ID: 912401631

View in Genome Browser
Species Human (GRCh38)
Location 1:109398018-109398040
Sequence AGGGACAGGCGGCCAGCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401631_912401646 24 Left 912401631 1:109398018-109398040 CCATAGGCTGGCCGCCTGTCCCT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401631_912401647 25 Left 912401631 1:109398018-109398040 CCATAGGCTGGCCGCCTGTCCCT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401631_912401637 1 Left 912401631 1:109398018-109398040 CCATAGGCTGGCCGCCTGTCCCT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 912401637 1:109398042-109398064 TTCCCCGGCCCACTCCTCATTGG 0: 1
1: 0
2: 0
3: 11
4: 117
912401631_912401645 23 Left 912401631 1:109398018-109398040 CCATAGGCTGGCCGCCTGTCCCT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34
912401631_912401644 17 Left 912401631 1:109398018-109398040 CCATAGGCTGGCCGCCTGTCCCT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 912401644 1:109398058-109398080 TCATTGGCTCGCGTCGCCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 25
912401631_912401648 26 Left 912401631 1:109398018-109398040 CCATAGGCTGGCCGCCTGTCCCT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401631 Original CRISPR AGGGACAGGCGGCCAGCCTA TGG (reversed) Intergenic
900205382 1:1429771-1429793 AGGGACAGAGAGCCAGCCTGCGG - Intergenic
900542059 1:3207957-3207979 GCGGACAGGCGGCCGGGCTAGGG - Intronic
900566882 1:3337672-3337694 AGGGAAAGCCAGCCAGCCTGGGG - Intronic
900656700 1:3762239-3762261 AGGGAAAGGTGGCCAGCCGGCGG + Intronic
905517066 1:38569780-38569802 AGGGAAAGGAGGCCAGGCTTGGG - Intergenic
905576478 1:39048658-39048680 AGGGCAAGGCGGGGAGCCTAGGG - Intergenic
905918727 1:41704557-41704579 CAGGACAGGCTGCCAGCCTTGGG - Intronic
912401631 1:109398018-109398040 AGGGACAGGCGGCCAGCCTATGG - Intergenic
912508017 1:110169958-110169980 AGGGCCTGGCGGCCTGCCTGAGG + Intronic
913009490 1:114669663-114669685 AGAGAGCGGCGCCCAGCCTAGGG + Intronic
914255793 1:145960684-145960706 AGGGACAGGCGGCTGGACTCAGG + Exonic
915367473 1:155324020-155324042 AGGGAGAGGGGGCCGGCCCACGG - Intronic
920037636 1:203076139-203076161 AGGGCCAGGCCGGCAGCCAAGGG - Intronic
924424766 1:243941046-243941068 TGGGTCAGGCGGGCAGCCAAAGG + Intergenic
1062968335 10:1627053-1627075 AGGGAGAGGCGTCCAGGCCAGGG - Intronic
1064006134 10:11700612-11700634 AGGCACAGGTGGCCTGTCTAAGG + Intergenic
1066635346 10:37494172-37494194 AGGGACCGGCGCTCAGCATACGG - Intergenic
1068539306 10:58273330-58273352 AGGCACGGCCTGCCAGCCTATGG + Intronic
1069876753 10:71567814-71567836 AGGGACAACAGGCCAGCTTACGG - Intronic
1070825487 10:79388096-79388118 GGGGACAGGTGGCCTGCCCAAGG - Intronic
1076204462 10:128585682-128585704 AGGGACAGGGGACCACTCTAGGG - Intergenic
1078006597 11:7536975-7536997 AGGGACAGGCTGGCAGACCATGG + Intronic
1081914006 11:46719425-46719447 AGCCCCAGGCGGCCAGCTTAGGG + Intronic
1081992104 11:47343423-47343445 AGGGGCAGGAGGCAAGGCTATGG + Intronic
