ID: 912384761

View in Genome Browser
Species Human (GRCh38)
Location 1:109265788-109265810
Sequence CTCTGGACAAGGAGCCTGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912384761_912384773 26 Left 912384761 1:109265788-109265810 CCCCACAGGCTCCTTGTCCAGAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 912384773 1:109265837-109265859 CCATGCAAGCCAGGTGTCATCGG 0: 1
1: 0
2: 0
3: 16
4: 127
912384761_912384767 -4 Left 912384761 1:109265788-109265810 CCCCACAGGCTCCTTGTCCAGAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 912384767 1:109265807-109265829 AGAGTCTGTGACCCTGAGGATGG 0: 1
1: 0
2: 1
3: 21
4: 350
912384761_912384765 -8 Left 912384761 1:109265788-109265810 CCCCACAGGCTCCTTGTCCAGAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 912384765 1:109265803-109265825 GTCCAGAGTCTGTGACCCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 225
912384761_912384770 17 Left 912384761 1:109265788-109265810 CCCCACAGGCTCCTTGTCCAGAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 912384770 1:109265828-109265850 GGCCAGTGTCCATGCAAGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 145
912384761_912384774 27 Left 912384761 1:109265788-109265810 CCCCACAGGCTCCTTGTCCAGAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 912384774 1:109265838-109265860 CATGCAAGCCAGGTGTCATCGGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912384761 Original CRISPR CTCTGGACAAGGAGCCTGTG GGG (reversed) Exonic
900584906 1:3428089-3428111 CCCAGGACCAGGAGCGTGTGCGG + Intronic
900779152 1:4606256-4606278 CTCTCGACAAGGAGCCAGAGTGG + Intergenic
901004756 1:6166322-6166344 CTCTGGACCAGGGGGCCGTGGGG + Intronic
902446422 1:16468080-16468102 GTCTGCACAAGGTGCCTGTTGGG - Intergenic
903170322 1:21548327-21548349 CTCAGGACAAGGAGAGGGTGGGG - Intronic
904982848 1:34521489-34521511 CTCTGGGCAAGGTAGCTGTGAGG - Intergenic
905489565 1:38332947-38332969 CTCTGGATGAGAAGCCAGTGGGG - Intergenic
906159870 1:43640123-43640145 CTCTGGACAAAGAGCCTGACAGG - Intergenic
908503428 1:64769385-64769407 CCCTAGACAAGGAGGCTGGGAGG - Intronic
911313708 1:96329797-96329819 GTCTGCACAGGGAGTCTGTGAGG - Intergenic
912384761 1:109265788-109265810 CTCTGGACAAGGAGCCTGTGGGG - Exonic
912471246 1:109908480-109908502 CTTTGGACATGTAGACTGTGGGG - Intergenic
912971395 1:114286987-114287009 CTCTGGACACACTGCCTGTGGGG - Intergenic
913524850 1:119681052-119681074 CTGTGGACAAGGAGATAGTGAGG + Intronic
913998672 1:143673761-143673783 GTCTGCACAAGGTGCCTGTTGGG + Intergenic
914509152 1:148316148-148316170 GTCTGCACAAGGTGCCTGTTGGG + Intergenic
915346607 1:155200742-155200764 CCCAGGACAAGGAGGCTGGGTGG - Intronic
915602398 1:156930460-156930482 CTCTGGGGAGGGAGCCTGGGTGG + Intronic
916145897 1:161739118-161739140 CTGTGAACATGAAGCCTGTGAGG + Intergenic
