ID: 912389213

View in Genome Browser
Species Human (GRCh38)
Location 1:109290314-109290336
Sequence CTCCAGTGGAAGCAGGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912389213_912389220 5 Left 912389213 1:109290314-109290336 CCTAGGTCCTGCTTCCACTGGAG 0: 1
1: 0
2: 3
3: 23
4: 257
Right 912389220 1:109290342-109290364 CCTCTTTGCCATTGTGTACATGG 0: 1
1: 0
2: 0
3: 14
4: 208
912389213_912389224 26 Left 912389213 1:109290314-109290336 CCTAGGTCCTGCTTCCACTGGAG 0: 1
1: 0
2: 3
3: 23
4: 257
Right 912389224 1:109290363-109290385 GGCTGGCTGTCACTGGACTCTGG 0: 1
1: 0
2: 2
3: 20
4: 177
912389213_912389221 9 Left 912389213 1:109290314-109290336 CCTAGGTCCTGCTTCCACTGGAG 0: 1
1: 0
2: 3
3: 23
4: 257
Right 912389221 1:109290346-109290368 TTTGCCATTGTGTACATGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 243
912389213_912389223 19 Left 912389213 1:109290314-109290336 CCTAGGTCCTGCTTCCACTGGAG 0: 1
1: 0
2: 3
3: 23
4: 257
Right 912389223 1:109290356-109290378 TGTACATGGCTGGCTGTCACTGG 0: 1
1: 0
2: 1
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912389213 Original CRISPR CTCCAGTGGAAGCAGGACCT AGG (reversed) Intergenic
901403709 1:9032029-9032051 CTCCAGAGCCAGCAGGAGCTAGG - Intergenic
901449142 1:9325494-9325516 CTCCCATAGAAGCAGGGCCTAGG - Intronic
901778590 1:11577506-11577528 TGCCAGAGGATGCAGGACCTTGG - Intergenic
902192798 1:14775356-14775378 CTCCAGGGGAAGCATGACGCTGG - Intronic
902243991 1:15107287-15107309 CTGGAGTGGAAGCAGGCCCTGGG - Intronic
904471022 1:30736279-30736301 CTCAGATGGAAGCAGGAGCTGGG + Intronic
906713555 1:47950932-47950954 CTCTACTGGAAGCAGGCCCAAGG - Intronic
907166028 1:52412107-52412129 CTCCAGTAGACCCAGGATCTCGG - Intronic
907426002 1:54379753-54379775 GTCCAGAGAAAGCAGGACTTTGG - Intronic
908026594 1:59958473-59958495 TTCCAGTGATACCAGGACCTGGG - Intergenic
912389213 1:109290314-109290336 CTCCAGTGGAAGCAGGACCTAGG - Intergenic
913256672 1:116960454-116960476 TCCCAGTGGAAACAGGACCGTGG + Intronic
914006663 1:143738300-143738322 CTCCAGTGGAGGTCGGAACTCGG + Intergenic
914645488 1:149648785-149648807 CTCCAGTGGAGGTCGGAACTCGG + Intergenic
920241472 1:204555063-204555085 CTGCAGGGGAAGCAGCATCTTGG - Exonic
920499316 1:206476450-206476472 CTCCTGTGGAAGCAGGAGGTGGG - Intronic
921254816 1:213329795-213329817 CCCCAATAGAAGAAGGACCTCGG - Intergenic
922614613 1:226954433-226954455 CTGCAGTGTCAGCAGCACCTGGG + Intronic
924576855 1:245288500-245288522 CTCGTGTGGAAGAAGGACATGGG + Intronic
1063280597 10:4625399-4625421 CTGTAGTGGAAGCCAGACCTTGG - Intergenic
1069635705 10:69923602-69923624 TTCCAGAGGAAGCAAGACCCAGG + Intronic
