ID: 912401630

View in Genome Browser
Species Human (GRCh38)
Location 1:109398017-109398039
Sequence GGGACAGGCGGCCAGCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401630_912401648 27 Left 912401630 1:109398017-109398039 CCCATAGGCTGGCCGCCTGTCCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39
912401630_912401645 24 Left 912401630 1:109398017-109398039 CCCATAGGCTGGCCGCCTGTCCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34
912401630_912401644 18 Left 912401630 1:109398017-109398039 CCCATAGGCTGGCCGCCTGTCCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 912401644 1:109398058-109398080 TCATTGGCTCGCGTCGCCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 25
912401630_912401647 26 Left 912401630 1:109398017-109398039 CCCATAGGCTGGCCGCCTGTCCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401630_912401646 25 Left 912401630 1:109398017-109398039 CCCATAGGCTGGCCGCCTGTCCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401630_912401637 2 Left 912401630 1:109398017-109398039 CCCATAGGCTGGCCGCCTGTCCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 912401637 1:109398042-109398064 TTCCCCGGCCCACTCCTCATTGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401630 Original CRISPR GGGACAGGCGGCCAGCCTAT GGG (reversed) Intergenic
905918726 1:41704556-41704578 AGGACAGGCTGCCAGCCTTGGGG - Intronic
909919956 1:81368739-81368761 GGGACAGTCAGCCAGCATAGAGG - Intronic
912401630 1:109398017-109398039 GGGACAGGCGGCCAGCCTATGGG - Intergenic
914826684 1:151142541-151142563 GGGAAAGGCGGCCTGAGTATGGG + Exonic
915585615 1:156842306-156842328 TGGACAGGAGACCAGCCTCTGGG - Intronic
920941435 1:210486863-210486885 TGCACAGGCTGCCAGCCTAAAGG + Intronic
1067746947 10:48943202-48943224 AGGACAGGCAGCCAGCCCCTCGG - Intronic
1068213433 10:53952356-53952378 GGGACAGCCTGCCTGCATATAGG - Intronic
1068539307 10:58273331-58273353 GGCACGGCCTGCCAGCCTATGGG + Intronic
1069038873 10:63673423-63673445 GGGAGAGGCGGCACGCATATGGG - Intergenic
1081587576 11:44397988-44398010 GAGACAGGCAGCGAGCCTCTCGG + Intergenic
1081992105 11:47343424-47343446 GGGGCAGGAGGCAAGGCTATGGG + Intronic
1083275948 11:61597254-61597276 GGGACAGGAGCCCAGCGTGTAGG + Intergenic
1083731538 11:64655028-64655050 GCGACAGGAGGCCAGGGTATTGG - Intronic
1085128568 11:74018624-74018646 GGGAAAGGCAGCCAGCCAAAGGG - Intronic
1085642623 11:78202190-78202212 GGGACAGGAGGTCAGACTTTGGG + Intronic
1086108084 11:83168934-83168956 GGACCAGGAGGCCAGCCTGTGGG + Exonic
1089615377 11:119692018-119692040 GGGACATGCGGCCAGGCTCAGGG - Intronic
1102586051 12:113923743-113923765 GGGACAGGCGTCCAGCACAGGGG - Intronic
1103953279 12:124563558-124563580 GGGCAACGCGCCCAGCCTATGGG + Intronic
1106028545 13:25977435-25977457 GGGTCATGCGGGCAGCCTTTCGG - Intronic
1113442704 13:110341478-110341500 AGGACAAGGGGCCTGCCTATTGG + Intronic
1114663795 14:24367215-24367237 GTGACAGGTGTCCAGCCTGTTGG + Intronic
1120885600 14:89449650-89449672 GGGGCAGGAGGCCAACTTATAGG + Intronic
1122974633 14:105166069-105166091 GGGGCAGGCGGCCTGTCTCTGGG - Intronic
1123991518 15:25687091-25687113 GTGACAGGCGGCAAGCCCCTAGG - Intronic
1132506717 16:313704-313726 GGCACTGGCTGCCAGCCTGTGGG - Intronic
1133822879 16:9252537-9252559 GGGAAAGGCTCCCAGCATATTGG - Intergenic
1139244867 16:65431866-65431888 AGGACAGGGAGCCACCCTATAGG + Intergenic
