ID: 912384420

View in Genome Browser
Species Human (GRCh38)
Location 1:109264174-109264196
Sequence CACCATGCACAGCTGGCACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 355}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912384412_912384420 14 Left 912384412 1:109264137-109264159 CCGTCTGGAGCCAGGCCGGGCCA 0: 1
1: 0
2: 2
3: 21
4: 254
Right 912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG 0: 1
1: 0
2: 5
3: 62
4: 355
912384409_912384420 21 Left 912384409 1:109264130-109264152 CCTCTCTCCGTCTGGAGCCAGGC 0: 1
1: 0
2: 3
3: 26
4: 156
Right 912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG 0: 1
1: 0
2: 5
3: 62
4: 355
912384416_912384420 -1 Left 912384416 1:109264152-109264174 CCGGGCCAATGACGGTGACTGGC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG 0: 1
1: 0
2: 5
3: 62
4: 355
912384407_912384420 24 Left 912384407 1:109264127-109264149 CCTCCTCTCTCCGTCTGGAGCCA 0: 1
1: 0
2: 0
3: 31
4: 219
Right 912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG 0: 1
1: 0
2: 5
3: 62
4: 355
912384414_912384420 4 Left 912384414 1:109264147-109264169 CCAGGCCGGGCCAATGACGGTGA 0: 1
1: 0
2: 2
3: 6
4: 87
Right 912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG 0: 1
1: 0
2: 5
3: 62
4: 355
912384417_912384420 -6 Left 912384417 1:109264157-109264179 CCAATGACGGTGACTGGCACCAT 0: 1
1: 0
2: 1
3: 5
4: 96
Right 912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG 0: 1
1: 0
2: 5
3: 62
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912384420 Original CRISPR CACCATGCACAGCTGGCACT GGG Exonic
900377137 1:2360109-2360131 CGCCCTGCACCCCTGGCACTAGG + Intronic
900692069 1:3987024-3987046 CACCATGGACAGCTCGCAGTGGG + Intergenic
900716567 1:4148838-4148860 CACCATGCACAGCTGGGTCTTGG - Intergenic
901055485 1:6447099-6447121 GACCACGCAGACCTGGCACTTGG - Intronic
901323575 1:8353789-8353811 CACCATGCAGACCTGCCCCTAGG + Exonic
901908411 1:12434334-12434356 CACCCTTCACAGCTGGCAAGTGG - Intronic
903057623 1:20647443-20647465 CACCACGCCCAGCTGGGAGTTGG + Intronic
903337389 1:22634329-22634351 CAGCTTCCACAGCTGGCACCGGG + Intergenic
903672037 1:25042147-25042169 CAGCATCCACAGCTGGCACTGGG + Intergenic
904540268 1:31228008-31228030 CACCATGCAAAGCTGACAAATGG - Intronic
906082305 1:43101382-43101404 CAGCTTCCTCAGCTGGCACTGGG + Intergenic
906448149 1:45921643-45921665 CAACTTCCACAGCTGGCACAAGG + Intronic
906459137 1:46023942-46023964 CACCATGCACAAGTGGCGCTTGG - Exonic
906511992 1:46415312-46415334 CACCATGCCCGGCTGACCCTAGG + Intergenic
909305678 1:74073356-74073378 CACCATGCACAGCTATCTTTTGG - Intronic
910123518 1:83816018-83816040 CTCCATGTACAGCTGGGGCTGGG - Intergenic
911288607 1:96028327-96028349 CATCTTCCACGGCTGGCACTGGG + Intergenic
912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG + Exonic
913263363 1:117021282-117021304 TACCAAGCACAGGTAGCACTAGG + Intronic
913317965 1:117568174-117568196 CACCCTGCACAGCTGCCAAGGGG - Intergenic
913549437 1:119903114-119903136 CACCACAGACAGCTGCCACTAGG + Intergenic
914445805 1:147749735-147749757 CACCATGCACAGGCAGCACAAGG + Intergenic
915178611 1:154038631-154038653 CACCATGCCCAGCAGACACAGGG + Intronic
915403281 1:155639950-155639972 CACCATGCCTGGCTGGCCCTGGG - Intergenic
915590599 1:156868234-156868256 CACCTACCACAGCTGGCATTGGG - Exonic
916733201 1:167584410-167584432 CACCATGCACCTCTTGCACCCGG - Intergenic
917405506 1:174702204-174702226 CACCATGCAGAGTGGGAACTTGG - Exonic
918734129 1:188037501-188037523 CACCATGCCTGGCTGGCATTAGG + Intergenic
919707703 1:200694046-200694068 CACCATGCCCAGCCTACACTTGG + Intergenic
922012145 1:221599573-221599595 CAACTGGCACAGCTGGCACTGGG - Intergenic
922161874 1:223084183-223084205 CATCGTGCACAGCAGGCGCTTGG + Intergenic
924290410 1:242530180-242530202 CACCATGCCTGGCCGGCACTGGG + Intergenic
1062771335 10:104106-104128 CACCTTCCACGGCTGGCACCAGG + Intergenic
1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG + Exonic