916326432 1:163565053-163565075 CTTTGGACAAAGAGCACGTGAGG - Intergenic
917250023 1:173048839-173048861 CTCTGGAAAAGAAGTCTGAGAGG - Intronic
917664371 1:177209459-177209481 CCTTGGCCAAGCAGCCTGTGAGG - Intronic
917830274 1:178875784-178875806 CTCTGGGGAAGGAGCCAGTAGGG + Intronic
920735838 1:208532519-208532541 CTCTGGAAGTGGAGCCTCTGGGG - Intergenic
920866896 1:209760429-209760451 CTCTGGACAAGGAGGGTGGGTGG + Intronic
922549751 1:226485274-226485296 CTCTGGGCAGGAAGCCTGTGAGG + Intergenic
924662696 1:246036376-246036398 CTCTGGAGAAGGAGACTGCGGGG - Intronic
1062952935 10:1518409-1518431 CTGTGGAAACGTAGCCTGTGAGG + Intronic
1063062941 10:2577241-2577263 CTCTGGACAAACTGCCTGTGGGG + Intergenic
1063746630 10:8891085-8891107 CTCTGGACACACTGCCTGTGGGG - Intergenic
1065495928 10:26328132-26328154 CCCTGGACAAGGAGCCCTTCTGG - Intergenic
1067779660 10:49190542-49190564 CACTGGCCCAGGAGCTTGTGAGG + Intergenic
1067962805 10:50875568-50875590 CTCTGGATAAAGAGACTGTTAGG - Intronic
1068226602 10:54114754-54114776 ATCTGAACAAGGAGCCTTTCAGG + Intronic
1068444424 10:57103182-57103204 CTCTGGGTAAGGAGCTTGTTTGG - Intergenic
1070718508 10:78739998-78740020 CTCAGGGCAAGGAGGCTGAGAGG + Intergenic
1071399857 10:85258578-85258600 CTGGGGACAGGGAGCATGTGAGG - Intergenic
1072034114 10:91548935-91548957 CTCAGAACAAAGACCCTGTGAGG - Intergenic
1073356167 10:102856101-102856123 CTCTGGGGAGAGAGCCTGTGAGG + Intronic
1073435545 10:103513742-103513764 CTCTGGCCTAGGAGCTGGTGAGG + Intronic
1074617484 10:115083943-115083965 CTCTGCACAAGGACCCAGTGGGG - Intergenic
1075617983 10:123905378-123905400 CACTGGACAAGGAGCCACTTTGG + Intronic
1076426438 10:130370575-130370597 CTCTGCTCTGGGAGCCTGTGGGG + Intergenic
1077037537 11:502637-502659 CTCAGGACAGGCAGACTGTGCGG + Exonic
1077311119 11:1889508-1889530 CTCTGGGCACGGAGGCTCTGGGG + Exonic
1077342962 11:2034146-2034168 CTCTGGCCTTGGAGCCTGGGTGG + Intergenic
1078566005 11:12414895-12414917 CTTTGGACAAGAAGGCTTTGGGG + Intronic
1079098353 11:17525746-17525768 CACTGCAAAAGGAGCCTGTTTGG - Intronic
1079105191 11:17567192-17567214 CTCTGGACATGTCACCTGTGTGG - Intronic
1079114016 11:17629137-17629159 CTGTGGACTTGCAGCCTGTGTGG + Exonic
1080663148 11:34313562-34313584 CATTGGACAAGGAGGATGTGCGG + Intronic
1081484174 11:43515331-43515353 CTCTGGTCAGGGAGCCTGCGTGG - Intergenic
1081579865 11:44344818-44344840 CTAAGGAGAAGGAGGCTGTGAGG + Intergenic
1081592872 11:44437183-44437205 TACTGGAGAAGGAGTCTGTGAGG + Intergenic
1083247066 11:61436894-61436916 CTCTGGATTGGGAGCCTTTGGGG + Intronic
1083328629 11:61886396-61886418 CTCTGGGGAAGGGGCCTGGGTGG + Intronic
1083626266 11:64073643-64073665 GTCTGGGCCGGGAGCCTGTGAGG + Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1083684389 11:64368018-64368040 CCCTGGACAAGGGGGCAGTGGGG - Intronic
