ID: 912401633

View in Genome Browser
Species Human (GRCh38)
Location 1:109398029-109398051
Sequence GGCCGGGGAAGAGGGACAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 895
Summary {0: 1, 1: 0, 2: 1, 3: 82, 4: 811}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401633_912401649 21 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401633_912401637 -10 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401637 1:109398042-109398064 TTCCCCGGCCCACTCCTCATTGG 0: 1
1: 0
2: 0
3: 11
4: 117
912401633_912401644 6 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401644 1:109398058-109398080 TCATTGGCTCGCGTCGCCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 25
912401633_912401646 13 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401633_912401645 12 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34
912401633_912401647 14 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401633_912401652 27 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401633_912401648 15 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401633 Original CRISPR GGCCGGGGAAGAGGGACAGG CGG (reversed) Intergenic
900432028 1:2606987-2607009 GGCCGGTGGCGATGGACAGGTGG - Exonic
900638387 1:3676490-3676512 GGACAGGGCAGGGGGACAGGGGG + Intronic
900774521 1:4572183-4572205 GGGAGGGGAAGAGTGGCAGGAGG + Intergenic
901005609 1:6170327-6170349 AGCGGGGAAAGGGGGACAGGAGG + Intronic
901200202 1:7462717-7462739 GGCAGGGGAGGAGCGGCAGGAGG - Intronic
901230981 1:7641607-7641629 GGTTGGGGATGAGGGTCAGGAGG + Intronic
901454977 1:9358003-9358025 GGCCAGGCAAGAGGCAGAGGGGG + Intronic
901522095 1:9792909-9792931 GGCAGGGGAAGAGACAGAGGTGG + Intronic
901644435 1:10709018-10709040 GGACGGGGGAGAGTGACAGGCGG + Intronic
901672250 1:10862800-10862822 GGCTGGGGAGGGGGGAGAGGGGG - Intergenic
901820122 1:11823614-11823636 GGCGGCGGAAGAGGGAGAGCTGG - Intronic
902611497 1:17600245-17600267 GGCAGGGGAAGAGGGAGGGGAGG - Intronic
903179483 1:21598062-21598084 GGCCTGGGGAGGGGGGCAGGAGG + Exonic
903221854 1:21873679-21873701 GGCTGGGGCAGGGGGCCAGGGGG + Intronic
903283125 1:22261542-22261564 GGGTGGGGCTGAGGGACAGGAGG + Intergenic
903646842 1:24901306-24901328 GGCGGGGGAGGGGGGATAGGAGG - Exonic
904376515 1:30085535-30085557 GCCAGGGGAAGAGGCTCAGGGGG + Intergenic
904480153 1:30788320-30788342 GGCAGGGGAAGAGGTTCAAGAGG - Intergenic
904492667 1:30870449-30870471 GGCAGGGGTAGGGGGACATGAGG + Intronic
904755961 1:32768786-32768808 GGGCAGGGGAGAGGGACAGTGGG + Intronic
904910683 1:33932002-33932024 GGCTGGTGCAGAGGGACATGGGG + Intronic
904913772 1:33954799-33954821 GGCTGGGGGAGAGGGAAAAGAGG + Intronic
905322327 1:37126938-37126960 GGCTGGGGAAGGAGGACATGAGG - Intergenic
905418950 1:37825688-37825710 GGCGGAGGAAGAGGAAGAGGAGG - Intronic
905791441 1:40791749-40791771 GGCCGGGAAGGTGGGACTGGAGG + Intronic
906071404 1:43019281-43019303 GGAGTGGGAAGATGGACAGGAGG + Intergenic