1063499325 10:6538658-6538680 GTCCATGACCAGCTGGCACTAGG - Intronic
1064065901 10:12181368-12181390 CAACCTGTACAGCTGTCACTTGG - Intronic
1066101443 10:32121961-32121983 CAGCTTCCTCAGCTGGCACTGGG + Intergenic
1066313177 10:34218116-34218138 CACCATGCACACCTGACTGTTGG + Intronic
1068698970 10:60000051-60000073 CACCATTCACAGCAGGAACAGGG - Intergenic
1069558951 10:69416224-69416246 CTCCATGCCCAGCTGGCAACTGG - Exonic
1073425262 10:103452105-103452127 CACCATGCTCCGCTGACACCTGG + Intronic
1073670174 10:105579365-105579387 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1074389568 10:113045506-113045528 CACCATGCCCAGGTGGGGCTGGG - Intronic
1074595989 10:114867683-114867705 CTCCATGCACATCTGGCACGTGG - Intronic
1075546943 10:123362255-123362277 GACCAAGCACTGCAGGCACTGGG - Intergenic
1075816269 10:125266925-125266947 CACCTGGCAGAGCTGGCCCTGGG + Intergenic
1075857083 10:125638672-125638694 CACCGTGCCCAGCTGTCACCTGG + Intronic
1076497531 10:130906726-130906748 GTCCATCCACAGCTGGAACTTGG - Intergenic
1076846264 10:133070995-133071017 CACCAGGCACAGATGGCGCACGG + Intronic
1077184312 11:1229488-1229510 CACCATGCCCAGCTGGCTCATGG - Intronic
1079535979 11:21515898-21515920 CTTCATGCAGAGCTGGCCCTGGG + Intronic
1080068164 11:28044198-28044220 CAACATGCACAGCTGACACTAGG + Intronic
1080486197 11:32709582-32709604 CACCATGCACAGCCTGCTGTTGG + Intronic
1081268700 11:41058265-41058287 CAGCTTCCACGGCTGGCACTGGG - Intronic
1081283918 11:41245504-41245526 CAGCTTCCACGGCTGGCACTGGG + Intronic
1081683639 11:45026340-45026362 CACCAGGCCCAGATGGCCCTAGG + Intergenic
1081741357 11:45443248-45443270 CTCCATGCACTGATGGCTCTGGG + Intergenic
1082691625 11:56312050-56312072 CACCATATACAGCAGTCACTTGG - Intergenic
1083214505 11:61210048-61210070 CCCCAGGAACAGCTGGCACAGGG + Intronic
1083217389 11:61228877-61228899 CCCCAGGAACAGCTGGCACAGGG + Intronic
1083220380 11:61248625-61248647 CCCCAGGAACAGCTGGCACAGGG + Intronic
1083336300 11:61923743-61923765 CACCCTGCACAGCTGGCGGAGGG - Intergenic
1085100709 11:73797536-73797558 CAGCTTTCACAGCTGGCACTGGG - Intronic
1085482169 11:76831667-76831689 CACCATGCCCAGCTGATACTGGG - Intergenic
1086092876 11:83021435-83021457 CAGCTTTCCCAGCTGGCACTGGG - Intronic
1088651245 11:111959365-111959387 CAGCTTCCACAGCTGGCACCAGG - Intronic
1090124787 11:124074831-124074853 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1090712478 11:129400022-129400044 CACCATGCCCAGCTGAGACTTGG + Intronic
1091033907 11:132216017-132216039 CACCAGGCACAGTGGGCAGTTGG - Intronic
1091549254 12:1525478-1525500 CACCATGCCCAGCCAGTACTTGG + Intergenic
1091552682 12:1548736-1548758 CACCATGCCCGGCTGAGACTGGG - Intronic
1093764870 12:22951954-22951976 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1093926833 12:24916825-24916847 CACCATGCACAGCCGAAAATAGG + Intronic
1095252090 12:39990704-39990726 TCCCAAGCACAGCTGCCACTAGG - Intronic
1095603312 12:44038351-44038373 CAGCTTCCACGGCTGGCACTGGG - Intronic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1097491895 12:60281816-60281838 CAGCTTCCACGGCTGGCACTGGG + Intergenic
1097536077 12:60872512-60872534 CAGCTTTCACAGCTGGCACCAGG + Intergenic
1097853463 12:64436856-64436878 CACCATGCCCAGCTGATTCTGGG + Intronic
1098548780 12:71740116-71740138 CACCATGCCTGGCTGTCACTTGG + Intergenic
1098802893 12:74984919-74984941 CAGCTTCCACAGATGGCACTAGG + Intergenic
1099492838 12:83307496-83307518 CTCCACCAACAGCTGGCACTGGG + Intergenic
1099839728 12:87950392-87950414 CACTTTGCACAGCTTGTACTTGG - Intergenic
1100198899 12:92277727-92277749 CACCATGCCCAGCTGGGTTTGGG + Intergenic
1101793269 12:107950106-107950128 TCCCATGCACAGCTAGGACTGGG - Intergenic
1101960525 12:109246168-109246190 CACCATGCCCACCTGGCAAGGGG - Exonic
1102922211 12:116800206-116800228 CACCATGCCCGGCTGAGACTAGG - Intronic
1103523675 12:121552942-121552964 CACCGTGCCCGGCTGGTACTGGG - Intronic
1104120142 12:125791135-125791157 CAACATGCAGAGCTGTCACAGGG - Intergenic