1083928124 11:65821512-65821534 CTATGGACAGTGAGCCTCTGAGG + Intergenic
1084420493 11:69058251-69058273 CTCTCCACAAGGCACCTGTGGGG - Intronic
1084518293 11:69648103-69648125 CTCTGGAGAGGAAGCGTGTGAGG - Exonic
1085192930 11:74644594-74644616 CTCTGGCTAAAGAGCCTGGGTGG - Intronic
1089853282 11:121518393-121518415 TTCTGGTGAAGGAGCATGTGAGG + Intronic
1089858185 11:121565814-121565836 CTCTTGAGAAGGAGCCTTTGTGG - Intronic
1090406625 11:126479655-126479677 CACTGGACAAAGAGCACGTGTGG + Intronic
1091334360 11:134755288-134755310 CTCTGGAACAGGAGCCAGTCTGG - Intergenic
1202825948 11_KI270721v1_random:89335-89357 CTCTGGCCTTGGAGCCTGGGTGG + Intergenic
1091609562 12:1993905-1993927 CTCTGAACAATGAACTTGTGAGG + Intronic
1094199619 12:27782128-27782150 TTCAGGACCAGGACCCTGTGAGG - Intronic
1094433663 12:30397841-30397863 CTCTGGAGGAGGAGGCTGAGGGG + Intergenic
1096578448 12:52569429-52569451 CACTGGACATGGAACATGTGTGG - Intronic
1098224618 12:68308784-68308806 CTCTGGACAAGGAGCCTCTTTGG - Intronic
1098784363 12:74731476-74731498 CTGTGGACAAGAAGCCTGAGTGG + Intergenic
1100308850 12:93376540-93376562 CTCTGGCAGAGGGGCCTGTGAGG - Intergenic
1103447767 12:121005395-121005417 CTCTGGACCAGGAGCTCCTGAGG - Intronic
1103907733 12:124335961-124335983 CTCTGGGGAAGGAGTGTGTGGGG + Intronic
1103972085 12:124678753-124678775 AGCTGTCCAAGGAGCCTGTGGGG - Intergenic
1104269154 12:127266767-127266789 CCCTGGGCAGGGAGGCTGTGGGG + Intergenic
1104584248 12:130035141-130035163 CTGTGGACCAGGAGCCCCTGGGG + Intergenic
1104992171 12:132631869-132631891 CTGTGGGGATGGAGCCTGTGAGG - Intronic
1105675621 13:22668718-22668740 CCCTGGAAAGGGAGCTTGTGGGG - Intergenic
1107832675 13:44388531-44388553 CTTTCAACAAAGAGCCTGTGAGG + Intronic
1108461387 13:50670936-50670958 CTGTGGACCTGGAGCCTTTGTGG - Intronic
1108472238 13:50779092-50779114 CTTTGGACTAGAAGCCTTTGAGG - Intronic
1108706220 13:52990573-52990595 CAATGGATAAGGGGCCTGTGAGG + Intergenic
1112609945 13:100946227-100946249 CTCTGGAAGAGGATGCTGTGGGG - Intergenic
1113085723 13:106567806-106567828 CCCGGGACAAGGAGCGCGTGCGG - Exonic
1113680112 13:112237972-112237994 CTCTGGTCCAGGAGGCTGTGGGG - Intergenic
1114776880 14:25494082-25494104 GTCTGGAGAAGACGCCTGTGGGG + Intergenic
1115910918 14:38255690-38255712 CCCTGGAGAACGAGCCTTTGCGG - Exonic
1116713032 14:48393579-48393601 CCCTGGAGAAGGAGCCTGCCAGG - Intergenic
1117071680 14:52063216-52063238 CTTTGGAGACAGAGCCTGTGCGG - Intronic
1117120562 14:52563923-52563945 CTGTGGAGAATGGGCCTGTGGGG - Intronic
1118126450 14:62909725-62909747 CTCTGGACAAATAGACTGTGTGG - Intronic
1118327687 14:64792650-64792672 CTCTGGAGAAGGAGGTTGAGAGG - Intronic
1119414334 14:74459643-74459665 CTCTGGTCCAGGAGCCTGTGGGG + Intergenic
