ID: 912384761

View in Genome Browser
Species Human (GRCh38)
Location 1:109265788-109265810
Sequence CTCTGGACAAGGAGCCTGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912384761_912384767 -4 Left 912384761 1:109265788-109265810 CCCCACAGGCTCCTTGTCCAGAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 912384767 1:109265807-109265829 AGAGTCTGTGACCCTGAGGATGG 0: 1
1: 0
2: 1
3: 21
4: 350
912384761_912384774 27 Left 912384761 1:109265788-109265810 CCCCACAGGCTCCTTGTCCAGAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 912384774 1:109265838-109265860 CATGCAAGCCAGGTGTCATCGGG 0: 1
1: 0
2: 1
3: 9
4: 136
912384761_912384770 17 Left 912384761 1:109265788-109265810 CCCCACAGGCTCCTTGTCCAGAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 912384770 1:109265828-109265850 GGCCAGTGTCCATGCAAGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 145
912384761_912384773 26 Left 912384761 1:109265788-109265810 CCCCACAGGCTCCTTGTCCAGAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 912384773 1:109265837-109265859 CCATGCAAGCCAGGTGTCATCGG 0: 1
1: 0
2: 0
3: 16
4: 127
912384761_912384765 -8 Left 912384761 1:109265788-109265810 CCCCACAGGCTCCTTGTCCAGAG 0: 1
1: 0
2: 2
3: 23
4: 230
Right 912384765 1:109265803-109265825 GTCCAGAGTCTGTGACCCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912384761 Original CRISPR CTCTGGACAAGGAGCCTGTG GGG (reversed) Exonic