 GTGGCCCTTCCTACCCCACTAGG + Intergenic
986288298 5:6377684-6377706 CTGGCTATTCCCACAGCACTAGG + Intronic
987152467 5:15056618-15056640 CAGGTCAGTCCCACCCCTCTGGG - Intergenic
989052699 5:37336970-37336992 CCAGACATTCACACCCCACTAGG + Intronic
990908224 5:60825973-60825995 CTGGGCATTCCTTCCCCAGATGG - Intronic
993424167 5:87741689-87741711 CTTGGCATTGCCACCTCATTAGG - Intergenic
998371912 5:141667253-141667275 CTGGGAAATCCCACCACCCTAGG + Intronic
1001434259 5:171687075-171687097 CTGGTCAACCCCACCACACTTGG - Intergenic
1003182866 6:3806845-3806867 CAAGGGAGTCCCACCCCACTGGG + Intergenic
1006439925 6:34047603-34047625 CTGGGAATTTCTAACCCACTTGG + Intronic
1006444372 6:34070581-34070603 CTCAGCAGCCCCACCCCACTAGG - Intronic
1006582516 6:35085040-35085062 CTGGGCATCCCCACACTCCTGGG + Intronic
1007737432 6:43990422-43990444 CTGGCCCTGCCCACCCGACTGGG - Intergenic
1012217996 6:96612137-96612159 CTTAGCAATCCCACACCACTCGG + Intronic
1013403786 6:109824161-109824183 CCCTCCATTCCCACCCCACTTGG - Intronic
1013596093 6:111662314-111662336 CAGAACATTCCCATCCCACTTGG - Intronic
1016503084 6:144744869-144744891 CGGGACATTTCCACTCCACTGGG - Intronic
1017283729 6:152650921-152650943 CAGGGGATTCCCACCTCTCTTGG - Intergenic
1019374426 7:681816-681838 CTGGGCATTTCAATCCCACCAGG + Intronic
1021313044 7:19116541-19116563 CTCAGCCTTCCCACCTCACTTGG - Intronic
1021542236 7:21772738-21772760 GTGGGTATTCCAAACCCACTCGG + Intronic
1021761931 7:23910681-23910703 CTGGGCAGCCCCACCCCTCATGG - Intergenic
1022474313 7:30700092-30700114 CTGGCCAGCCCCACCCCACCCGG + Exonic
1029273275 7:99389757-99389779 CTGGGCATTGCCAGCCCACAAGG - Intronic
1030271981 7:107678331-107678353 CTGAGTATTCTCACCTCACTGGG + Intronic
1030327702 7:108238717-108238739 TTAGGCATTCCCACTCCAATGGG + Intronic
1031716668 7:125116952-125116974 CTGGCCATTACCCCTCCACTTGG + Intergenic
1034383328 7:150718086-150718108 CAGGGCCTTTCCAACCCACTCGG - Intronic
1038226645 8:25664016-25664038 CTGGGCTTTCCCACACCAGTGGG + Intergenic
1038452590 8:27649499-27649521 CTGGGATGTCCCACCCCTCTGGG - Intronic
1039545704 8:38409664-38409686 CTGCTCATTCCCACCCTGCTCGG - Intergenic
1049247623 8:141571236-141571258 AGGGGCACCCCCACCCCACTGGG - Intergenic
1049537556 8:143189438-143189460 CAGGCCATCCCCACCCCTCTGGG + Intergenic
1049585848 8:143432080-143432102 CTGGGCCCTCCCACTCCTCTGGG + Intergenic
1049620352 8:143595575-143595597 CTGGATATTCCAGCCCCACTGGG + Intronic
1053069578 9:35093136-35093158 CTGGGCCTGCCCATCCCATTTGG - Exonic
1055640096 9:78312795-78312817 CCAGGCATCCCCATCCCACTGGG - Intronic
1055859483 9:80730905-80730927 CAGGGCAGTCCCACCTCCCTGGG - Intergenic
1056461993 9:86817496-86817518 CTGAGCATTCCCACCACATCAGG - Intergenic
1056580758 9:87886916-87886938 GTGGGCTTTCCCACCCCTCCAGG - Exonic
1056756411 9:89384865-89384887 CTGGGCCTTCCACCCCCACCTGG + Intronic
1057192024 9:93093734-93093756 CTGGGCATTCCCCCTCCCCCAGG - Intergenic
1057805928 9:98220036-98220058 CTAGGCTTCCCCACCCCACAGGG - Intronic
1058876589 9:109250049-109250071 CTGGCCTCTCCCTCCCCACTCGG + Intronic
1059277826 9:113110263-113110285 CTGCCCTTTCCCTCCCCACTGGG - Intergenic
1059278425 9:113114288-113114310 CTGCCCTTTCCCTCCCCACTGGG + Intergenic
1059354148 9:113686743-113686765 CTGTGCCTCCCCAGCCCACTGGG - Intergenic
1060409961 9:123393882-123393904 CAGGTCCTTCCCGCCCCACTGGG + Intronic
1060635988 9:125200343-125200365 CAGGGAAGGCCCACCCCACTTGG + Intergenic
1060645114 9:125271808-125271830 CTGGGCTTACCCACCGCACCTGG + Intronic
1060947660 9:127579599-127579621 CCGGGCCTTCCCACACCACATGG + Intergenic
1061853182 9:133428072-133428094 CTGGCCTCTCCCACCCCATTAGG + Intronic
1062125410 9:134858090-134858112 CTGCTCACTGCCACCCCACTTGG + Intergenic
1062271360 9:135711204-135711226 CTGGGCATTCCCGTTCCAGTTGG - Intronic
1062482121 9:136757384-136757406 CAGGGCAGCCCCTCCCCACTGGG + Intronic
1062580968 9:137229090-137229112 CTGGCCATTCCCACCCCTGCAGG + Exonic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1186212948 X:7269274-7269296 CATGGCATTCCCAACTCACTGGG + Intronic
1186779019 X:12894269-12894291 GAGGGATTTCCCACCCCACTAGG - Intergenic
1186796877 X:13055661-13055683 CTGGGCCTCCCCACACCTCTGGG + Intergenic
1187532719 X:20111369-20111391 CTGTACATTCCCACTCCACAGGG - Intronic
1192223264 X:69211712-69211734 CTGGCCCTTCCCACCACAGTAGG + Intergenic
1192980177 X:76330786-76330808 CTGAGCAATCCCTCCTCACTGGG + Intergenic
1193199699 X:78673917-78673939 CTGGTCATCCCCACTCCCCTGGG - Intergenic
1198648597 X:138837115-138837137 CTGGGCAAGACCACCCAACTGGG - Intronic
1199095729 X:143736193-143736215 CTGGGTTTTCCCACCCCATGTGG + Intergenic
1199754292 X:150850050-150850072 CTTGGCATACCTTCCCCACTGGG - Intronic
1199928559 X:152494873-152494895 CTGGACCTTCCCACCACACATGG - Intergenic
1200066323 X:153505770-153505792 CTGTGCCTCCCCAGCCCACTGGG - Intronic