1142267297 16:89070577-89070599 GGGACAGCCGGGCACCCTAGGGG + Intergenic
1146439072 17:32877386-32877408 GCGGCAGGCGGCCATCCTCTTGG - Intergenic
1147459261 17:40557966-40557988 GGGGAAGGGGGCCAGGCTATGGG + Intronic
1149448520 17:56732321-56732343 GAGACAGGTGACCATCCTATAGG - Intergenic
1149891133 17:60391745-60391767 GGGAAAGGCGGCCGGCCTTGGGG - Intronic
1154412730 18:14150107-14150129 GGGCCAGGCGGCCACCCTGATGG - Intergenic
1159946284 18:74446917-74446939 GGGACAGCTGGCCAGCCTGTGGG - Exonic
1161838055 19:6661133-6661155 TGGACAGACGGCGAGCTTATAGG - Intergenic
1161877892 19:6926015-6926037 AAGGCAGGCAGCCAGCCTATGGG + Intronic
1162908332 19:13836407-13836429 GGGACAGGCGGCAAGGCCAGAGG + Intergenic
1167219231 19:48186741-48186763 GGGCCAGGCTGCCAGCTTCTGGG + Intronic
1168015748 19:53571523-53571545 GAGACAGGAGGCCACCCTCTGGG - Intronic
925225979 2:2184683-2184705 TGGAGAGGCCGCCAGCCCATTGG - Intronic
928917803 2:36491745-36491767 GGGTCAGGCGGTCAGACTTTTGG - Intronic
946162122 2:217841686-217841708 GGGACAGGCCTGCTGCCTATGGG - Intronic
948847521 2:240690269-240690291 GGGACAGGCGGCCTTCCTGTGGG + Intergenic
1171132709 20:22668543-22668565 GGGACAGGTGGACAGCATCTAGG + Intergenic
1172116179 20:32574816-32574838 GCCACAGGCTGCCAGCCTACCGG + Intronic
1172505779 20:35461445-35461467 GGCAGAGGCGGCCAGCCTAACGG - Intronic
1172806493 20:37615551-37615573 GGGACAAGCTGCCAGCCTGGTGG - Intergenic
1175230258 20:57469393-57469415 GGGACAGGCAGCCAGCGGAAAGG - Intergenic
1176860276 21:14008148-14008170 GGGCCAGGCGGCCACCCTGATGG + Intergenic
1178404860 21:32315844-32315866 GGGAGGGGCTGGCAGCCTATCGG - Intronic
1179420460 21:41232167-41232189 GTCACAAGCGGCCAGCGTATTGG + Intronic
1179723904 21:43331245-43331267 TGGTCAGGCGGCCAGGCTACAGG + Intergenic
1183714492 22:39525796-39525818 AGGAGAGGCGGCCAGGATATGGG + Intergenic
1184878819 22:47292126-47292148 GGGACAGGAGGCCACCTTAGGGG + Intergenic
1185317470 22:50185298-50185320 GGGCCCCGCGGCCAGCCTAGCGG - Intergenic
955700786 3:61680152-61680174 GGGGCAGATGGCCATCCTATTGG - Intronic
958441881 3:94165140-94165162 GGGGCAGGCGGCCAGCCAAGAGG + Intergenic
969091001 4:4693975-4693997 AGGGAAGGCGGCCAGCCTTTAGG - Intergenic
972943474 4:44225355-44225377 AAAACAGGTGGCCAGCCTATGGG - Intronic
983638200 4:169919472-169919494 GGGGCAGGCTTCCAGGCTATAGG - Intergenic
992052772 5:72956279-72956301 GCGACCGGTCGCCAGCCTATAGG + Intronic
997446419 5:133943519-133943541 GTGACTGGCTCCCAGCCTATGGG + Intergenic
1001055739 5:168448273-168448295 GGAACAGACGGACAGCCTTTTGG - Intronic
1002570258 5:180136097-180136119 GGGCCAGGTGGCCAGGCTGTTGG - Intronic
1025049727 7:55724032-55724054 GGGGCAGGTGTCCACCCTATTGG - Intergenic
1034393427 7:150802545-150802567 GGGAGAGGCAGCCAGCCTGGTGG - Intronic
1039385709 8:37133952-37133974 GGAACAGGAAGCCAGCCTGTTGG + Intergenic
1062073546 9:134572195-134572217 GGGACATGCAGCCAGCCTCAGGG - Intergenic
1062542905 9:137049402-137049424 GGGACAGGCGGCGAGCCAGCGGG - Intronic
1186016550 X:5201382-5201404 TTGACAGGAGGCCACCCTATTGG - Intergenic
1189850255 X:45170329-45170351 GGGACAGGTGGCCAGGCCACTGG + Intronic
1190061549 X:47214941-47214963 TGGACAAGGGGCCAGCCTAGAGG - Exonic
1195992270 X:110694268-110694290 GGGACAGACCTCCAGCCTGTCGG + Exonic
1201585460 Y:15555731-15555753 AGGACAGGCACCCAGACTATAGG - Intergenic