906072839 1:43029632-43029654 GGACAGGGAGGAGGGGCAGGAGG - Intergenic
906108846 1:43310124-43310146 GGCAGGAGCAGAGGGACAGCAGG - Intronic
906226027 1:44122166-44122188 GGCCGTGGCAGAGGAAGAGGGGG - Intronic
906956643 1:50380975-50380997 GGCAGAGGGAGAGGGAGAGGAGG - Intergenic
906957237 1:50384785-50384807 GACTGGGGAGGAGGGAAAGGGGG - Intergenic
907127950 1:52068670-52068692 GGTGGGGGAGGAGGGACAGGAGG - Intronic
907220021 1:52899664-52899686 GGTCGAGGAAGTGGGAAAGGTGG - Intronic
907703234 1:56810059-56810081 GGAGGGGGAAGAGGGAAAGAAGG + Intronic
907733096 1:57086704-57086726 GGCGGGGGGAGGGGGTCAGGGGG + Intronic
908235148 1:62141120-62141142 GGGAGGGGCAGAGGGACAGTGGG - Intronic
908683529 1:66689204-66689226 GGCCGGGGAGGAGGTGGAGGTGG - Exonic
910760720 1:90728809-90728831 GGAAGGGGAGGAGGGAAAGGAGG + Intergenic
911734686 1:101324125-101324147 GGCAGGGGAATAGGGTCTGGAGG + Intergenic
912401633 1:109398029-109398051 GGCCGGGGAAGAGGGACAGGCGG - Intergenic
912478136 1:109955517-109955539 GGCCAGGGAAGAGAGACAGCTGG + Intergenic
912625819 1:111204102-111204124 GAGAGGGGAAGAGGGTCAGGTGG - Intronic
913457688 1:119050128-119050150 GGCTGGAGAAGAGGGACAAAGGG - Intronic
914679054 1:149926320-149926342 GGTTGGGGGAGAGGGTCAGGAGG - Intronic
914833687 1:151189972-151189994 GGCCTGGGAAAAGGGAGGGGAGG - Intronic
915118448 1:153614378-153614400 GGCAGGGGAGGAGGGAGAGCAGG - Exonic
915517541 1:156421882-156421904 GGCCCGGGAAGGGGGAGGGGCGG - Intronic
915525250 1:156472174-156472196 GGCCTGGGGACAGGGACAGTTGG - Intronic
915954014 1:160208256-160208278 TGCTGGGGAAGAGGGGCAGGAGG - Intronic
916003031 1:160634715-160634737 GGCCGAGGGTGAGGGACAGGAGG + Exonic
916037920 1:160936888-160936910 GGCCGGGGAGGCTGGCCAGGCGG + Intergenic
917274109 1:173312639-173312661 GCCTGGGGGAGAGGGACTGGTGG - Intergenic
917969111 1:180196030-180196052 GGCCGGGGCTGAGGGGTAGGTGG + Intronic
918022897 1:180711604-180711626 GGGAGGGGGAGAGGGAGAGGGGG + Intronic
918095111 1:181327954-181327976 GGCAGGGGCAGGGGGACAGCTGG + Intergenic
919022391 1:192123762-192123784 AGTCGGTGAAGAGGGGCAGGAGG + Intergenic
919726608 1:200888596-200888618 GGCAGAGGAAGAGGGGGAGGAGG - Intergenic
919781810 1:201226008-201226030 GGCCGGGGAGGATGCCCAGGAGG - Exonic
920221762 1:204409312-204409334 GGTGGGGGGTGAGGGACAGGAGG + Intronic
920305764 1:205017140-205017162 GGCCGAGGCAGAGGGGCTGGGGG - Exonic
920674489 1:208029628-208029650 GGCAGGGGCAGAGGGAGAAGTGG + Intronic
920735193 1:208527167-208527189 GGCCGGGGGAGGGGGGCAGAAGG - Intergenic
920755922 1:208732370-208732392 GTCCTGGCAGGAGGGACAGGAGG + Intergenic
921261658 1:213389733-213389755 GACCGGGAAAGAGGGAAAGGAGG - Intergenic
921370999 1:214423127-214423149 GGAAAGGGAAGAGGGAAAGGGGG + Intronic
922241318 1:223757062-223757084 CGCAGGGAAAGAGGGCCAGGCGG - Intronic
922898508 1:229118880-229118902 GTCCGGGGGAGAGGTTCAGGAGG + Intergenic