1071052831 10:81472902-81472924 CTGCAGGGGAGGCAGGACCCGGG + Intergenic
1071901503 10:90125206-90125228 CTCCAGTAGAAGCATGACACAGG + Intergenic
1072936542 10:99718713-99718735 CTCTAGAGGAAGCAGAATCTTGG - Intronic
1073106205 10:101033454-101033476 CTCCAGTGGCTGCAGGTCCCTGG + Intronic
1075078583 10:119368082-119368104 CTCCAGGGGAAGCCAGACCCCGG + Intronic
1075082566 10:119393619-119393641 GTCCAGGGGCAGCAGGACCCTGG + Intronic
1075327721 10:121547886-121547908 CTCCAGTGACTCCAGGACCTGGG + Intronic
1076799211 10:132812871-132812893 GCCCAGTGGGAGCAGGCCCTGGG - Exonic
1076834682 10:133015040-133015062 CTCCGGTGGAAGGAAGTCCTGGG + Intergenic
1077029611 11:459021-459043 CTCCAGTGGATGTAGGACCTGGG + Intronic
1077029618 11:459061-459083 CTCCGGTGAATGTAGGACCTGGG + Intronic
1077029628 11:459101-459123 CTCCGGTGGATGTCGGACCTGGG + Intronic
1077029636 11:459141-459163 CTCCGGTGGATGTCGGACCTGGG + Intronic
1077029644 11:459181-459203 CTCCGGTGGATGTCGGACCTGGG + Intronic
1077029652 11:459221-459243 CTCCGGTGGATGTCGGACCTGGG + Intronic
1077029660 11:459261-459283 CTCCGGTGGATGTCGGACCTGGG + Intronic
1077029668 11:459301-459323 CTCCGGTGGATGTCGGACCTGGG + Intronic
1077029676 11:459341-459363 CTCCGGTGGATGTAGGACCTGGG + Intronic
1077029684 11:459381-459403 CTCTGGTGGATGTAGGACCTGGG + Intronic
1077252410 11:1566484-1566506 CTCCAGTGGAGGCAGCCCCAAGG - Intronic
1077493399 11:2872676-2872698 CTCCACAGGGACCAGGACCTAGG + Intergenic
1077961060 11:7077286-7077308 CACCAGAGAAAGCAGGACCCTGG + Intergenic
1079139873 11:17801223-17801245 TTCAAGGGGAAGCAGGGCCTTGG + Intronic
1079322155 11:19460210-19460232 CTTCAGTGGAATCAGGTCCCTGG - Intronic
1079390988 11:20022016-20022038 CTCCAGTGGAAGCAGGGAGCGGG - Intronic
1080764102 11:35279674-35279696 CTCCAGAGGCAGCCTGACCTAGG + Intronic
1081600302 11:44488205-44488227 CTCCAGTGGAGGCCGGGCCCTGG - Intergenic
1083198941 11:61107938-61107960 CTCCAGAGCAAGCAGGCTCTGGG + Intronic
1084581254 11:70024804-70024826 CTCCCCTGAAAGGAGGACCTGGG + Intergenic
1084612467 11:70212317-70212339 CGCTAGAGGAAGCAGGACCCGGG - Intergenic
1085196126 11:74672889-74672911 CTCCAGTGGGAACAGGCCTTGGG + Intergenic
1087020462 11:93597516-93597538 CTCCAGTGGAAGATCGTCCTGGG - Intergenic
1088712024 11:112517018-112517040 CTCCTGTAGAAGCAGGACACAGG + Intergenic
1089111385 11:116060559-116060581 CTCTACTGGAAGTAGGAACTTGG + Intergenic
1090800479 11:130168434-130168456 CTCCAGTGGAAGCTCTACATCGG - Intronic
1090830231 11:130416109-130416131 CACCAGTGGAAGGAGGCCCACGG + Intronic
1092158052 12:6297363-6297385 CTGCTATGGAAGCAGGAGCTTGG + Intergenic
1092289443 12:7150492-7150514 GGCCAGTGGAGGCAGGACCTGGG - Intronic
1093573916 12:20702922-20702944 CTCAAGTTGCATCAGGACCTGGG - Intronic