1105041975 12:132967778-132967800 CAGCTTCAACAGCTGGCACTGGG - Intergenic
1105240985 13:18609605-18609627 CAGCCTGCGCAGCGGGCACTCGG - Intergenic
1105783017 13:23720874-23720896 CACCGCACACAGCTGGGACTGGG + Intergenic
1106604050 13:31211104-31211126 CACCATGCCCGGCTGCCAGTTGG - Intronic
1108542328 13:51455803-51455825 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1109062145 13:57632845-57632867 CTCGAGGGACAGCTGGCACTTGG - Exonic
1109396390 13:61765599-61765621 CAGCTTCCACAGCTGGCACCGGG + Intergenic
1109622118 13:64924761-64924783 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1109982371 13:69924848-69924870 CAGCTTCCACAGCTGGCACTGGG - Intronic
1110090208 13:71435372-71435394 CTCCATGCGCAGTTGGAACTGGG + Intergenic
1110310568 13:74044556-74044578 CACCATGCCCAGCTTGCCATTGG - Intronic
1110596053 13:77321870-77321892 CACCATGCTCAGCTTGCTCAGGG - Intronic
1110722267 13:78776845-78776867 AATCATGCATAGCTGGTACTAGG + Intergenic
1110810766 13:79808554-79808576 CAGCTTCCCCAGCTGGCACTGGG - Intergenic
1111002770 13:82206291-82206313 CATCTTCCACGGCTGGCACTAGG - Intergenic
1112199500 13:97261258-97261280 CATCATTCACTGCTGCCACTTGG + Intronic
1113526387 13:110981141-110981163 CTCCCTGCCCAGCTGCCACTGGG + Intergenic
1114349469 14:21834951-21834973 CAGCATTGACTGCTGGCACTGGG + Intergenic
1115675272 14:35666511-35666533 CACCATGCCCAGCCTGGACTGGG + Intronic
1117046400 14:51817289-51817311 GACCATGCACAGCATGCACAGGG + Intergenic
1117651662 14:57914273-57914295 CACCATGCCCGGCTGAGACTGGG - Intronic
1117734115 14:58751895-58751917 CAGCTTCCATAGCTGGCACTGGG - Intergenic
1118200016 14:63663090-63663112 TAGCTTCCACAGCTGGCACTGGG + Intergenic
1118371477 14:65140880-65140902 CACCATGCACAGTTGGATTTAGG + Intergenic
1118667852 14:68089636-68089658 CAAAATGCAAATCTGGCACTTGG - Intronic
1118946922 14:70397589-70397611 CAGCTTCTACAGCTGGCACTGGG + Intronic
1119047306 14:71330461-71330483 CATCATTCACAGCTAGAACTTGG + Intronic
1119266345 14:73265080-73265102 CACCCTGCACATTTGCCACTAGG - Intronic
1121910118 14:97782431-97782453 CTCCATGCAGGGCTGCCACTTGG - Intergenic
1122446560 14:101773845-101773867 CACCATGCTCAGCTGATATTTGG + Intronic
1122491355 14:102117920-102117942 CAGCTTCCCCAGCTGGCACTGGG - Intronic
1122792554 14:104190479-104190501 CACCAAGCACAGCTGGCCACAGG - Intergenic
1122888078 14:104719411-104719433 CACGCTGGGCAGCTGGCACTGGG - Exonic
1123490372 15:20775540-20775562 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1123546873 15:21344627-21344649 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1124126518 15:26942353-26942375 CACCATGCACAGCAGGCTCCAGG + Intronic
1124215668 15:27805718-27805740 CACTGTGCACCTCTGGCACTCGG - Intronic
1124916062 15:33975641-33975663 CACCGTGCCCAGCTGGGACCTGG - Intronic
1125381481 15:39091781-39091803 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1125552264 15:40554282-40554304 CAGGATGCACAGCTGCCATTAGG - Intronic
1125718262 15:41832051-41832073 CAGCTTCCACAGCTGACACTGGG - Intronic
1126215312 15:46147025-46147047 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1126921909 15:53536075-53536097 CAAGAGGCACAGCTGGGACTTGG + Intronic
1127367908 15:58308970-58308992 CTCCATCGAAAGCTGGCACTAGG + Intronic
1129798016 15:78392627-78392649 CACCAGGCACCCCAGGCACTCGG + Intergenic
1130183290 15:81652464-81652486 CGGCTTCCACAGCTGGCACTGGG - Intergenic
1131553764 15:93379481-93379503 CACCCTGCACCCCTGGCTCTAGG - Intergenic
1132123677 15:99200233-99200255 CACCATGCCCTGCTGGCTCTTGG - Intronic
1202955204 15_KI270727v1_random:71843-71865 CAGCCTGCGCAGCAGGCACTCGG + Intergenic
1132518153 16:375499-375521 CACCAGGCTGAGCTGGCACGTGG - Intronic
1132741909 16:1418325-1418347 CACCATCCCCAGCTGGCCTTGGG + Intergenic
1132755489 16:1482524-1482546 AGTCATGCACAGGTGGCACTGGG + Intergenic
1132951207 16:2563417-2563439 CACCATCAACAACTGGCACAGGG - Intronic
1132963143 16:2636753-2636775 CACCATCAACAACTGGCACAGGG + Intergenic