923089499 1:230729087-230729109 GGTCAGGGGAGAGGGTCAGGTGG - Intergenic
923482457 1:234397475-234397497 GGATGGGGAAGAGGGGGAGGGGG + Intronic
923482585 1:234397748-234397770 GGAGGGGGAAGAGGGGGAGGAGG + Intronic
923482601 1:234397778-234397800 GGCGGGGGAGGAGGGGGAGGAGG + Intronic
923858033 1:237865330-237865352 GTCTGGGGAATAGGGACAGGAGG + Intergenic
1062885107 10:1010650-1010672 GGGTGGGGAAGTGGTACAGGGGG - Intronic
1062885157 10:1010818-1010840 GGACAGGGAAGAGGTGCAGGAGG - Intronic
1062922909 10:1293242-1293264 GACGGGGGGAGAGGGACAGAGGG + Intronic
1063145330 10:3290576-3290598 GGCCTGGGAGTGGGGACAGGTGG - Intergenic
1063386542 10:5619758-5619780 GGCCGCAGAAGAAGAACAGGCGG + Intergenic
1064245040 10:13661440-13661462 GGCTGGTGAGGAGGGGCAGGGGG + Intronic
1064529854 10:16297125-16297147 GGAAGGGGAAGAGGGGAAGGAGG + Intergenic
1065793195 10:29280554-29280576 AGACGGATAAGAGGGACAGGAGG - Intergenic
1066518924 10:36194599-36194621 GGCCGGGGAGGAGGAGCAGGGGG + Intergenic
1067246277 10:44549140-44549162 GGCAGGAGAATAGGGTCAGGAGG + Intergenic
1067735317 10:48845961-48845983 GGCTGGAGAATAGGGACACGGGG + Intronic
1067783961 10:49229216-49229238 GGGCAGGGCTGAGGGACAGGCGG - Intergenic
1068316533 10:55351029-55351051 GGAGGGGGAGGAGGGAGAGGGGG - Intronic
1069621663 10:69841068-69841090 GTCCAGGGAAGTGGGGCAGGGGG - Intronic
1069689862 10:70343343-70343365 TGGGGGGGAAAAGGGACAGGTGG + Intronic
1069874565 10:71553600-71553622 GGCAGGGGAGGAGAGACAGCAGG + Intronic
1070746294 10:78935951-78935973 GGCAGGGTAAGTGGGAGAGGAGG - Intergenic
1070963088 10:80512572-80512594 GGACAGGGAAGAGGGATAAGCGG - Intronic
1071298662 10:84240796-84240818 GGCCAGCGAAGATGGAGAGGAGG + Intronic
1071729903 10:88237300-88237322 GGAAGGGGAAGAGGGAAGGGAGG - Intergenic
1072733803 10:97865873-97865895 AGACGGGGGTGAGGGACAGGGGG - Exonic
1073080741 10:100859089-100859111 GAGTGGGGAAGAGGGAGAGGGGG - Intergenic
1073091126 10:100940757-100940779 GGCAGGGGAAGGGGGAGAAGTGG - Intronic
1073134338 10:101211792-101211814 GGGAAGGGAAGAGGGACACGAGG + Intergenic
1073196264 10:101694607-101694629 GGCCGGGGAGGAGGAGGAGGAGG - Exonic
1073381040 10:103078322-103078344 GACAGGGGAGGAGGGACAGTTGG - Exonic
1073523347 10:104155610-104155632 GGCAGGGAAAAAGGGACATGGGG + Intronic
1073562483 10:104508815-104508837 GGCTGGGGAAGGGGGAAAGGGGG - Intergenic
1074142862 10:110690540-110690562 GCTGGGGGAAGAGGGACATGGGG - Intronic
1074158739 10:110820071-110820093 GGCTGGAAAAGAGGAACAGGAGG + Exonic
1074341289 10:112632703-112632725 GGTTAGGGAAGAGGAACAGGTGG + Intronic
1074695750 10:116049070-116049092 GGCAGGGGAATAGGGTCTGGAGG + Intergenic
1075073543 10:119335176-119335198 GGTGGGGGGAGAGGGAGAGGGGG - Intronic
1075130462 10:119733810-119733832 GGCCAGGCAAGTGGGACAAGTGG - Intronic
1075639821 10:124056580-124056602 GGCAGGGGAGGAAGGAGAGGCGG + Intronic
1075911709 10:126130737-126130759 GGCCTGGGAAGAGGGATGGAGGG + Intronic