1093693235 12:22130980-22131002 CTCCAGTGGAGAGAGGAGCTGGG - Intronic
1096827108 12:54288284-54288306 ATCCAGTGGTTGCAGGAACTTGG - Intergenic
1100574134 12:95873669-95873691 CTTGAGTGGAAGCAGGAAATGGG - Intronic
1100922672 12:99506414-99506436 CTCCATTGAAAGCAGGAAATTGG + Intronic
1101487197 12:105176926-105176948 CTCCAGTGGATTCAGGAACACGG + Exonic
1102545729 12:113653970-113653992 CTCGAGTGGGAGCAAGACCTGGG - Intergenic
1103717288 12:122952320-122952342 CTTCAGTGGAAACAGGTCCTGGG - Intronic
1103904723 12:124321440-124321462 CTCCAGGGGAGGCAGGACCCTGG + Intergenic
1103969626 12:124661916-124661938 ATTCAGTGGAAACAGAACCTTGG + Intergenic
1105591489 13:21796773-21796795 CTCCTCTGGAAGCAGGTGCTCGG + Intergenic
1107080007 13:36364804-36364826 CCCCTGTGGCAGGAGGACCTTGG - Intronic
1107249802 13:38346066-38346088 CTTCAATGGGAGCAGGAACTGGG - Intergenic
1107762710 13:43697636-43697658 CTCCAGAACTAGCAGGACCTGGG + Intronic
1110222539 13:73088984-73089006 GCCCAGTGGAAACTGGACCTTGG + Intergenic
1110792625 13:79602066-79602088 CTCCAGAGGAAGCAGCATCAGGG + Intergenic
1113556830 13:111242716-111242738 GTGCAGTGGCAGGAGGACCTGGG + Intronic
1114668600 14:24397102-24397124 CTCCAGGAGAGGCAGGAGCTGGG + Intergenic
1115364681 14:32544541-32544563 CACCAGTGGGAGCAGGACTTGGG + Intronic
1117256594 14:53984552-53984574 CTGAAGTGGAAGCAGGAGCTAGG - Intergenic
1117469081 14:56024104-56024126 CTTCAGTGGAAGCTGCAGCTGGG - Intergenic
1117739044 14:58797105-58797127 CCCCAGGGGAATCAGTACCTTGG + Intergenic
1119124549 14:72113467-72113489 CTCCAGTTGAAGCAGGATGTAGG - Intronic
1121329336 14:93040302-93040324 CTCCTATGAAAGCAGGGCCTCGG + Intronic
1121864841 14:97353202-97353224 CTCCGGTGGAAGGAGGGACTTGG - Intergenic
1122542547 14:102506244-102506266 CTGCAGTGGCAGCAGGCCCCTGG - Exonic
1123469006 15:20536339-20536361 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123649052 15:22464352-22464374 CACCTGTGGCAGCAGGAGCTTGG - Exonic
1123729282 15:23131327-23131349 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123747450 15:23328809-23328831 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1123762245 15:23441976-23441998 CACCTGTGGCAGCAGGAACTTGG + Exonic
1124121628 15:26893654-26893676 CTCCAGGGTGAGCAGGCCCTGGG - Intronic
1124279811 15:28352661-28352683 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1124302887 15:28558943-28558965 CACCTGTGGCAGCAGGAGCTTGG - Intergenic
1124531983 15:30516593-30516615 CGCCTGTGGCAGCAGGAGCTGGG - Intergenic
1124766670 15:32491052-32491074 CGCCTGTGGCAGCAGGAGCTGGG + Intergenic
1125481225 15:40082312-40082334 CTCCTGAGGAAGCAGAACCAGGG - Intergenic