1132997868 16:2832643-2832665 CACCAGGCTCGCCTGGCACTGGG + Intronic
1133016281 16:2942988-2943010 CACCACGCCCAGCTGGCATCTGG + Intronic
1133556804 16:6913536-6913558 CACCCTGAACACCAGGCACTGGG - Intronic
1133797477 16:9057875-9057897 CACCATGCCCAGCCGGCCATGGG - Intergenic
1134508956 16:14830936-14830958 CACCATGCCCAGCTCTCTCTTGG + Intronic
1134696657 16:16229770-16229792 CACCATGCCCAGCTCTCTCTTGG + Intergenic
1134845634 16:17437586-17437608 CACCCTGCACAGCTATCACCTGG + Intronic
1135034555 16:19066146-19066168 CACCACGCCCAGCTGAGACTGGG - Intergenic
1135049810 16:19183738-19183760 CAGCATGCCCAGCTGGTACTTGG - Exonic
1135666135 16:24337100-24337122 CACCATGCCCTGCAGGCATTAGG + Intronic
1135839739 16:25864497-25864519 CATCCTGCATAGCTGACACTTGG + Intronic
1136130714 16:28219167-28219189 CACCATGCCCAGCTGACAAGGGG + Intergenic
1136506725 16:30709139-30709161 CACCACACCCAGCTGGAACTGGG - Intronic
1136555731 16:31006824-31006846 CACCGCGCTCGGCTGGCACTGGG - Intronic
1137334211 16:47532653-47532675 CAGCTTCCACAGCTGGCACTGGG + Intronic
1137552480 16:49448793-49448815 CACCATGCCCAGCTGATATTTGG + Intergenic
1137562366 16:49511003-49511025 CTCCAGGCAGAGATGGCACTTGG - Intronic
1138317241 16:56080861-56080883 CACCATGCCCAGCCAGGACTTGG + Intergenic
1139279844 16:65760926-65760948 CTCCATGCAGAGCAGGCAGTGGG + Intergenic
1139612847 16:68071187-68071209 CAGCAAGCACAGCTGGCAGCTGG - Intronic
1139650465 16:68359658-68359680 CACCAGGCAAAGCCGGCCCTGGG + Exonic
1140031549 16:71343314-71343336 CACGATGCAAAGCTGGGGCTTGG + Intergenic
1141123461 16:81381935-81381957 CATCATGTACATCAGGCACTTGG - Exonic
1142256871 16:89018166-89018188 CCCCAGGCACAGCTGGCTGTGGG - Intergenic
1142804572 17:2364708-2364730 CACAGTGCACAGCTGGCAGAAGG - Intronic
1145098333 17:20051461-20051483 CACTGTGCCCAGCTAGCACTTGG + Intronic
1145974957 17:28978560-28978582 CAGCATGTGCAGCTGGGACTTGG + Intronic
1146055198 17:29577510-29577532 CTCAGGGCACAGCTGGCACTGGG - Intronic
1147114038 17:38285446-38285468 CACCGTGCCCAGCTGAGACTGGG + Intergenic
1148415567 17:47503744-47503766 CACCGTGCCCAGCTGAGACTGGG - Intergenic
1148478167 17:47942421-47942443 GACCATGCCCACCTGGCACAAGG - Intronic
1148635312 17:49144609-49144631 CACCATGCCCAACTGGAGCTAGG - Intronic
1149063663 17:52454811-52454833 CACTATGAACAGCATGCACTTGG - Intergenic
1149878825 17:60267117-60267139 CACCATGCCCAGCTGTAAATAGG - Intronic
1150594659 17:66593533-66593555 CCACATGCACAGCTGAAACTTGG + Intronic
1150717472 17:67584025-67584047 CACCATGCCCGGCCGGCATTGGG + Intronic
1150952913 17:69822493-69822515 CAGCTTCCACAGCTAGCACTGGG - Intergenic
1151292109 17:73157694-73157716 CACCAGGCACTTCTGTCACTTGG + Intergenic
1151490464 17:74430006-74430028 TACCATGCAGGGCTGGCAGTGGG + Intronic
1152097070 17:78278534-78278556 CTTCAAGCACAGCTGGCACCTGG - Intergenic
1152154657 17:78625023-78625045 CACCACGCCCAGCTGGAACAGGG - Intergenic
1152193415 17:78902394-78902416 CACCATGCCCAGCCTGCACTGGG + Intronic
1152228765 17:79104463-79104485 CCCCATGCCCAGCTGGCAGCTGG - Intronic
1152294023 17:79456322-79456344 CACCATGGACATCTGGGGCTGGG + Intronic
1152611825 17:81318771-81318793 CACCATGCCCGGCCGGCACTGGG - Intronic
1154447979 18:14450297-14450319 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1155866742 18:30974647-30974669 CACTATGCACAGCTGGTACCTGG + Intergenic
1156407477 18:36796740-36796762 TTCCATGCACAGATGGCCCTAGG - Intronic
1156538860 18:37890315-37890337 CACCATGAGCAGCTGCCACAGGG - Intergenic
1158197957 18:54909761-54909783 CAGCTTCCACAGCTGGCACCGGG + Intronic
1158568230 18:58574141-58574163 CACCATCCAAATCTTGCACTTGG - Intronic
1158672911 18:59492839-59492861 CTCCATGCACAGTTGTTACTGGG - Intronic
1159623938 18:70670141-70670163 CAGCTTCCACAGGTGGCACTGGG - Intergenic
1159749907 18:72287047-72287069 CCCCATGCACAGATGTGACTTGG - Intergenic
1160122131 18:76140116-76140138 TACCACCCACAGCTGGGACTGGG + Intergenic
1160698346 19:495132-495154 CCCCATGCACCGCAGGCACGCGG - Intronic