1075965656 10:126609655-126609677 TGTGGGAGAAGAGGGACAGGAGG + Intronic
1076278922 10:129228835-129228857 TGACGGGGAAGAGGCAGAGGGGG - Intergenic
1076312501 10:129518491-129518513 GGGAGGGGAGGAGGGGCAGGGGG - Intronic
1076312514 10:129518516-129518538 GGGAGGGGAGGAGGGGCAGGGGG - Intronic
1076535562 10:131174520-131174542 GGGCGGGTGAGAGGGAGAGGCGG - Intronic
1076721408 10:132395006-132395028 GGGCAGGGCAGAGGGGCAGGAGG + Intergenic
1076723669 10:132403801-132403823 TGCAGGGGAAGGGGCACAGGGGG - Intronic
1076750289 10:132538812-132538834 GATTGGGGAACAGGGACAGGAGG - Intronic
1076993573 11:288147-288169 GGCCTGGGCAGCGGGACGGGCGG + Intergenic
1077105568 11:840983-841005 GGCTTGGGAAGTGGGAGAGGTGG - Intronic
1077207067 11:1349823-1349845 TGCCGGAGAAGAGGGAAGGGAGG - Intergenic
1077360639 11:2138953-2138975 GGCCTCGGGAGGGGGACAGGCGG + Intronic
1077427029 11:2485686-2485708 GGCTGGGGAAGAGAGAATGGGGG - Intronic
1077495125 11:2883263-2883285 GGCCGGGGCAGTGGTACAGACGG + Exonic
1077497342 11:2892592-2892614 GGGAGGGGAGGAGGGGCAGGGGG - Intronic
1077556398 11:3228109-3228131 GGCCGCAGAAGAGGAAGAGGAGG + Exonic
1078190433 11:9089591-9089613 GGCTGGGGGAAAGGGAGAGGAGG + Intronic
1079601385 11:22316200-22316222 GGCAGGGGGAGAGAGGCAGGGGG - Intergenic
1079601463 11:22316498-22316520 GGCGGGGGAAGAGAGAGAGGAGG - Intergenic
1079727250 11:23891759-23891781 GGCCGGGGCACAGAGAAAGGAGG + Intergenic
1079876087 11:25858926-25858948 GGCCAGGGGAGAGGGGCAAGGGG + Intergenic
1080441132 11:32295562-32295584 GGCAGGGGAGTGGGGACAGGAGG + Intergenic
1080699892 11:34635827-34635849 GTGAGAGGAAGAGGGACAGGAGG + Intronic
1081937841 11:46917583-46917605 GGCTGGGGTAGGGGGGCAGGGGG - Intronic
1083184172 11:61007938-61007960 GGCCTGGGGAGTGGGGCAGGTGG - Intronic
1083359280 11:62094605-62094627 GGGAGGGAAAGAGGGACGGGAGG + Intergenic
1083360164 11:62101411-62101433 GGGAGGGAAAGAGGGACGGGAGG - Intergenic
1083642082 11:64150986-64151008 GGCCGGGGAAGGGGGAGAGCTGG - Intronic
1083828750 11:65217741-65217763 GGCGGGGGCGGGGGGACAGGGGG + Intergenic
1084269918 11:68023248-68023270 GGCCGGGGAAGGGGGCGGGGTGG - Intronic
1084370227 11:68736841-68736863 AGCCGGGGGAGAGGAAAAGGGGG + Intronic
1084455436 11:69265454-69265476 GGGCAGGGAAGAGGGACAAGAGG + Intergenic
1084697200 11:70762784-70762806 GGCCGCTGTAGAGGGCCAGGTGG - Intronic
1085171364 11:74452547-74452569 TGGCAGGGAAGAGGGACAAGAGG - Intergenic
1085723168 11:78931066-78931088 GGCCGGGGAAGAGTTGCTGGCGG - Intronic
1085803295 11:79611525-79611547 GGCAGGGGAAGATGGACACAGGG - Intergenic
1088505405 11:110522304-110522326 GGCTGGGGGAGGGAGACAGGAGG - Intergenic
1088888306 11:114024881-114024903 GGCCTGGGAAGAGGGCATGGTGG + Intergenic
1088919832 11:114252780-114252802 GGCTGGGGCCGAGGGACGGGGGG - Intergenic
1089136823 11:116255827-116255849 GGTCGGGGGAGGGGGGCAGGAGG + Intergenic
1089347569 11:117800262-117800284 CGCCGGGGAAGAGAGTCAGGCGG + Intronic