1130194782 15:81769067-81769089 GCCAAGTGGAAGCATGACCTTGG + Intergenic
1130367903 15:83257110-83257132 CACCAGTGGGCCCAGGACCTGGG - Exonic
1130916200 15:88307062-88307084 CCCCAGAGGAAGCTGGACCCTGG + Intergenic
1130992831 15:88886867-88886889 CCCCAGTGGAAAGGGGACCTGGG - Intronic
1132405454 15:101539578-101539600 CTCAAATGGAAACAGGACCGCGG + Intergenic
1132858376 16:2057738-2057760 CTCCTATGGAACCAGGCCCTGGG + Intronic
1132858502 16:2058148-2058170 CTCCCGTAGAACCAGGCCCTGGG + Intronic
1132973411 16:2700057-2700079 CTCCAGTGGAAACAGGGCACAGG - Intronic
1133381721 16:5336558-5336580 CTCCAGAGGATACAGGACCAGGG - Intergenic
1133740123 16:8644995-8645017 CTCCAGAGGAGGCAAGACCGAGG + Intronic
1135734227 16:24918026-24918048 CTCCAGAGGAAGCAGGGACTTGG - Intergenic
1136624712 16:31455171-31455193 GTACAGTGGATGCAGGACATGGG + Intergenic
1136750144 16:32628289-32628311 CTCCTGTGGAAGCTGCTCCTTGG + Intergenic
1137256293 16:46778088-46778110 CTACAGAGGAGGCAGGAGCTGGG + Intronic
1138425772 16:56931405-56931427 CTCCAGTGTGAGCAGGACTGTGG + Intergenic
1138551318 16:57750231-57750253 CTCCAGCGGAAGCAGAACCAGGG - Intronic
1140565095 16:76032311-76032333 CTCCAGAGGATGCAGCATCTTGG + Intergenic
1140754757 16:78057049-78057071 CACTAGTGGAAGCAAGGCCTGGG - Intronic
1141184198 16:81775428-81775450 CTCCTGTGAAAGCATGAACTTGG - Intronic
1141788068 16:86214883-86214905 CTCCAGTGGGGTCAGGGCCTGGG - Intergenic
1203052274 16_KI270728v1_random:887488-887510 CTCCTGTGGAAGCTGCTCCTTGG + Intergenic
1143375980 17:6468012-6468034 CTCCTGTGGAACCAGGCCATGGG + Intronic
1143497149 17:7318791-7318813 CTGCAGTGGGAGGAGAACCTCGG - Intronic
1143551903 17:7635481-7635503 CTCCAGGGTAAGGAGGCCCTGGG + Intergenic
1143584967 17:7846443-7846465 CTCCAGTGGGGGCAGGACCTTGG - Exonic
1144828776 17:18120751-18120773 CTCCAGTGGGAGAGGGTCCTGGG - Exonic
1145090016 17:19978269-19978291 CTCCTGAGGAAGCAGGGACTGGG - Intronic
1146138600 17:30345054-30345076 CTCCACTAGAAGCAGCATCTAGG + Intergenic
1146299615 17:31677969-31677991 CTCCAGGGACAGCATGACCTTGG - Intergenic
1146519432 17:33514903-33514925 ATCCCCTGGAAGCAGGACCTCGG + Intronic
1147347117 17:39806739-39806761 CTCCAGTGTGGGCTGGACCTAGG + Intronic
1147811299 17:43171550-43171572 CCCCAGTGGAATGAGGGCCTAGG + Intronic
1149349124 17:55769602-55769624 ATCCAGTGGAAGCAGCAGTTAGG + Intronic
1150057447 17:62031504-62031526 CTCTTGTGGAAGCAGGCACTTGG + Exonic
1151529582 17:74695842-74695864 CTCCAGGGGCTGCAGTACCTGGG + Exonic
1152710773 17:81869659-81869681 CACCAGTGGAAGTAGGGGCTGGG + Intronic
1153835328 18:8958970-8958992 ATCCAGTGGGGGCAGGAGCTTGG + Intergenic
1153914304 18:9732349-9732371 CTGCAGTGGGTGCAGGACTTGGG - Intronic