1119711367 14:76824913-76824935 CTCTGGACAAGTAGAGTCTGGGG - Intronic
1121332277 14:93057128-93057150 CTCTGGGCAAGTCGCCTGTGAGG - Intronic
1121790784 14:96698122-96698144 ATCTGGAAGAGGAGGCTGTGGGG - Intergenic
1122174837 14:99909115-99909137 CACTGGACAATGAGCCCTTGAGG - Intronic
1202905987 14_GL000194v1_random:72787-72809 CTCTGGCCCTGGAGTCTGTGTGG - Intergenic
1124350847 15:28954596-28954618 CTCCAGACAGGAAGCCTGTGGGG + Intronic
1125541548 15:40472475-40472497 CCCTGGACAAGGAACTTCTGAGG - Exonic
1126073574 15:44886912-44886934 CTCTGGAACAGCAGCCTGAGTGG + Intergenic
1126546754 15:49882244-49882266 CTCTGGGCTGGGACCCTGTGGGG - Intronic
1127427985 15:58874764-58874786 CTCTGGACAGGTAGCCTGCTAGG - Intronic
1127647662 15:60974378-60974400 GTATAGACAAGGAGCCTGAGAGG - Intronic
1129200899 15:73998561-73998583 CTGAGGACAAGGAGCTTCTGGGG + Intronic
1131539539 15:93264760-93264782 CTCTGCAGAAGAATCCTGTGGGG - Intergenic
1134996490 16:18742900-18742922 ATCTGGACAAGTGGTCTGTGAGG + Intergenic
1135232374 16:20721109-20721131 CTTTGGAGTAGAAGCCTGTGAGG + Intronic
1136465298 16:30438928-30438950 CACTGGACAGGGAGCCTGGAAGG - Intergenic
1141963678 16:87426576-87426598 CTCTGGAGGGGGAGGCTGTGTGG - Intronic
1142365361 16:89647150-89647172 CTGGGGACAAGGAGCGTGTGTGG - Intronic
1143421186 17:6793859-6793881 CTCTGCACAAAGTGGCTGTGAGG - Intronic
1144880008 17:18426225-18426247 CTCTGCAGAAGGGGCCAGTGTGG + Intergenic
1145152225 17:20518159-20518181 CTCTGCAGAAGGGGCCAGTGTGG - Intergenic
1146008785 17:29178642-29178664 CCATGGACAAAGAGCCAGTGAGG + Intronic
1146163579 17:30572375-30572397 CTCTGCAGAAGGGGCCAGTGTGG - Intergenic
1146407803 17:32554273-32554295 CTCTGTACAATTAGACTGTGTGG + Intronic
1147580571 17:41625194-41625216 CTCTGCAGAAGGGGCCAGTGTGG - Intergenic
1147667921 17:42160301-42160323 CTGTGGACAAGGAGGGTCTGGGG + Exonic
1147772895 17:42879755-42879777 CTCCGGCCACGGAGCCTGAGTGG - Intergenic
1148805267 17:50260763-50260785 CACAGGACAAGCAGCCTGTGTGG + Intergenic
1151744957 17:76007080-76007102 CACGGGCCAAGGAGCCAGTGGGG - Exonic
1152912060 17:83010559-83010581 CTCTGCACATGCAGCCTGGGAGG - Intronic
1153332398 18:3887169-3887191 CTCTGCAGAGGGAGTCTGTGTGG + Intronic
1153528151 18:6016885-6016907 CTGTGGAGAGAGAGCCTGTGGGG + Intronic
1153917473 18:9758647-9758669 CACTGAACCAGGAGCCTGTGAGG + Intronic
1155627931 18:27858055-27858077 CTCTAGATAAGGAGCCTGTCAGG - Intergenic
1156538932 18:37891012-37891034 CTCTGGCCAAGGATTCTGGGTGG + Intergenic
1157602778 18:48904426-48904448 TTCAGGCCAAGGGGCCTGTGTGG + Intergenic
1158008452 18:52700519-52700541 TTCATGAAAAGGAGCCTGTGGGG - Intronic
1158988010 18:62838689-62838711 CTCTGATCAAGGAGCCTGCATGG - Intronic
1160411416 18:78677780-78677802 CCCTGGAAAAGGATCCTGAGAGG - Intergenic
1161104682 19:2437332-2437354 CTTTGGACAAGGAGGCCCTGTGG + Intronic