1090386908 11:126362638-126362660 CCCAGGGGAAGAGGGGCAGGTGG + Intronic
1090645683 11:128765047-128765069 GGCCGGGGGAGGGAGAGAGGAGG + Intronic
1091204791 11:133812757-133812779 GGCCAGGGAAGGGGGAGAGCTGG + Intergenic
1091518961 12:1216599-1216621 GGTCGGGGAGGAGGGATGGGGGG + Intronic
1091620915 12:2088318-2088340 GGCTGGGGAGGAAGGAGAGGAGG + Intronic
1091672445 12:2462084-2462106 GGCTGGTGAGGAGGGAGAGGAGG - Intronic
1091986060 12:4910875-4910897 GGCAGGCGAAGAGGGGTAGGAGG + Exonic
1092287399 12:7136741-7136763 GGCAGGGAAAGAGGGACTGATGG - Intronic
1092894834 12:13001303-13001325 GGCCGGGGATCTGGGACAGGCGG + Intergenic
1096009784 12:48203097-48203119 GGCCGAGGAAGAAGTACATGGGG + Exonic
1096077418 12:48814376-48814398 GGCGGGGGAAGGGGGAGCGGGGG - Intronic
1096153944 12:49331459-49331481 AGGTGGGGAACAGGGACAGGGGG + Intronic
1096230140 12:49892216-49892238 GGGACGGGAGGAGGGACAGGAGG - Intronic
1096651988 12:53066376-53066398 GGAAGGGGAAGAGGAAGAGGAGG - Exonic
1096693025 12:53332853-53332875 GGGCTGGGCAGAGGGAGAGGGGG - Intronic
1097223988 12:57466145-57466167 AGTCGTGGAAGAGGAACAGGGGG + Intronic
1098463339 12:70758697-70758719 GGCCAGAGGAGAGGGTCAGGAGG - Intronic
1099550081 12:84033067-84033089 GGCAGGAGAACTGGGACAGGAGG - Intergenic
1099829346 12:87820663-87820685 GGCCGTGGCAGAGGAAGAGGGGG - Intergenic
1100021133 12:90070770-90070792 TGCAGGGGAAGACAGACAGGAGG + Intergenic
1100091562 12:90978172-90978194 GGCCCAGGAAGAGGAAGAGGAGG - Exonic
1100630736 12:96386845-96386867 GGCCATGGCAGAGGGAGAGGGGG - Intronic
1100742815 12:97613812-97613834 GGGTGGTGAAGAGAGACAGGAGG + Intergenic
1100945906 12:99783723-99783745 GGCAGGGGAGCAGGGAGAGGAGG + Intronic
1101319595 12:103661870-103661892 GGCTGGGCAAGAGAGAGAGGAGG + Intronic
1101607357 12:106257829-106257851 TGCCAGGGAATAGGGAGAGGTGG - Intronic
1101808970 12:108091528-108091550 GGCTGGGGAAGCTGGACATGTGG + Intergenic
1101903697 12:108810080-108810102 GGCCGGGCCTGTGGGACAGGAGG - Intronic
1102025803 12:109713894-109713916 GGCCGGGGGAGGCGGACAGCCGG + Intergenic
1102256416 12:111418168-111418190 GGGCGCGGAAGAGGGCGAGGAGG - Exonic
1102313042 12:111862236-111862258 AGCCTGGGAAAAAGGACAGGAGG + Intronic
1102749179 12:115277265-115277287 GGACGGGGGAGAAGGAGAGGGGG + Intergenic
1102774766 12:115508885-115508907 AGCCAGGGAAGAAGGACACGTGG - Intergenic
1102789863 12:115635966-115635988 GGGAGGGGAAGAGGAAGAGGAGG + Intergenic
1102992012 12:117322357-117322379 GGGAGGGGAGGAGGGACAGAAGG - Intronic
1103005639 12:117418113-117418135 GGAAGGGGAGGAGGGAGAGGAGG + Intronic
1103192893 12:119017536-119017558 GGCTGGGGAAGAGTGTAAGGGGG + Intronic
1103260985 12:119588376-119588398 GGCTGGGGTGGAGGGGCAGGGGG - Intergenic
1103566308 12:121817562-121817584 GGCCGAGGACGAGGGTGAGGTGG - Intronic
1103924017 12:124413882-124413904 GGCAGGGGAAGAGACACAGGTGG + Intronic