1160815240 19:1032437-1032459 CTCCATGCAGAACTGGCACCAGG + Exonic
1161163846 19:2775036-2775058 CAACATCCACAGCTCCCACTGGG + Intronic
1162361807 19:10224887-10224909 CACCATGGGCAGCTTGTACTCGG - Exonic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167625785 19:50588196-50588218 CACCATGCCCAGCCTGCTCTTGG - Intergenic
1168550680 19:57290767-57290789 CTCCAGGAACAGCTGGCACAGGG + Exonic
925515419 2:4675400-4675422 CAGCTTCCACGGCTGGCACTGGG - Intergenic
925830177 2:7886173-7886195 AGCCATGCAAAGATGGCACTCGG - Intergenic
926625552 2:15086644-15086666 CAGCTTCCTCAGCTGGCACTGGG - Intergenic
927922281 2:26982297-26982319 CACCATGCAAAGCAGCCACAGGG + Intronic
930564234 2:52999411-52999433 CACCATGCCCGGCTGGCTCGAGG + Intergenic
930946545 2:57083645-57083667 CACCTTCCATGGCTGGCACTGGG + Intergenic
930971095 2:57397004-57397026 CAACTTCCACAGCTGGCACTGGG + Intergenic
932245316 2:70191739-70191761 CACCATGAACACATTGCACTCGG - Intronic
932902871 2:75719293-75719315 CACCACGCTCAGCTGACATTTGG + Intergenic
933465093 2:82641574-82641596 CACCTTGCTCAGCTGGGGCTGGG - Intergenic
933722527 2:85407422-85407444 CACCATGCCTGGCTGGCACTGGG - Intronic
933755804 2:85637562-85637584 GACCAGGCAGAGCTGCCACTAGG - Intronic
935137574 2:100321494-100321516 CAGCCTGCGCAGCCGGCACTCGG + Exonic
935264734 2:101384590-101384612 CCCCATGCCCAGTTGGCACCAGG - Intronic
936056724 2:109267581-109267603 CACCCATCACAGCCGGCACTCGG - Intronic
937248765 2:120510581-120510603 CACCATGCAGCCCTGGCTCTGGG - Intergenic
937543829 2:122990153-122990175 CCACTTCCACAGCTGGCACTTGG - Intergenic
938120631 2:128630912-128630934 CATCACGCACAGCTGGCACAGGG + Intergenic
942246728 2:174014816-174014838 CACCATGAGCAGCTGGCAGTTGG + Intergenic
942272783 2:174293563-174293585 CACCATGCCCAGCTGCCATTGGG + Intergenic
942695272 2:178635442-178635464 TACCCTGCAAAGCTGACACTTGG - Exonic
942926634 2:181440772-181440794 CACCAGGCACACCTGGCATAGGG + Intergenic
943484618 2:188464424-188464446 CACCACCCATAGCTTGCACTGGG + Intronic
943858516 2:192829000-192829022 CAGCTTCCACAGCTGGCACCAGG - Intergenic
945770311 2:214034684-214034706 CAGCTTCCACAGCTGGCACCAGG + Intronic
947964701 2:234269482-234269504 CACCATGCCCGGCCAGCACTTGG + Intergenic
947997597 2:234541948-234541970 CACCATGCCCAGCTGAGACAGGG + Intergenic
948760353 2:240186370-240186392 CACCATGCAGTGTTGGCAGTAGG + Intergenic
948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG + Intergenic
1168983321 20:2026306-2026328 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1170696309 20:18662407-18662429 CACCATGCCCAGCTGGGGGTGGG + Intronic
1170890268 20:20369580-20369602 CACTGGGCACAGGTGGCACTCGG - Exonic
1172469230 20:35178941-35178963 CACCGTGCCCAGCTTGCGCTTGG - Intergenic
1173884449 20:46445308-46445330 CAGCTTCCACAGCTGGTACTGGG + Intergenic
1175728008 20:61332561-61332583 CACCCTGGGCAGCAGGCACTAGG + Intronic
1175900246 20:62357194-62357216 CACCCAGCACAGCGGGCACCTGG - Intronic
1176408524 21:6434985-6435007 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1177262698 21:18750665-18750687 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1177344558 21:19853385-19853407 CACCTTGCACTGCAGGCATTGGG + Intergenic
1177796969 21:25789032-25789054 CACCACGCCCCGCTGGGACTAGG - Intergenic
1178358463 21:31928309-31928331 CACAAGGCACAGCTTCCACTTGG - Intronic
1178570845 21:33735712-33735734 CACCATGCCCGGCTGGAATTAGG - Intronic
1178599107 21:33980673-33980695 CAAGATGCACAGCTGGCCCCAGG - Intergenic
1179542633 21:42093581-42093603 CCACATCCACAGCTGGCTCTGGG - Intronic
1179684017 21:43043311-43043333 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1182577719 22:31284470-31284492 CACCATTAACAGCAGGCACATGG - Intronic
1182802315 22:33041584-33041606 CACCATGCCCGGCCTGCACTAGG + Intronic
1182928923 22:34154391-34154413 CACCGTGCCCAGCTGGAATTTGG + Intergenic
1183024872 22:35057570-35057592 CAGCTTTCACAGCTGGCACTGGG + Intergenic
1184054161 22:42033253-42033275 CAGCTTCCACAGCTGGCACCAGG + Intronic