1083899178 11:65635490-65635512 AGGGTCAGGGGGCCGGCCCAAGG - Intronic
1085128569 11:74018625-74018647 AGGGAAAGGCAGCCAGCCAAAGG - Intronic
1085250470 11:75140411-75140433 GGGCACAGGCAGCCAGCCTCTGG - Intronic
1085642622 11:78202189-78202211 AGGGACAGGAGGTCAGACTTTGG + Intronic
1088626628 11:111734531-111734553 ACTGACAGGAGGTCAGCCTAAGG + Intronic
1088875820 11:113935469-113935491 TGGGACAGGAGGCCAGACTCAGG + Intronic
1089183950 11:116602355-116602377 AGAGACAGGCTGCCAGCACATGG + Intergenic
1089299650 11:117490891-117490913 AGGGCCAGGAGGCCAGTCCAGGG + Intronic
1089615378 11:119692019-119692041 GGGGACATGCGGCCAGGCTCAGG - Intronic
1092870018 12:12797959-12797981 AGGGAGTTGGGGCCAGCCTAGGG - Intronic
1093769646 12:23003669-23003691 AGGGAAAGGTGGACAGCCTGGGG - Intergenic
1102586052 12:113923744-113923766 AGGGACAGGCGTCCAGCACAGGG - Intronic
1103953278 12:124563557-124563579 AGGGCAACGCGCCCAGCCTATGG + Intronic
1104607185 12:130198616-130198638 AGGGACAGGCAGGCAGCTTCTGG + Intergenic
1106559716 13:30837784-30837806 AGGGACAGGAGGCGTGCCTTGGG + Intergenic
1108863832 13:54897343-54897365 AAGTACTGGCAGCCAGCCTACGG - Intergenic
1117063898 14:51989713-51989735 AGGGACACGCGGCCGGGCTGAGG - Intronic
1119669866 14:76510164-76510186 AGGGACAGGAGGCCAACAGAGGG + Intergenic
1122232175 14:100311905-100311927 AGGGACCGGCGTTCAGCATACGG + Intergenic
1122922430 14:104885547-104885569 AGGCACAGACGGCCACCCCAAGG + Intronic
1124504447 15:30261246-30261268 AACGACAGGCGGCCAGCCGGGGG - Intergenic
1124602869 15:31149427-31149449 AGGCTCAGGGGGCCAGCCTTTGG - Intronic
1124621358 15:31275865-31275887 AGGGGCAGGAGGCCAGCCCCAGG - Intergenic
1124739104 15:32277389-32277411 AACGACAGGCGGCCAGCCGGGGG + Intergenic
1125541343 15:40471475-40471497 AGGGACAGGCCCCCAGGCTTGGG - Exonic
1127261234 15:57327839-57327861 AGGGACAAGCAGCCAGGTTAGGG - Intergenic
1127624670 15:60768430-60768452 AGAGACATTCAGCCAGCCTACGG - Intronic
1130070638 15:80644200-80644222 AGGGACCGGCAGGCAGCCTCCGG + Intergenic
1132333205 15:101026620-101026642 AGTGACAGGCAGTCAGCCCAGGG - Intronic
1139253590 16:65519979-65520001 TGGGAGAGGCCACCAGCCTAGGG + Intergenic
1141137807 16:81478050-81478072 AGGGAGAGGAGGCCAGAATAGGG + Intronic
1141460788 16:84177658-84177680 AAGGACAGGGGGGCAGCCTTGGG - Intronic
1141533130 16:84660409-84660431 AGGGTGAGGCGGCCACCCTGGGG - Intronic
1141744758 16:85918485-85918507 AGGGACAGGCGGCAGCCCTCGGG - Exonic
1142267296 16:89070576-89070598 AGGGACAGCCGGGCACCCTAGGG + Intergenic
1142847432 17:2689034-2689056 AGGGGCAGGTGGCCAGCCAGGGG + Intergenic
1145270004 17:21399799-21399821 AGGGACACGCAGCCAGTCCATGG - Intronic
1147119917 17:38329871-38329893 AGGGACTGGAGGCCAGCTTTGGG + Exonic
1149597335 17:57872148-57872170 GGGGAAAGGCAGCCAGGCTAGGG + Intronic
1149891134 17:60391746-60391768 AGGGAAAGGCGGCCGGCCTTGGG - Intronic
1150620948 17:66807357-66807379 AGAGACGGGCTGCCAGCCCACGG - Exonic
1151003659 17:70408072-70408094 AGGGACATGCGGCAGGGCTAAGG - Intergenic