1161663446 19:5560886-5560908 CACTGCACAAAGGGCCTGTGGGG + Intergenic
1161937164 19:7379114-7379136 TGCTGGACAATCAGCCTGTGGGG - Exonic
1163724215 19:18913345-18913367 CTCTGGACATGGGGCCACTGTGG + Intronic
1163738449 19:18995963-18995985 CTCTGGAGGAGGAGCCTGCAGGG + Intronic
1164399089 19:27890525-27890547 CTCTGGAGTAAGAGCCTGAGAGG - Intergenic
1165595879 19:37011005-37011027 CTCTGGACAAGTCACCTGTTTGG + Intronic
1165780934 19:38433883-38433905 CTCTGGGTTAGGGGCCTGTGGGG + Intronic
1166741069 19:45115125-45115147 CTCTGGACAATAAGCCTGGAAGG - Intronic
1167300380 19:48674279-48674301 CTCTGGACACTGAGCCTGATGGG - Intergenic
1167672147 19:50859471-50859493 CTGAGGGCCAGGAGCCTGTGAGG - Intronic
925159707 2:1675527-1675549 TGCCGGACAAGGAGCCTGTAAGG - Intronic
925444709 2:3917905-3917927 ATCTTGACAAGAACCCTGTGAGG - Intergenic
926427298 2:12750693-12750715 CACAGGCCAAGGAGCCAGTGTGG + Intergenic
927295981 2:21453480-21453502 ATCTGGTCAAGGACCCTCTGTGG + Intergenic
927913042 2:26915029-26915051 CTCTGGAATAGGACCCTGAGAGG - Intronic
927992272 2:27456583-27456605 CTGTGGGCAAAGAGCCTGGGAGG - Exonic
928946670 2:36778240-36778262 CTCTGGAGTAGGAGAGTGTGGGG - Intronic
931087107 2:58844730-58844752 CTCTGAACAAGGATCATGTTTGG + Intergenic
932005920 2:67926906-67926928 CCCTGGACCAAGAGCCTGTAGGG + Intergenic
932478612 2:72024681-72024703 CTCTGTAAAAGGAGCCTGAAGGG + Intergenic
932788774 2:74633535-74633557 ATATAGCCAAGGAGCCTGTGGGG - Intronic
932851253 2:75189254-75189276 CTCTGGGCAAGACCCCTGTGAGG + Intronic
934039469 2:88115987-88116009 CTCTGCACCAGGAGGCTCTGAGG + Intergenic
934500610 2:94857726-94857748 CTCTGGCCCTGGAGTCTGTGTGG + Intergenic
935373532 2:102372264-102372286 CTCTTGACAACAAGCCAGTGAGG - Intronic
936587152 2:113768073-113768095 CACTGGACATGGATCCTGTCTGG - Intergenic
936670759 2:114653361-114653383 CTCTGGAGAAGGAAACTTTGTGG + Intronic
937105051 2:119303869-119303891 CGCATGACAAGGAGCCTGTGGGG + Intronic
943700144 2:190980485-190980507 CTCTGGCCAAGGAGCCCCTCGGG - Intronic
944021801 2:195114459-195114481 CACAGGACAAGTGGCCTGTGAGG + Intergenic
947168361 2:227286027-227286049 CTCTCCACAAGGAGGCTGCGTGG + Intronic
948384857 2:237575043-237575065 CTCTGAACAAGGGGCCCGCGAGG - Exonic
948737568 2:240019170-240019192 CTCTGAGGAAGGAGGCTGTGGGG - Intronic
948831208 2:240599142-240599164 CTCTTGCCAAGCAGGCTGTGGGG + Intronic
1168890458 20:1292573-1292595 TTCCTGATAAGGAGCCTGTGTGG - Intronic
1169414690 20:5405808-5405830 GTCTGGAGTAGGAGACTGTGTGG + Intergenic
1169715751 20:8615945-8615967 ATCTGGAGAAGGACCCTGTTGGG - Intronic
1170159153 20:13295098-13295120 CTCTGACCCAGGAGCCTGGGAGG - Intronic
1170585236 20:17729375-17729397 CTCAGAAAAAGGAGCCTGTTGGG - Intronic
1171313952 20:24169641-24169663 CTCTGGACACACTGCCTGTGGGG + Intergenic
