ID: 912401629

View in Genome Browser
Species Human (GRCh38)
Location 1:109398016-109398038
Sequence GGACAGGCGGCCAGCCTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401629_912401637 3 Left 912401629 1:109398016-109398038 CCCCATAGGCTGGCCGCCTGTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 912401637 1:109398042-109398064 TTCCCCGGCCCACTCCTCATTGG 0: 1
1: 0
2: 0
3: 11
4: 117
912401629_912401647 27 Left 912401629 1:109398016-109398038 CCCCATAGGCTGGCCGCCTGTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401629_912401644 19 Left 912401629 1:109398016-109398038 CCCCATAGGCTGGCCGCCTGTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 912401644 1:109398058-109398080 TCATTGGCTCGCGTCGCCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 25
912401629_912401646 26 Left 912401629 1:109398016-109398038 CCCCATAGGCTGGCCGCCTGTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401629_912401648 28 Left 912401629 1:109398016-109398038 CCCCATAGGCTGGCCGCCTGTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39
912401629_912401645 25 Left 912401629 1:109398016-109398038 CCCCATAGGCTGGCCGCCTGTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401629 Original CRISPR GGACAGGCGGCCAGCCTATG GGG (reversed) Intergenic
903647851 1:24905546-24905568 GGAAAGGAGCCCAGCCTGTGTGG - Intronic
907559897 1:55378772-55378794 GGGCAGGAGGCCAGTATATGTGG + Intergenic
910803147 1:91165034-91165056 GGAAAGCCGGCCTGGCTATGTGG + Intergenic
912401629 1:109398016-109398038 GGACAGGCGGCCAGCCTATGGGG - Intergenic
914448529 1:147771113-147771135 GGACAGGGGACCTGTCTATGTGG - Intronic
914826685 1:151142542-151142564 GGAAAGGCGGCCTGAGTATGGGG + Exonic
916517395 1:165532397-165532419 GGACAGGGGACGAGCCCATGTGG + Intergenic
920379488 1:205527521-205527543 GGTCAGGATGCCCGCCTATGTGG - Intronic
1064107178 10:12509927-12509949 AAACAGGCGCCCAGCCTAGGAGG - Intronic
1065528945 10:26649461-26649483 GGAGAGGCGGCCATCCTTGGCGG + Intergenic
1065557955 10:26935535-26935557 GGAGAGGCGGCCATCCTTGGCGG - Intergenic
1070723436 10:78772324-78772346 GGAAACCCGGCCAGCCTATATGG - Intergenic
1076424421 10:130357382-130357404 GGCCAGGCGTCCAGCCCAGGAGG - Intergenic
1076613017 10:131738063-131738085 GGGCAGCCGGCCAGCCTACCTGG - Intergenic
1078020065 11:7649633-7649655 GCACCGGCGGCCAGCTGATGAGG + Exonic
1078694863 11:13620785-13620807 GGACAGGACTCCAGCCTGTGTGG - Intergenic
1081992106 11:47343425-47343447 GGGCAGGAGGCAAGGCTATGGGG + Intronic
1084005827 11:66323037-66323059 GGTCAGGAGTCCAGCCTCTGTGG + Intergenic
1084490605 11:69476334-69476356 GGACAGGCCGGCTGCCTAGGAGG - Intergenic
1085128567 11:74018623-74018645 GGAAAGGCAGCCAGCCAAAGGGG - Intronic
1089159785 11:116428645-116428667 GGGCAGGCTGCCAGTCCATGCGG + Intergenic
1090947952 11:131448371-131448393 GGACAGGAGGCTGGCCTGTGTGG - Intronic
1092023807 12:5224015-5224037 GGAGCGGCGGCCACCCTAGGAGG - Intergenic
1096106198 12:48998191-48998213 GGACCGGCCGCCACCCTACGTGG - Exonic
1102812055 12:115832861-115832883 GGCCAGGCTTCCAGCCCATGGGG + Intergenic
1103958598 12:124593478-124593500 TGCCAGGCGGCCGGCCTAGGTGG - Intergenic
1108845973 13:54678840-54678862 GCAAAGACGGCCAGCCTGTGAGG - Intergenic
1108854296 13:54774630-54774652 GCACAGTCTGCCAGCCCATGTGG - Intergenic
1112370008 13:98785779-98785801 GGACAGGGGCCCAGTCTGTGTGG + Intergenic
1122081141 14:99268766-99268788 GGAAAGCCGGCCTGCCTTTGAGG - Intronic