1151421689 17:74002429-74002451 AGGCACAGGAGGCCAAACTAAGG - Intergenic
1151462087 17:74260465-74260487 AGGGCCAGGCAGCCAGCTCAGGG - Exonic
1152229671 17:79108177-79108199 TGGGACAGGACGCCAGCCGAAGG + Intronic
1152380716 17:79941142-79941164 GGGGACAGCCTGGCAGCCTAGGG + Intronic
1155384510 18:25262717-25262739 AGAGACAGGAGGGCTGCCTAGGG + Intronic
1156539543 18:37895977-37895999 AGGTACAGACAGCCAGCCTGGGG + Intergenic
1159259428 18:65992970-65992992 AGAGAAAGGGGGCCAGTCTATGG - Intergenic
1159946285 18:74446918-74446940 GGGGACAGCTGGCCAGCCTGTGG - Exonic
1160809498 19:1007323-1007345 TGGGATAGGCGTCCAGCCCAGGG + Intronic
1161793295 19:6373339-6373361 CGGGACAGGAGGCGAGCGTAGGG + Intronic
1163810682 19:19429599-19429621 AGGGGCAGGCCGGCAGCCTAAGG - Intronic
1167219230 19:48186740-48186762 AGGGCCAGGCTGCCAGCTTCTGG + Intronic
1168063821 19:53908543-53908565 AGGGGCAGGCCGCCCGCCGAGGG - Intergenic
927510124 2:23639173-23639195 AGGGACTGGCGACCAGCATCCGG + Exonic
931063342 2:58555987-58556009 AGGGACAGGCTAGAAGCCTAGGG + Intergenic
931986505 2:67747426-67747448 AGGAACAGGGGGCCAGCAGAGGG + Intergenic
932079453 2:68698395-68698417 AAGGACTGGCAGCCAGCCTGTGG - Intronic
940855791 2:158727793-158727815 AGGAACAGGGGGCCAACCCAGGG - Intergenic
946162123 2:217841687-217841709 AGGGACAGGCCTGCTGCCTATGG - Intronic
946313633 2:218896341-218896363 AGGGAGAGGCAGCCAGGCTGGGG + Intronic
947447081 2:230172356-230172378 AGCGGCAGGCGGGCAGCCTGAGG + Intronic
948847520 2:240690268-240690290 GGGGACAGGCGGCCTTCCTGTGG + Intergenic
1170917042 20:20636981-20637003 AGTGACTGGAGGCCAGCCCAAGG - Intronic
1172523168 20:35582338-35582360 AGGGACAGGCGTCCAGAGTGGGG + Intergenic
1173250623 20:41362519-41362541 AGGGTCAGGCCGCCAGCCGGAGG - Exonic
1173360594 20:42340981-42341003 AGGAACACGAGGCCAGACTAAGG - Intronic
1173551150 20:43933965-43933987 AAGGAGAGGCGGCCACCCCAGGG - Intronic
1174934922 20:54857026-54857048 AGGGAGAGGCTACCTGCCTAGGG + Intergenic
1175388111 20:58610231-58610253 AGGGGCCGGGTGCCAGCCTAGGG + Intergenic
1180215514 21:46321430-46321452 AGGGACATGAGGCAAACCTAAGG - Intronic
1181580928 22:23827673-23827695 ATGGAGAGGCGGCCTGCCTGGGG + Intronic
1183355202 22:37355126-37355148 AGGGACAGACTGACAGGCTATGG - Intergenic
1183544895 22:38450232-38450254 AGGGGCAGGCGGGAATCCTAGGG - Intronic
1183714491 22:39525795-39525817 AAGGAGAGGCGGCCAGGATATGG + Intergenic
1184652414 22:45925279-45925301 AGCTCCAGGCTGCCAGCCTAGGG - Intronic
1184878818 22:47292125-47292147 AGGGACAGGAGGCCACCTTAGGG + Intergenic
949555626 3:5149751-5149773 AAGGACTGGCAGCCAGCCTGCGG - Intronic
950153665 3:10707414-10707436 AGGGAGAAGCCCCCAGCCTAGGG + Intronic
954773915 3:52999177-52999199 AGGGCCAGCCGGGCAGCCCAAGG + Intronic
957338453 3:78861891-78861913 AGGGAAAGGCTGCCTGCCTATGG + Intronic
958574458 3:95929783-95929805 AGGGAAAGGCAGACAGACTAGGG + Intergenic
959609377 3:108277016-108277038 AGGGACAGAGGTGCAGCCTAGGG - Intergenic
968751916 4:2394493-2394515 AGAGAAACGCAGCCAGCCTAGGG - Intronic