1184560812 22:45261991-45262013 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
1184865726 22:47200970-47200992 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1185082613 22:48718239-48718261 CCCCCTGCACAGCAGACACTGGG + Intronic
950505176 3:13390142-13390164 CACCATGCAGTCATGGCACTAGG - Intronic
950865973 3:16189303-16189325 CACCATGCACTGGTGTCTCTTGG - Intronic
953748075 3:45590480-45590502 CAACTTCCACCGCTGGCACTGGG + Intronic
954196577 3:49000687-49000709 CACCAGGCACAGCTGGTAGGTGG - Intronic
954199861 3:49017835-49017857 GATCCCGCACAGCTGGCACTAGG + Exonic
954687967 3:52380691-52380713 CACCATGCACAGGAGGAACAGGG + Intronic
955864982 3:63372562-63372584 CACAAGGCACAGCTGCCCCTGGG + Intronic
961220934 3:125199064-125199086 CACCATGCCCGGCTGACAATAGG + Intronic
961942873 3:130656002-130656024 CAGCTTCCACAGCTGGCACTGGG + Intronic
962785822 3:138767769-138767791 CAGCTTCCACAGCTGGCACTGGG + Intronic
963920142 3:150897523-150897545 CTCCATGCACAGCTGGGAAGAGG - Intronic
964353273 3:155824000-155824022 CACCATGCCCAGCCTGCAATAGG + Exonic
964590601 3:158359569-158359591 CAGCTTCCACAGCTGGCACCGGG + Intronic
965567526 3:170136450-170136472 CACGAAGCACAGCTGTCACCCGG - Exonic
967015639 3:185479240-185479262 CACCATGCCCAGTGGACACTGGG + Intronic
968189852 3:196659901-196659923 CAGCCTGCACAGCTGCCACCTGG + Exonic
968538529 4:1150375-1150397 CAGCTTCCACAGCTGGCACTGGG + Intergenic
968607735 4:1543411-1543433 CACCATCTGCAGCTGGCCCTTGG - Intergenic
969245152 4:5927152-5927174 CTCCAGGCACAGCTGGCTCCAGG - Intronic
970716291 4:18928871-18928893 CACCACGCCCAGCTGTAACTTGG + Intergenic
970932950 4:21534790-21534812 CACCATCCCCTGCAGGCACTGGG - Intronic
970959761 4:21857951-21857973 CAGCTTCCACAGCTGGCACTGGG - Intronic
971869300 4:32215588-32215610 CAGCTTCCACAGCTGGCATTGGG + Intergenic
972579236 4:40380151-40380173 CACCATGCCCGGCTGGCCCAAGG - Intergenic
974165140 4:58191575-58191597 CACCCAGCAGAGCTGGTACTGGG - Intergenic
975324254 4:73041987-73042009 CACCACGCCCAGCTGGTAGTTGG - Intergenic
975498437 4:75058723-75058745 CTCCATGCCCAGCTCGCCCTTGG + Intergenic
976647443 4:87400516-87400538 CAGCTTCCACAGCTGGCACTGGG - Intergenic
976734429 4:88295986-88296008 CAGCTTCCACAGCTGGCACTGGG + Intergenic
976822664 4:89224089-89224111 CACCACGCCCAGCCAGCACTAGG + Intergenic
977359194 4:95981788-95981810 AACCTTCCACAGCTGGCACCAGG - Intergenic
977606084 4:98986216-98986238 CACCATGCCCAGCCGGAAATGGG + Intergenic
977658333 4:99550932-99550954 AATCATGCACAGCTCCCACTTGG - Exonic
978229801 4:106385183-106385205 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
980243289 4:130203649-130203671 CAACTTCCACAGCTGGCACTGGG - Intergenic
980253528 4:130348788-130348810 CAGCTTCCACAGCTGGCACTGGG + Intergenic
980306167 4:131064221-131064243 CCACTTCCACAGCTGGCACTGGG + Intergenic
980493424 4:133560324-133560346 CAGCTTCCACAGCTGGGACTAGG + Intergenic
980702029 4:136443170-136443192 CAGCTTCCACAGCTAGCACTGGG - Intergenic
980745099 4:137001989-137002011 CACCTTCCATGGCTGGCACTGGG - Intergenic
980932379 4:139194297-139194319 CCACATGGATAGCTGGCACTGGG + Intergenic
981330024 4:143497745-143497767 CACCATGCCCAGCCGACCCTGGG - Intergenic
981674962 4:147332176-147332198 GACCATGCGCAGTTTGCACTGGG - Intergenic
982157933 4:152539853-152539875 CAGCTTCCACAGCTGGCACCAGG + Intergenic
982642490 4:157980506-157980528 CACCATGGAAAGCTGGGAATGGG + Intergenic
982902069 4:161019171-161019193 CACCCTGAAAAGCTGGGACTTGG - Intergenic
984102029 4:175498790-175498812 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
984995116 4:185423145-185423167 CACCGCGCCCAGCTGGCACAGGG + Intronic
985056424 4:186039703-186039725 GACCAAGCACCGCTGGCACACGG + Intergenic
985426131 4:189832414-189832436 CACACTGCACAGCTGACATTGGG + Intergenic
986433401 5:7704203-7704225 GAACGTGCACACCTGGCACTTGG + Intronic
986733597 5:10652515-10652537 CACCATGGGAAGCTGTCACTGGG + Intergenic
986923618 5:12718024-12718046 CAGCTTCCACAGCTAGCACTAGG - Intergenic