1154289606 18:13095800-13095822 CAACAGTGGAAGCAGGGCCTGGG - Intronic
1158183126 18:54740592-54740614 CTCAAGTAGAATCATGACCTAGG + Intronic
1159706092 18:71690378-71690400 CTCCAGAGGATGCAGCAACTAGG + Intergenic
1160439998 18:78882559-78882581 CACCAGAGACAGCAGGACCTGGG - Intergenic
1160804931 19:988458-988480 CACCAGAGGAAGCAGGATCCAGG - Intronic
1162898272 19:13778407-13778429 AACCTGTGGAGGCAGGACCTGGG - Exonic
1163111020 19:15161058-15161080 CGCCAGTGGCAGCAGGAACGAGG + Exonic
1164471629 19:28541204-28541226 CTCAAGTGGAAGCAGCCCCAGGG - Intergenic
1164792278 19:30997393-30997415 CAGCAGTGGATGCAGAACCTTGG - Intergenic
1165239899 19:34457816-34457838 CTTTAGTAGAAGCAGGAGCTTGG + Intronic
1165907941 19:39204950-39204972 CTCCCTGGGAGGCAGGACCTTGG + Intergenic
925835836 2:7946103-7946125 CTACAGTGGGAGCAGAAGCTGGG + Intergenic
928257011 2:29731503-29731525 CTCCAGTGACAGCAAGACCCAGG - Intronic
929133561 2:38602376-38602398 CTCCCCGGGAAGCAGGGCCTCGG - Intronic
930027994 2:47041142-47041164 TCCCTGTGAAAGCAGGACCTGGG - Intronic
930930608 2:56877142-56877164 CTACTGTGGAACCAGGACATTGG + Intergenic
931196668 2:60058410-60058432 CTCCAGGGTAAGCAGGACTGGGG - Intergenic
931967592 2:67550675-67550697 ATCCAGAGTCAGCAGGACCTAGG + Intergenic
933793777 2:85904155-85904177 CTCCAGTGGAGCCAGGAACCAGG + Intergenic
933892418 2:86783983-86784005 CTCCTGTGGAAGCAGGGCCTGGG - Intergenic
933993173 2:87648349-87648371 CAGGAGTGGAATCAGGACCTTGG + Intergenic
936300684 2:111302534-111302556 CAGGAGTGGAATCAGGACCTTGG - Intergenic
937890669 2:126936213-126936235 TTCCAGAGGAAGCAGGAGTTAGG + Intergenic
941391655 2:164922414-164922436 CTTCAGTGGATGCAGGAGCTGGG - Intronic
942670913 2:178375859-178375881 GTCCAGGGCAAGCAGTACCTGGG - Intronic
943394919 2:187322276-187322298 CACCAGTGCAAGAAGGAGCTGGG - Intergenic
944395639 2:199263229-199263251 CTCCTGAGGAAACAGGACCAGGG - Intergenic
944636790 2:201682511-201682533 CTCCATTGGAAACTGAACCTGGG - Intronic
944651278 2:201832705-201832727 GTCCAATGGAAGCAGGAGCATGG - Intronic
946162093 2:217841550-217841572 CTCTTGGAGAAGCAGGACCTTGG - Intronic
946628856 2:221644731-221644753 CTCCAGTGGAAAGAAAACCTAGG + Intergenic
1172221847 20:33279633-33279655 TTCCAGATGAAGTAGGACCTTGG - Intronic
1173297502 20:41772508-41772530 GTCCTCTGGAAGCAGAACCTGGG - Intergenic
1173799299 20:45884959-45884981 GTGCAGTGGCAGCAGGATCTTGG - Exonic
1174384408 20:50178563-50178585 CTCCAGAGGGAGCAGGACCCTGG + Intergenic
1175105354 20:56611012-56611034 CTCAAGTGCAACCAGGACCGAGG - Intergenic
1175780802 20:61680758-61680780 CTCCCCGGGATGCAGGACCTCGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1177195521 21:17900567-17900589 CTCCACTGGAAACAGGTGCTGGG - Intergenic