1171341499 20:24432178-24432200 CTTTGGACTAGAAGGCTGTGGGG - Intergenic
1171891836 20:30724432-30724454 CTCTGGCCCTGGAGTCTGTGTGG + Intergenic
1173597231 20:44266602-44266624 CTCAGATCAAGGTGCCTGTGGGG + Intronic
1174658946 20:52193964-52193986 ATCTGAACAAGGAGCCGGGGAGG + Intronic
1176027682 20:62994118-62994140 CTCTGGACCAGGAGCCTGCCTGG - Intergenic
1176625344 21:9087543-9087565 CTCTGGCCCTGGAGTCTGTGTGG - Intergenic
1180150769 21:45946111-45946133 CACGGGCCAAGGAGCCTCTGGGG - Intergenic
1181681921 22:24501407-24501429 CTATCCCCAAGGAGCCTGTGGGG + Intronic
1183337828 22:37260690-37260712 ATCTGGACATGGAGGTTGTGGGG + Intergenic
1184987547 22:48145930-48145952 TCCCTGACAAGGAGCCTGTGGGG + Intergenic
949577760 3:5355490-5355512 ACCTGGGCAAGGAGGCTGTGTGG + Intergenic
950845501 3:16011836-16011858 TTCTGGAGAAGGAGCTTATGAGG - Intergenic
954412707 3:50377978-50378000 CTCTGGACAAGGAAGGGGTGGGG - Intronic
960992884 3:123323243-123323265 CTCTGGAGAAGGAGGCTGCCAGG - Intronic
961651887 3:128420954-128420976 CTCGGGACAAGGAGGCTCTCAGG + Intergenic
962860463 3:139395269-139395291 CTCAGGACAAGGAGGCTGGTAGG + Intergenic
963103011 3:141623585-141623607 CTCGGGAAAAGGAGCCCCTGGGG + Intergenic
968126800 3:196166055-196166077 TTCTGGCCAAGGGACCTGTGTGG - Intergenic
969196386 4:5566853-5566875 CTCTGGAGTAGGAACGTGTGTGG - Intronic
969657278 4:8505501-8505523 CCCTGGACAGGCAGCCGGTGTGG + Intergenic
971177811 4:24297343-24297365 CTCTGAACCAGTAGGCTGTGAGG + Intergenic
973821771 4:54668099-54668121 ACCTTGATAAGGAGCCTGTGTGG + Intronic
980158543 4:129133952-129133974 AGCAGGAAAAGGAGCCTGTGAGG + Intergenic
984884971 4:184442017-184442039 ATCTGCACTGGGAGCCTGTGTGG + Intronic
985554201 5:548268-548290 CCCTGGACAGGGGACCTGTGAGG + Intergenic
986044370 5:4023066-4023088 CTCTGGACCAGAAGCCAGTGTGG - Intergenic
988750893 5:34190027-34190049 CTCAGCACAAGGACTCTGTGGGG + Intergenic
995040606 5:107584015-107584037 CTGTGGACGCCGAGCCTGTGTGG - Intronic
998046668 5:138992487-138992509 CTGTGGAAAAGGAGCCTGCTAGG - Intronic
998094060 5:139387537-139387559 CTCTGCAAAAGGTGCTTGTGGGG - Intronic
999195909 5:149781475-149781497 ATCTGGACAAGAAGACTGAGAGG - Intronic
1000252948 5:159512490-159512512 TTCTGGACAAGGTGACTGTCTGG - Intergenic
1003477004 6:6492549-6492571 CTCCGGACAAGGAGGTGGTGAGG - Intergenic
1004381597 6:15137511-15137533 TGCTGGAGAATGAGCCTGTGCGG + Intergenic
1006012498 6:31054455-31054477 CCCTGGAGAAGGAGCCTCTTGGG + Intergenic
1006031222 6:31177959-31177981 CACTGCACAAGGTGCCTGTGTGG + Intronic
1006716440 6:36123674-36123696 CTCTGGACAATGACTCTGTAAGG - Intergenic
1007656036 6:43451532-43451554 ATCAGGCCCAGGAGCCTGTGAGG - Intronic
1008036838 6:46753915-46753937 CTATGGACAGAAAGCCTGTGTGG + Exonic
1008905413 6:56672264-56672286 CACTGGAGAAGGAGTGTGTGAGG - Intronic