987951841 5:24686641-24686663 CAGCTTCCACAGCTGGCTCTGGG + Intergenic
988346442 5:30042804-30042826 CAGCTTCCACTGCTGGCACTGGG - Intergenic
989520778 5:42397296-42397318 CAGCTTCCACAGCTGGCACTGGG - Intergenic
991359171 5:65802383-65802405 CAGCTTTCACAGCTGGCACTGGG + Intronic
991974597 5:72173838-72173860 CACCACGCCCAGCAGGAACTAGG - Intronic
991983593 5:72259179-72259201 CACCATGCCTAGCTGGGAATCGG - Intronic
992721136 5:79562224-79562246 CATCACACCCAGCTGGCACTGGG + Intergenic
992838823 5:80667708-80667730 CAGCTTCCACAGCTGGCACCAGG + Intronic
993236044 5:85311651-85311673 CAGCTTTGACAGCTGGCACTGGG - Intergenic
994755459 5:103789146-103789168 CACCATGCCCAGCTGAATCTGGG + Intergenic
994943779 5:106359220-106359242 CTCCATGCACAGCTCACAATAGG - Intergenic
996366536 5:122707250-122707272 CACCATGCCCAGCTGACAAAGGG + Intergenic
996692257 5:126352763-126352785 CAGCAGGTACAGCTGGCACATGG - Intergenic
997352928 5:133243961-133243983 CAGCCTGCACAGCGGCCACTCGG - Intronic
997858004 5:137390730-137390752 CACCATGCCTTGCTGGCAGTAGG - Intronic
998588298 5:143451165-143451187 CACCATGCACAGCATGGGCTGGG + Intergenic
999778713 5:154831601-154831623 CACCATGCCCAGCTAGGACTCGG + Intronic
1000266370 5:159641715-159641737 CAGCTCCCACAGCTGGCACTGGG - Intergenic
1000472345 5:161660881-161660903 CAACTTCCACAGCTGGCACCGGG - Intronic
1000597501 5:163232605-163232627 CACCATGCACAGCCAGAAGTCGG + Intergenic
1001001667 5:168013313-168013335 CACCGTGCCCAGCTGAAACTTGG - Intronic
1001581658 5:172802631-172802653 CACCATGCCCAGCTAGAACCAGG + Intergenic
1001773068 5:174310165-174310187 CACCATGCCCAGCAGGCATGGGG + Intergenic
1001819570 5:174699327-174699349 TTCCATGCACAGCTGGCGTTGGG - Intergenic
1003119352 6:3307130-3307152 CGACATGCACAGGTGGCACTTGG + Intronic
1003181428 6:3795186-3795208 CACCATGCCCAGCTGGGATCTGG + Intergenic
1003544291 6:7045414-7045436 CTCCATGCACAGATGGCACAGGG - Intergenic
1005945248 6:30590577-30590599 CACCACCCACAGCTGGCAATTGG - Exonic
1006830189 6:36963772-36963794 CATCAGGCACAGCTGTCTCTAGG + Intronic
1007619775 6:43204826-43204848 CACCACGCTCAGCCAGCACTGGG - Exonic
1007650333 6:43415966-43415988 CACCATGCCCAGCTGCTGCTGGG + Intergenic
1008122367 6:47633243-47633265 CACCATGCCCAGCTGTCATCTGG + Intergenic
1009846805 6:69145347-69145369 CAGCTTCCACAGCTGGCACTGGG + Intronic
1010561540 6:77357549-77357571 CACCGCGCCCAGCTGGTACTAGG + Intergenic
1012213312 6:96551091-96551113 GGCCCTTCACAGCTGGCACTGGG + Intronic
1012231079 6:96762070-96762092 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
1012696385 6:102390270-102390292 CAGCTTCCACGGCTGGCACTGGG + Intergenic
1012752862 6:103184847-103184869 CAGCTTCCACAGCTGGCACCAGG - Intergenic
1013136974 6:107291722-107291744 CACCGTGCCCAGCTGGCACTTGG - Intronic
1013201800 6:107904967-107904989 CACCATGCCCAGCTGGGAGTTGG - Intronic
1015143414 6:129959547-129959569 CAGCTTCCACAGCTGACACTGGG - Intergenic
1016595074 6:145789645-145789667 CACCTTACACATCTGGCAGTTGG - Intergenic
1016758760 6:147715413-147715435 CAGCTTCCACAGCTGGCACTGGG + Intronic
1019377279 7:699545-699567 CTCCCTGCAGAGCTGGGACTTGG + Intronic
1019497974 7:1349352-1349374 CACCAGCCACGGCTGTCACTGGG + Intergenic
1019697880 7:2457654-2457676 CACCATGCCCAGCTGGCCATGGG + Intergenic
1019853521 7:3582514-3582536 CACCCTCCACAGCAGACACTGGG - Intronic
1021518788 7:21517506-21517528 CACCATGCCCAGCTGGTCCTGGG + Intergenic
1022496596 7:30856800-30856822 CAGCATGCAGAGCTGGTACAAGG + Intronic
1023929039 7:44693772-44693794 CACCTGGCACAGCCGGCACAGGG - Intronic
1024638509 7:51310328-51310350 CACCTTGGACAACTGGCACCAGG + Intronic
1025054580 7:55754561-55754583 CACCATGCTCAGCAGTCACAAGG - Intergenic
1025926237 7:65962582-65962604 CACCATGGCCAGCTGAAACTCGG - Intronic
1026916999 7:74126459-74126481 CACCATGCCCAGCTGACGCCAGG + Intergenic
1028378815 7:90176012-90176034 CAGCTTCCACAGCTGGCACCAGG + Intronic
1029899427 7:104023154-104023176 CAGCTTCCACAGCTGGCACCAGG - Intergenic