1181508591 22:23378652-23378674 CCCAAGTAGGAGCAGGACCTGGG - Intergenic
1182221840 22:28764851-28764873 CTCCACTGGAAGAAGACCCTTGG - Intergenic
1182285019 22:29241192-29241214 CTCCAGAGGAACCAGGGCCAGGG - Intronic
1182448996 22:30407208-30407230 ATCCAGTGGATCCAGGACCCAGG - Intronic
1183164023 22:36133911-36133933 CTCCAGCGGGAGCTGCACCTCGG - Intergenic
1183457684 22:37931680-37931702 CTCCAGGGCCAGCAGGACCCAGG - Intronic
1183473817 22:38024818-38024840 CTACAGTGTAGGCAGGACCCTGG + Intronic
1183667438 22:39253856-39253878 CTCCAGCTGCAGGAGGACCTGGG - Intergenic
1183834505 22:40441161-40441183 CTCCAATGGAACCAGCTCCTGGG - Intronic
1184841953 22:47057277-47057299 CTCCCGTGGAAGGAGGAGCTTGG - Intronic
950654612 3:14428848-14428870 CTCCAGTGGAGGCAGCAGGTGGG - Intronic
950839940 3:15958243-15958265 TTCCAGAGGAAGCAGGTACTTGG - Intergenic
951024420 3:17814747-17814769 CTCCAGTGGATGCAGCAGCAAGG - Intronic
951614598 3:24527725-24527747 CACCAGTATAACCAGGACCTAGG - Intergenic
953510000 3:43525902-43525924 CTACAGTGGCAGCAGACCCTTGG - Intronic
954810363 3:53243695-53243717 CTCCAGTTGAAGCTGGCACTGGG - Intronic
954810375 3:53243737-53243759 CTCCAGTTGAAGCTGGCCCTGGG - Intronic
956968043 3:74486976-74486998 CTTCATTGTCAGCAGGACCTTGG - Intronic
960372966 3:116863478-116863500 CACCATAGGAATCAGGACCTGGG + Intronic
961384763 3:126517301-126517323 CTCCAGTGGGAGGAGGCCTTGGG - Intronic
962049372 3:131796615-131796637 CTCCAGGGGAAGGGGGACCCTGG - Intronic
962889918 3:139662596-139662618 CATCAGAGGAAGCAGGAGCTAGG - Intronic
964468545 3:157026159-157026181 CTCTAGGGGAGGCAGAACCTTGG - Intronic
965444899 3:168763408-168763430 TTCCCATGGAAGCAGGCCCTGGG - Intergenic
965521454 3:169671457-169671479 AGCCTGTGGCAGCAGGACCTGGG + Intergenic
967610384 3:191499164-191499186 CGCCACCGGCAGCAGGACCTGGG + Intergenic
969900433 4:10344363-10344385 CTGCAGTGAATGCAGGACCATGG - Intergenic
970560506 4:17277288-17277310 CTTCAAAGGAAGAAGGACCTAGG + Intergenic
978245513 4:106567623-106567645 GTCCTATGGAAGCAGGACCAGGG - Intergenic
978378475 4:108100977-108100999 CTCCAGTGTTAGCAGGAAGTGGG - Intronic
979425643 4:120561914-120561936 GGCCAGTGGAAGCAGGACACTGG + Intergenic
981226957 4:142308074-142308096 CTCCTGTGGAAGCAGAACGTTGG + Intronic
982350399 4:154409013-154409035 CTCCTGTGGAATCAGTGCCTTGG + Intronic
984066027 4:175048938-175048960 CTCCAGGGGAAACAGGTCATGGG - Intergenic
985260689 4:188112191-188112213 CTCCATTAGAAGCAGGGGCTTGG + Intergenic
985850235 5:2383326-2383348 CTCCAGTGTGAGCAGGTGCTGGG + Intergenic
987070653 5:14334243-14334265 CTCCAGTTGCAGAAGGACCCAGG + Intronic