1122311879 14:100802598-100802620 GGAAAGGGGGCCAGCTTCTGGGG + Intergenic
1202852537 14_GL000225v1_random:30537-30559 GTACAGGCCGCCTGCCTGTGAGG - Intergenic
1202864305 14_GL000225v1_random:105084-105106 GCACAGGCCGCCTGCCTGTGCGG + Intergenic
1127632303 15:60838461-60838483 GGCCATGGGGCCAGCCTCTGTGG + Intronic
1128315100 15:66655099-66655121 GGAGAGGCCGCCAGCCTGGGAGG - Intronic
1128724297 15:69976364-69976386 GGACGGCTGGCCACCCTATGAGG - Intergenic
1132392196 15:101447249-101447271 GGACAGGATGCCAGGCTGTGAGG + Intronic
1132506716 16:313703-313725 GCACTGGCTGCCAGCCTGTGGGG - Intronic
1132836188 16:1954517-1954539 GGACAGTCTCCCAGCCTGTGAGG - Intronic
1132847046 16:2005487-2005509 GGCCAGGCGAGCAGCCTGTGAGG + Intronic
1137067425 16:35863131-35863153 GGAGAGGCTGCCATCCTCTGAGG + Intergenic
1139244868 16:65431867-65431889 GGACAGGGAGCCACCCTATAGGG + Intergenic
1140125972 16:72119413-72119435 GGCCATGCGGCCAGCCCTTGAGG - Intronic
1145758145 17:27407955-27407977 AGACAGAGGGCCAGCATATGTGG + Intergenic
1146602735 17:34232881-34232903 GGGCAGGGGGCTAGCGTATGGGG - Intergenic
1146793204 17:35764537-35764559 GCACAGCCACCCAGCCTATGTGG + Exonic
1148797337 17:50203322-50203344 GGCCAGCCGGCCAGCCGACGTGG - Intergenic
1148912367 17:50949723-50949745 GAACAGGAGGCCGGCCTAGGAGG + Intergenic
1151548558 17:74808132-74808154 GGACAAGCTGCCTGCCTGTGTGG - Intronic
1151759697 17:76093572-76093594 GGACAGGGGGCCAGCCTGGGTGG + Intronic
1152553317 17:81040569-81040591 GGAACGGCGGCCAGCCTGTGAGG + Intronic
1152586248 17:81190718-81190740 GGACCGGCTGGCAGCCTCTGAGG - Exonic
1152643366 17:81458159-81458181 GGACAGGCGGCAGGCCCCTGTGG - Exonic
1152684603 17:81687887-81687909 GGACAGGAAGCCAGCCAAAGTGG - Intronic
1159587904 18:70299431-70299453 GGGCAGGAGGCCACCCTAGGAGG - Intronic
1161365731 19:3878300-3878322 GGTGAGGCTGCCAGCCTAGGTGG + Intergenic
1161525530 19:4752663-4752685 AGACATGCCGCCAGCCTCTGGGG - Intergenic
1161553863 19:4929419-4929441 TGACAGCAGGCCAGCCGATGAGG + Exonic
1161838054 19:6661132-6661154 GGACAGACGGCGAGCTTATAGGG - Intergenic
1161877893 19:6926016-6926038 AGGCAGGCAGCCAGCCTATGGGG + Intronic
1161979171 19:7621577-7621599 GGACAGGCAGCCAGCGTCAGCGG - Intronic
1165573038 19:36791526-36791548 GGAGAGACGGCCCGCCTGTGAGG + Intergenic
1166976703 19:46609076-46609098 GGTCAGGCGGGCAGGCTAAGTGG - Intronic
1167427577 19:49437326-49437348 GTCCAGGCTGCCAGCCTAGGGGG + Intronic
929250979 2:39754765-39754787 GGACAGTTGGCCACCCTGTGAGG - Intronic
934660019 2:96138363-96138385 GGACAGGCAGCCAGCTTACCTGG + Exonic
1169186193 20:3619163-3619185 GGACAGCTGGCCACCCTGTGAGG - Intronic
1173033801 20:39389277-39389299 GGCAATGGGGCCAGCCTATGTGG - Intergenic
1173655168 20:44695265-44695287 GGACTGGCAGCCAGCTTTTGGGG - Intergenic
1174061914 20:47839074-47839096 GGACAGGCCGCCTGGCAATGTGG + Intergenic
1174069594 20:47890157-47890179 GGACAGGCCGCCTGGCAATGTGG - Intergenic
1175890875 20:62315400-62315422 GGACAGGCACCCAGCCTCTCAGG + Intronic
1178266148 21:31144233-31144255 GGGCTGGGGGCCAGCATATGTGG + Intronic
1179723905 21:43331246-43331268 GGTCAGGCGGCCAGGCTACAGGG + Intergenic
1180554416 22:16563535-16563557 AGACAGCCGGCCAGCCAAGGCGG + Intergenic
1180617691 22:17139238-17139260 GGACAGGCGGCCAGGCGCAGTGG + Intronic
1182296608 22:29313992-29314014 GGACAGGAGGCCAGGGTTTGCGG + Intronic
1183753420 22:39735994-39736016 TGGCAGGCGGCCAGCATGTGTGG - Intergenic
1184878820 22:47292127-47292149 GGACAGGAGGCCACCTTAGGGGG + Intergenic