1030513960 7:110518779-110518801 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1031766118 7:125779864-125779886 CACCTTGCACTGCTAGAACTGGG + Intergenic
1031824558 7:126546914-126546936 CACCTGGCACAGTTGGTACTGGG + Intronic
1031876786 7:127150797-127150819 CACCATTCTCAGCTGACCCTTGG + Intronic
1032240341 7:130154588-130154610 CAGGCTGCGCAGCTGGCACTTGG - Intergenic
1032411205 7:131694297-131694319 CACCATCCACTGCAGGCACTTGG - Intergenic
1033363208 7:140652495-140652517 CACCATGCCTGGCTGACACTTGG + Intronic
1034674380 7:152882057-152882079 CACCATGCCCAGCAGCGACTTGG - Intergenic
1035123376 7:156588756-156588778 CACCATGCCCAGCCTGGACTGGG - Intergenic
1035897949 8:3425299-3425321 CACCTTGCCCAGCTGGGACAGGG - Intronic
1036560104 8:9894423-9894445 CTCCAGGCAAAGCTGGAACTTGG - Intergenic
1036915361 8:12799214-12799236 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1037492039 8:19405849-19405871 CAGCATGCCCAGCTGGCCGTGGG + Exonic
1037815387 8:22109222-22109244 CAGCGTGCACAGCTGCGACTCGG - Exonic
1038005595 8:23427253-23427275 CAGCAAGAACAGCTGGCACAAGG + Intronic
1040659540 8:49554738-49554760 CACATGGCACAACTGGCACTGGG + Intergenic
1041205401 8:55494232-55494254 CAGCACCCACAGCTGGCACTAGG + Intronic
1043082448 8:75783926-75783948 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1043755710 8:84000780-84000802 CCCCAATCACAGCTGGTACTTGG - Intergenic
1044344765 8:91092319-91092341 CACCATGCCCGGCTGGAACTAGG - Intergenic
1044363884 8:91320566-91320588 CATCATGCACAGGTTGCAGTGGG + Intronic
1046395156 8:113631939-113631961 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1046911013 8:119626768-119626790 CACCATGGAAAGGTGGCACTGGG + Intronic
1049518627 8:143076445-143076467 CTCCATGCACAGCTCTCCCTGGG - Intergenic
1049974683 9:850105-850127 CACCACGCCCAGCTGACAATAGG + Intronic
1050182428 9:2935011-2935033 CAGCTTCCACGGCTGGCACTGGG - Intergenic
1050484058 9:6115193-6115215 CAGCTTCCACAGCTAGCACTGGG - Intergenic
1050965369 9:11795151-11795173 CACCTTGCACTACTGGCACATGG - Intergenic
1053128308 9:35600326-35600348 CAGCTTCCACAGCTGGCACTGGG - Intergenic
1055572688 9:77632666-77632688 CAGCTTCCACTGCTGGCACTGGG - Intronic
1055890819 9:81122081-81122103 CAGCTTCCACAGCTGGCACCAGG + Intergenic
1056539654 9:87560282-87560304 CACCATGCCCAGCCTGCCCTTGG + Intronic
1057216105 9:93229808-93229830 CACAATGCACCGCTTGCCCTTGG - Exonic
1057248873 9:93482858-93482880 CACCATGCACAGCGGTCACTAGG - Intronic
1058077783 9:100668114-100668136 CAGCTTCCACAGCTGGCACCAGG - Intergenic
1058703680 9:107621499-107621521 CACCATCCACATTTGGTACTAGG - Intergenic
1060391449 9:123280858-123280880 CACCATGCACGGCCGCCACTGGG + Intergenic
1060506900 9:124204625-124204647 CACCATGCCCAGCTACCACCAGG + Intergenic
1060541981 9:124437324-124437346 CACCATGCACAGCCAGCAACTGG - Intergenic
1061066719 9:128282887-128282909 CACCATGCCCATCTGTCACTGGG - Intronic
1061212428 9:129201651-129201673 CTCCATGCTCAGCCCGCACTGGG + Intergenic
1188859760 X:35243379-35243401 CAGCTTCCACAGCTGGCACTGGG + Intergenic
1189083687 X:37998433-37998455 CAGCTTCCACAGCTGGCACCGGG - Intronic
1189137988 X:38569571-38569593 CTCCATGCACACCTGGAAGTAGG - Intronic
1190369607 X:49727946-49727968 CAGCTTCCACAGCTGGCACCGGG - Intergenic
1191720413 X:64224169-64224191 CACCAGACACAGCAGACACTGGG + Intergenic
1192344169 X:70287761-70287783 CATCATTCACAGCTAGAACTTGG + Exonic
1192454101 X:71263174-71263196 CACCATGCCCAGCCCCCACTGGG - Intergenic
1193108314 X:77703474-77703496 CAGCATCCACAGCTGGCACCAGG + Intronic
1193207129 X:78762321-78762343 CACAATGCATAGATTGCACTGGG - Intergenic
1195178909 X:102338377-102338399 CAGCCTCCACAACTGGCACTTGG + Intergenic
1197235737 X:124060412-124060434 CACCATGCCCAGCTAACAGTAGG + Intronic
1199751461 X:150823572-150823594 CACCACGCCCAGCTGAAACTGGG + Intronic
1200115580 X:153768409-153768431 CACCTTGTACAGCTGGCCCTGGG - Exonic
1200411674 Y:2867829-2867851 CAGCTTCCACAGCTGGCTCTGGG + Intronic