1104030938 12:125065499-125065521 GGCCGGGGACCTGGGACCGGAGG - Exonic
1104088385 12:125494777-125494799 GGAGGGGGAAGAGGGGGAGGAGG - Intronic
1104559684 12:129832627-129832649 GGCCTGGGAGGAGGCAGAGGTGG - Intronic
1104863822 12:131941113-131941135 GGCTGGGGAACAGGCACAGGAGG - Intronic
1104983006 12:132582396-132582418 GAACGGGGAAGGGGAACAGGGGG - Intronic
1106435541 13:29720457-29720479 GGCAGGGGAAGGGGCACAGTAGG + Intergenic
1106483979 13:30156779-30156801 GGCGGGGGAAAGGGGACAGGAGG - Intergenic
1106512239 13:30421901-30421923 GGAAGGGGAGGAGGGAGAGGTGG + Intergenic
1106512249 13:30421923-30421945 GGGCGGGGAGGAGGGAGAGGTGG + Intergenic
1106512259 13:30421945-30421967 GGGCGGGGAGGAGGGAGAGGTGG + Intergenic
1106797431 13:33221237-33221259 GGCTGGCGAATAGGGAAAGGGGG - Intronic
1107436854 13:40388005-40388027 GGCAGGGGCAGAGAGACATGAGG + Intergenic
1107740426 13:43444865-43444887 GCCCAGGGAAGAGGTACGGGTGG - Intronic
1107809791 13:44189340-44189362 GGCTGGAGATGAGGGACTGGAGG - Intergenic
1111443629 13:88315108-88315130 GGCCAGGGAAAAGGGAAATGGGG - Intergenic
1111682804 13:91464674-91464696 GGGACGGGAAGAGGGAAAGGTGG + Intronic
1112507868 13:99985614-99985636 GGCGGGGGCAGCGGGACAGCCGG + Exonic
1113200688 13:107865978-107866000 GGCCGGGGGGGACGGGCAGGAGG - Exonic
1113565175 13:111315560-111315582 GGCCAGGGAGGAGGGGCTGGGGG - Intergenic
1113669438 13:112165730-112165752 GGAGGGGGAGGAGGGAGAGGTGG - Intergenic
1113750921 13:112775994-112776016 GTCCGGGGAAGAGGGCTGGGAGG - Intronic
1114559745 14:23581022-23581044 GGCCGGGGGAGGGGGGGAGGAGG - Intergenic
1115409889 14:33062019-33062041 GGCTGGGGAACGGTGACAGGAGG + Intronic
1115578463 14:34734419-34734441 GGCTGGGGAAGAGAAAAAGGAGG + Intergenic
1115680824 14:35736031-35736053 GGCCAGAGCAGAGTGACAGGTGG + Intronic
1115765369 14:36617831-36617853 GGCTGGAGCAGAGGGAAAGGAGG + Intergenic
1116658074 14:47675376-47675398 GGGTGGGGAAGAGGGAAGGGAGG + Intergenic
1116859298 14:49980880-49980902 GGCCAAGGAAGAGGAAGAGGAGG + Intergenic
1116976311 14:51120041-51120063 GGGAGGGGAAGAGGGAAAAGGGG - Intergenic
1117524130 14:56580097-56580119 GACCAGGGGAGAGGGACAGAAGG - Intronic
1117633369 14:57716859-57716881 GGTAGGGGAATAGGGAGAGGTGG - Intronic
1117893597 14:60452508-60452530 GGCGGGGGACTGGGGACAGGTGG + Intronic
1118864864 14:69694915-69694937 GGCCCGAGAAGAGCCACAGGAGG + Intronic
1119319159 14:73719208-73719230 GGAGGGGGAAGAGGTACAGGCGG - Exonic
1119410453 14:74426727-74426749 GGAGGGGGAAGGGGGACAGGGGG - Intergenic
1120606855 14:86590291-86590313 GGCCAAGGAAGAGCGACATGAGG + Intergenic
1121199656 14:92106607-92106629 GGGCGGAGGAGAGGGGCAGGGGG - Exonic
1121425962 14:93852305-93852327 GGCCGGAGAAGAAGGAAAAGGGG - Intergenic
1121629697 14:95413338-95413360 GGACGGGGAAGTGGGCCAGAGGG - Intronic
1122006298 14:98706633-98706655 GCCTGGGGAAGGGGGACAGTGGG - Intergenic
1122021576 14:98842158-98842180 GTCGGGGGGTGAGGGACAGGAGG - Intergenic