996040935 5:118810168-118810190 CTCCAGTGGAACCAGTACTCAGG + Intergenic
998057190 5:139088092-139088114 CTCCAGTGGCAGCAGCTCCACGG - Intronic
1000896833 5:166865425-166865447 CTGCAGTGGAGGCAGGCGCTGGG + Intergenic
1002312584 5:178323616-178323638 TTGCACTGGATGCAGGACCTGGG - Intronic
1002413130 5:179100100-179100122 CGCCAGTGGAACCAGCACTTTGG + Intergenic
1003143901 6:3493733-3493755 CTACAGGGTAAGCAGTACCTGGG - Intergenic
1004172098 6:13303052-13303074 CTACAGTGCAAGAAGGTCCTCGG + Intronic
1004409527 6:15367789-15367811 CTCCTGGGGAAGCAGGAGTTGGG - Intronic
1004563282 6:16771642-16771664 CTCCAGTGGTAGCAGTCCCAGGG - Intergenic
1005234631 6:23745449-23745471 CTCAAGTGCAGGCAGGACTTAGG - Intergenic
1006316650 6:33295591-33295613 CTCCAGTGGAAGTAGCCCCCAGG + Exonic
1010792032 6:80075711-80075733 CTCCTGGGAAAGCAGTACCTTGG - Intergenic
1015037119 6:128669253-128669275 CTCCAGAGGAAATAGGACATAGG - Intergenic
1016624072 6:146145508-146145530 CTGCAGTGCAAGCTGTACCTAGG - Intronic
1017977844 6:159373894-159373916 CCCAAGTGGAACCAGGATCTTGG - Intergenic
1018170450 6:161139679-161139701 TTCCCTTGGAAGCAGGGCCTCGG - Intronic
1021852727 7:24824490-24824512 CTGCAGGGAAATCAGGACCTAGG - Intronic
1021868214 7:24979676-24979698 CTCCCGGGGAAGGAGGACCCGGG - Intronic
1022443976 7:30455085-30455107 CACCAGTGCAAGCAGGGCCCTGG - Intronic
1023602014 7:41889563-41889585 CTCCAGTGGAATCAGGAGATGGG - Intergenic
1023660099 7:42462214-42462236 CTCCAGAGCCACCAGGACCTTGG + Intergenic
1023945259 7:44797497-44797519 CTGCAGTGGAAGGCGGTCCTTGG - Intronic
1024056196 7:45661126-45661148 CCCCAGTGGATGCAGGCCCCTGG + Intronic
1024880964 7:54084569-54084591 CTCCAGTGGCAGGCTGACCTTGG - Intergenic
1028713668 7:93939659-93939681 TTTCAGGGGAAGCAGCACCTTGG + Intergenic
1028812108 7:95099320-95099342 GTCCAGTGGAAACTGGACCAAGG + Intronic
1032398212 7:131605946-131605968 CCCCAGTGGGAGCAGCCCCTGGG + Intergenic
1033518222 7:142131005-142131027 TTCCAGGGGAAGAAGCACCTAGG - Exonic
1034225476 7:149477668-149477690 CTCCAGGAGCAGCAGGCCCTGGG - Exonic
1035381745 7:158445148-158445170 CTCCAGAGGGGGCAGGCCCTGGG + Intronic
1036484323 8:9165686-9165708 TCCCAGGGGAAGCAGGACATGGG + Intronic
1037832636 8:22198486-22198508 CTCCAGAGGTAACAGGACCCAGG + Intronic
1040375183 8:46817911-46817933 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1040378161 8:46846426-46846448 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1047101077 8:121676426-121676448 CTCCAGTGGCAGCAGCAGCCAGG + Intergenic
1048210837 8:132453107-132453129 CCCCAGGGGAGGCAGGACCTTGG + Intronic
1049037284 8:140086502-140086524 CCCCAGAGGCAGCAGGAGCTGGG - Intronic