1009465801 6:63967383-63967405 CTGTGTAGAAGTAGCCTGTGTGG + Intronic
1009951030 6:70396217-70396239 CTCTGAACAATGAGTCTATGAGG + Intergenic
1012550084 6:100457770-100457792 CTCCGGCTAAGGAGCCTGTGTGG + Intronic
1016986723 6:149900893-149900915 CACCGGAGAAGGAGCCTCTGAGG + Intergenic
1019064945 6:169288689-169288711 CTCTGGAGTAGGAGGCTGTGTGG + Intergenic
1020194178 7:6024496-6024518 TTCAGGAAAAGGAGCTTGTGGGG + Exonic
1023221146 7:37921003-37921025 CTCTGGGCCTGGACCCTGTGCGG + Exonic
1024269940 7:47634768-47634790 GTCTGGAGATGGAGCCTTTGGGG - Intergenic
1026907118 7:74068969-74068991 CCCTGGAGATGGAGGCTGTGTGG - Intronic
1028196205 7:87910975-87910997 CTCTTGAAAAGCTGCCTGTGGGG - Intergenic
1031351318 7:120734977-120734999 CTCTGGACAAATATGCTGTGTGG - Intronic
1034447893 7:151122813-151122835 CTCTGGACATGCCCCCTGTGCGG + Intronic
1035260085 7:157655625-157655647 CACTGGAGACGGAGCCTCTGGGG - Intronic
1037064035 8:14553616-14553638 ATGTGAGCAAGGAGCCTGTGCGG - Intronic
1037756843 8:21715703-21715725 CTTTAGACAAGGACCCTGTTGGG - Intronic
1040060289 8:43097828-43097850 CCCTGGAGGAGGGGCCTGTGGGG + Intronic
1041501335 8:58542100-58542122 CTCTGGAAAGGGAGCTTCTGGGG + Intergenic
1045060814 8:98409376-98409398 GTCTGCACGAGGAGCCCGTGAGG + Intronic
1047363038 8:124186331-124186353 CTCTTGACAGAGAGCCTTTGAGG - Intergenic
1050151724 9:2623521-2623543 ATGTGGTCAAGGAGCCTGTCGGG + Intronic
1051350610 9:16195028-16195050 CTCTGAAAAAGGAGCATGTTGGG - Intergenic
1052823823 9:33161066-33161088 CTCTGGAGAAGCAGCGGGTGTGG + Intronic
1052839141 9:33276692-33276714 CCCTGGGCAAAGAGCTTGTGAGG + Intronic
1053906916 9:42852040-42852062 CTCTGGCCCTGGAGTCTGTGTGG - Intergenic
1054356978 9:64071265-64071287 CTCTGGCCCTGGAGTCTGTGTGG - Intergenic
1060881619 9:127122039-127122061 TTTTGGACAAAGAGCCTTTGGGG - Intronic
1061325042 9:129858589-129858611 CTCTGAACAGGTAACCTGTGTGG + Exonic
1061570285 9:131473861-131473883 CTCTGGGGAAGGAGAGTGTGAGG + Intronic
1062212612 9:135372939-135372961 CTCTGGGCAGGGTGGCTGTGGGG - Intergenic
1062460965 9:136662430-136662452 CACTGGTCAAGGCTCCTGTGTGG + Intronic
1062712511 9:137984310-137984332 CTGGGGACAAGCACCCTGTGTGG - Intronic
1203748518 Un_GL000218v1:58004-58026 CTCTGGCCCTGGAGTCTGTGTGG - Intergenic
1203561204 Un_KI270744v1:60016-60038 CTCTGGCCCTGGAGTCTGTGTGG + Intergenic
1189528906 X:41857815-41857837 CTGTGGACAAGGAGATTGTCAGG + Intronic
1193606984 X:83581102-83581124 CTCTGGACAATGAAACTGGGAGG + Intergenic
1195484309 X:105385829-105385851 CTCTGGACAAAGAGTCTGAAGGG - Intronic
1195535561 X:106005332-106005354 CTTTGAACAAGGAGCATATGAGG - Intergenic
1196175969 X:112639297-112639319 CTCTGGCAAAGGAGCCTGGCAGG - Intronic
1201161863 Y:11172974-11172996 CTCTGGTCCTGGAGTCTGTGTGG - Intergenic