972943475 4:44225356-44225378 AAAAACAGGTGGCCAGCCTATGG - Intronic
976765425 4:88592961-88592983 AGGGGCAGGGGGCGAGCATAGGG - Intronic
985057865 4:186050872-186050894 GGGGACCGGCGCTCAGCCTAGGG - Intergenic
994135169 5:96278273-96278295 AGGGACAAAAGGCCAGCCTGTGG - Intergenic
995313521 5:110739555-110739577 AGGAAGAGGAGGCCAGCCTCAGG - Intronic
996372076 5:122764003-122764025 AGGGAAAGGCTGCCAGGCAAAGG + Intergenic
997394750 5:133549999-133550021 GGGGACAGGAGTCAAGCCTAGGG - Intronic
998168880 5:139860407-139860429 AGGGACATGGGGCCAGTCTGGGG - Intronic
998817059 5:146025379-146025401 CTGGACTGGGGGCCAGCCTACGG - Intronic
999989223 5:157034114-157034136 AGGGACCGGCGCTCAGCATACGG + Intronic
1003011114 6:2428380-2428402 AGGGACAGGCTGCAATACTAAGG + Intergenic
1003072093 6:2952905-2952927 AGGGACACGAGGCCACCCAATGG + Intronic
1003145140 6:3504183-3504205 ATGGACATGTGGCCAGCGTACGG + Intergenic
1006182813 6:32164198-32164220 AGGGGCAGGGGGGCAGCCCAGGG - Intronic
1006422003 6:33940529-33940551 AGGGACAACCATCCAGCCTATGG - Intergenic
1007686026 6:43667865-43667887 AGGGACAGTAGGCCAGGCTGGGG - Intronic
1008501058 6:52183558-52183580 AGGCACAGGAGGCAAGACTAGGG + Intergenic
1011501753 6:87998036-87998058 AAGTACTGGCGGCCAGCCTGTGG - Intergenic
1012243207 6:96897601-96897623 AGGGACAGCCGGGCAGCACAGGG + Intronic
1013091544 6:106905042-106905064 AGGGACAGGAGGGCAGCAGAAGG - Intergenic
1013181225 6:107718515-107718537 AAGGACAGGAGGACATCCTAGGG + Intronic
1018421886 6:163647282-163647304 AGGGACAGGAGGTCAGCCACAGG + Intergenic
1019282245 7:206368-206390 AGGGAAGGGCGGCCAGCGTGGGG - Intronic
1019316650 7:390084-390106 AGGGACAGGGGACCAGGCTCCGG + Intergenic
1024238339 7:47414866-47414888 AGGGACTGGCGGCCAGCAAGGGG - Intronic
1027225515 7:76241256-76241278 TGGCAGAGCCGGCCAGCCTAGGG - Intronic
1028173460 7:87627809-87627831 CGGGACTGACGGCCCGCCTAAGG - Intronic
1029910025 7:104135655-104135677 AGGGAGAAGCTGCCAACCTATGG + Intronic
1029987411 7:104934746-104934768 AGGGACAGGCGGGCATTCCACGG - Intergenic
1031560981 7:123237742-123237764 AGGGCCAGGAGGCCAGGCTGAGG + Intergenic
1032513956 7:132493296-132493318 AGTGACAGGAGGCCAGCCCCAGG - Intronic
1040994924 8:53391743-53391765 AGGGACAGGGGGCCACCAAATGG + Intergenic
1050643145 9:7690830-7690852 AGGGAGAGGCAGGCAGCCTATGG - Intergenic
1056810012 9:89756982-89757004 AGGGACAGGCAGCAAGCCAGTGG - Intergenic
1056859531 9:90167136-90167158 GGGGACCGGCGCCCAGCATACGG - Intergenic
1057831753 9:98412588-98412610 AGGGACAGGAGGCCAGGAGAAGG - Intronic
1059149596 9:111937509-111937531 ACGGACACCAGGCCAGCCTAAGG + Intergenic
1060406872 9:123377167-123377189 AGGCAGAGGCTGCCAGCCAAGGG - Exonic
1062073547 9:134572196-134572218 AGGGACATGCAGCCAGCCTCAGG - Intergenic
1062542906 9:137049403-137049425 GGGGACAGGCGGCGAGCCAGCGG - Intronic
1195031238 X:100929313-100929335 CCGGGCAGGCGGCCAGCCGAGGG + Intronic
1195410500 X:104564661-104564683 AGGGCCAGCCGGCTAGCGTAGGG + Intergenic