1049107168 8:140621320-140621342 CTCCAGTGCAAGCAAGTGCTTGG - Intronic
1050374788 9:4959379-4959401 CCACAGTGGAAACTGGACCTAGG + Intergenic
1050979842 9:11996555-11996577 CTCCCGGGGAAACAGTACCTTGG + Intergenic
1053412183 9:37922987-37923009 CCCCAGTGAAAGCAGGACTGGGG - Intronic
1054805779 9:69394852-69394874 CTCCAATGAAAGCAGGTCTTGGG - Intergenic
1055486691 9:76763168-76763190 TTCCAGTGCAGGCAGCACCTGGG - Intronic
1055925960 9:81509974-81509996 CTGCAATGGAAGCGGGAGCTGGG + Intergenic
1056493066 9:87126856-87126878 CTATATTGGAAGCAGGATCTGGG - Intergenic
1056505848 9:87257617-87257639 CTCCTCTGGAAGCAGAACTTGGG + Intergenic
1057817115 9:98304034-98304056 CTCCGGTCGAAGCAGGCTCTGGG + Intronic
1057941323 9:99287808-99287830 TTCCAGTGCCAGCAGGGCCTAGG + Intergenic
1060247175 9:121956893-121956915 ATCCACTGGATGCAGAACCTTGG - Intronic
1060395784 9:123315451-123315473 CTCCGGTGGCAACAGGTCCTGGG - Intergenic
1060665864 9:125431826-125431848 TTGCTGTGGGAGCAGGACCTGGG + Intergenic
1061033102 9:128098711-128098733 CGCCAGTGGAAGCAGGTCTGTGG + Intronic
1061649184 9:132032724-132032746 AGCCAGTGGAAGCAGGAAGTGGG - Intronic
1203790900 EBV:151049-151071 CCGCAGAGGAAGCATGACCTTGG + Intergenic
1186095027 X:6091304-6091326 CTTCCAGGGAAGCAGGACCTTGG - Intronic
1189532640 X:41902088-41902110 CTGCAGTGGACCCAGGACCCAGG - Intronic
1190113585 X:47611001-47611023 ACCCACTGTAAGCAGGACCTGGG - Intronic
1190925530 X:54900214-54900236 CTCCACTGGAAGCTGACCCTTGG - Intergenic
1195102924 X:101573824-101573846 CCCCAGTGGACCCAGGACTTAGG - Intergenic
1195859933 X:109372852-109372874 TTCCAGTGTGAGCAGGACCTTGG - Intergenic
1196495983 X:116326106-116326128 CTTAACTGGAAGCAGGGCCTGGG - Intergenic
1199807465 X:151314643-151314665 TTGCTATGGAAGCAGGACCTTGG + Intergenic
1200057571 X:153469770-153469792 CTCTTGTGGCAGCAGGACCTAGG + Intronic
1200850700 Y:7880335-7880357 CTCCAGTGGAAGTAGAATCCAGG + Intergenic
1200858495 Y:7964914-7964936 CCCCAGTGGAAGCAGGGTCCAGG + Intergenic
1200867881 Y:8064804-8064826 TCCCAGTGTAAGCAGGACTTTGG - Intergenic
1200896289 Y:8379354-8379376 CCCCAGTGGAATCAGGGTCTAGG + Intergenic
1202080097 Y:21075253-21075275 CTCCAGTCTAAGCAGGAACCAGG - Intergenic
1202245061 Y:22811632-22811654 CTCTAGTGGAAGCAGGGTCCAGG - Intergenic
1202260714 Y:22967426-22967448 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1202398051 Y:24445378-24445400 CTCTAGTGGAAGCAGGGTCCAGG - Intergenic
1202413701 Y:24601167-24601189 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1202457084 Y:25068919-25068941 CCCCAGTGGAAGCAGGGTCCAGG + Intergenic
1202472730 Y:25224709-25224731 CTCTAGTGGAAGCAGGGTCCAGG + Intergenic