1185126256 22:49012383-49012405 CAACAGGCAGCCAGCCTCTGGGG - Intergenic
1185126264 22:49012418-49012440 CAACAGGCAGCCAGCCTCTGGGG - Intergenic
1185126272 22:49012453-49012475 CAACAGGCAGCCAGCCTCTGGGG - Intergenic
1185186713 22:49405430-49405452 GAACAAGCTGCCAGCCTCTGTGG - Intergenic
955900334 3:63747061-63747083 GGATAGGTGGACATCCTATGTGG - Intergenic
962878749 3:139556133-139556155 GGGGAGGCGGCCACCCCATGAGG + Intergenic
968873002 4:3250911-3250933 GGACAGACCGCCAGCCTGTGAGG + Intronic
969227423 4:5808020-5808042 GGAGAGGCAGCCTGCCTGTGGGG + Intronic
969296056 4:6271083-6271105 GAACAGGCAGCCAGCACATGGGG - Intronic
984898394 4:184562562-184562584 GCACAGGCAGCAAGCCTATGTGG - Intergenic
989733833 5:44679224-44679246 GGGCAGGCCTCCAGCCTTTGTGG + Intergenic
992881400 5:81113952-81113974 AGGCAGGCGGCCAGCAAATGTGG - Intronic
993429419 5:87813796-87813818 GGACAGGATTCCAGCCTCTGTGG + Intergenic
999217974 5:149951649-149951671 CAACAGGCGGCCAGACAATGTGG - Intergenic
1000395395 5:160769460-160769482 GTAAAGGCGCCCAGCCTATGTGG - Intronic
1003623830 6:7726017-7726039 CGACAGGCTGGCAGCCAATGGGG - Intergenic
1004194040 6:13487921-13487943 GGACAGGCGACTAACCTATTAGG - Intergenic
1015048972 6:128815894-128815916 GCACAGCCAGCCAGGCTATGTGG + Intergenic
1016647390 6:146425735-146425757 TGACAGGCAGCCCGCTTATGTGG + Intronic
1017113322 6:150953017-150953039 GGAGAGACGGCAAGCCTGTGAGG - Intronic
1019496012 7:1341026-1341048 AGACAGGCAGCCAGGCCATGGGG - Intergenic
1025232543 7:57212090-57212112 GGACAGGCCGCCTGGCAATGTGG - Intergenic
1027554677 7:79648441-79648463 GGACAGGACTCCAGCCTGTGAGG - Intergenic
1032310347 7:130780408-130780430 GGACAGGACTCCAGCCTGTGTGG - Intergenic
1038319692 8:26514878-26514900 GGAGACGCGGGCAGCCTTTGTGG - Intronic
1040110923 8:43566907-43566929 GGACAGGCGGCCAGGCTTTCAGG - Intergenic
1040111270 8:43568147-43568169 GGACAGGCGGCCAGACGTTCAGG - Intergenic
1040692621 8:49958184-49958206 GGACAAAGGCCCAGCCTATGGGG + Intronic
1045292262 8:100843863-100843885 AGACAGTCGGCCAGCCTCAGTGG + Intergenic
1048009247 8:130443246-130443268 GGACGCGCGGCCAGGCTCTGCGG - Intronic
1048343375 8:133557468-133557490 GGATAGGAGGCCAGCCCGTGGGG - Intronic
1049311234 8:141934958-141934980 GGACAGGTGGCCTGCCCAAGTGG + Intergenic
1051097013 9:13477648-13477670 GCACAGGACTCCAGCCTATGTGG - Intergenic
1051602190 9:18886447-18886469 AGACAGGCGGCTACCCTCTGTGG - Intronic
1052543570 9:29843537-29843559 GGACAGGACTCCAGCCTATGTGG + Intergenic
1056967682 9:91178589-91178611 GCACAGGCAGCCTGCCTATGTGG + Intergenic
1060946241 9:127570750-127570772 GGGCAGGGGCCCAGCCTTTGAGG + Intronic
1062620063 9:137416651-137416673 CGCCAGGCGGCCACCCTCTGAGG + Intronic
1203740019 Un_GL000216v2:170932-170954 GCACAGGCCGCCTGCCTGTGCGG - Intergenic
1190832928 X:54075509-54075531 GAACAGGCGGCCAGGCGCTGTGG + Intronic
1191069041 X:56380521-56380543 TGACAGGCGGCGACCCTGTGTGG - Intergenic
1191256010 X:58279937-58279959 GGACAGGCAGCCAGGCTTTCAGG - Intergenic
1191256454 X:58281621-58281643 AGACAGGAGGCCAGGCTATCAGG - Intergenic
1191257052 X:58284082-58284104 AGACAGGCGGCCAGGCTTTCAGG - Intergenic
1191257353 X:58285393-58285415 AGACAGGCGGCCAGGCTTTCAGG - Intergenic
1191257574 X:58286259-58286281 AGACAGGCGGCCAGGCTTTCAGG - Intergenic
1192432004 X:71118888-71118910 GGGCACGCGGTCAGCCTAGGAGG + Intronic
1194019148 X:88665920-88665942 GGACAGGAATCCAGCCTGTGTGG + Intergenic
1197014289 X:121604995-121605017 GGACAGGACTCCAGCCTGTGAGG - Intergenic