1122263866 14:100537864-100537886 GGCCGGGGCAGGGGAACAGCGGG + Exonic
1122296866 14:100710816-100710838 GGACGTGGAGGAGGGGCAGGAGG - Intergenic
1122419074 14:101564096-101564118 GGAAGCGGAGGAGGGACAGGAGG - Intergenic
1123062557 14:105600834-105600856 GGCCAGAGAAGAGGGGCGGGTGG - Intergenic
1124256493 15:28146881-28146903 GGCCGGGAAAGAGGCAGGGGAGG + Intronic
1124567737 15:30832212-30832234 GGCCGGGAAAGAGGCAGGGGAGG - Intergenic
1124619236 15:31264680-31264702 GGAGGGGGATGAGGGGCAGGGGG + Intergenic
1124791249 15:32729438-32729460 GGCGGAAGAAGAGGGAAAGGTGG - Intronic
1125398474 15:39275155-39275177 GGGCTGGGGAGAGGGGCAGGAGG - Intergenic
1125533332 15:40428352-40428374 GGGCTGGGAAGAGGTACAAGAGG - Intronic
1126645757 15:50873442-50873464 GGCAAGGGAGGAGGGAAAGGAGG + Intergenic
1126799276 15:52285475-52285497 GGACGGAGAGGAGGGAGAGGAGG - Intronic
1127330330 15:57932712-57932734 GGCCTGGGAAGATGGTCATGTGG - Intergenic
1127681381 15:61301934-61301956 GGCTGAGGATGAGGGGCAGGCGG + Intergenic
1127819671 15:62644035-62644057 GGAGGGGGCAGAGGAACAGGCGG - Intronic
1128347832 15:66865796-66865818 GGCTGGGGAAGAGGTGAAGGAGG - Intergenic
1128704990 15:69832210-69832232 GGCAGGGGAAGGGGAATAGGAGG + Intergenic
1128931446 15:71708208-71708230 GGCTGGGGAGGAGGGAGAGTAGG + Intronic
1129020508 15:72513715-72513737 GGGAGGGAAGGAGGGACAGGGGG - Intronic
1129240306 15:74247675-74247697 GGCTGGGGATGAGGGAAATGAGG + Intronic
1129270717 15:74417972-74417994 GCCCGGGGAAGAGAGAAGGGAGG + Intronic
1129391441 15:75222966-75222988 GGCTGGGTAACAGGGAAAGGGGG - Intergenic
1129803672 15:78436938-78436960 GGCCAGGGAAAATGGACAGAGGG + Intergenic
1131095611 15:89652726-89652748 GGCCGAGGATGCGGGGCAGGAGG - Exonic
1131135513 15:89931905-89931927 GGCCGAGGAGGAGGAAGAGGAGG + Intergenic
1131284074 15:91043235-91043257 GGAGGAGGAAGAGGAACAGGAGG - Intergenic
1132243556 15:100278133-100278155 GGCTGGGGGAGAGGGAAAGGGGG + Intronic
1132457049 16:29773-29795 GGCCCTGGAGGAGGAACAGGAGG - Intergenic
1132673142 16:1110025-1110047 GGCAGGGGAACAGGGGCAGGGGG + Intergenic
1132702707 16:1228870-1228892 GGCGGGGGGCGGGGGACAGGCGG + Intronic
1132705619 16:1241998-1242020 GGCGGGGGGCGGGGGACAGGCGG - Intronic
1132840817 16:1977774-1977796 GGCCAGGCAAGAGGAGCAGGTGG + Exonic
1132997833 16:2832503-2832525 GGCCTGGGGTGAGGGACAGTGGG - Intronic
1133017567 16:2951333-2951355 GGCAGAGGAGGTGGGACAGGAGG - Intergenic
1133028024 16:2997098-2997120 GGGGGAGGCAGAGGGACAGGCGG - Intergenic
1133177293 16:4025026-4025048 GGCCAGGGAAGTGGGCCAGCAGG + Intronic
1133220032 16:4315952-4315974 GGCCGCGGAGGAGGGCGAGGAGG - Intronic
1133235718 16:4386515-4386537 GGCCTGGGATGGGGGACATGGGG + Intronic
1133326208 16:4943810-4943832 GCCCGGGACAGAGGGACATGTGG + Intronic
1133392384 16:5420887-5420909 GGCAGAGGAGGAGGGAGAGGAGG - Intergenic
1133597187 16:7304138-7304160 AGCCAGGGAGGAGGGACCGGCGG + Intronic
1133679672 16:8109194-8109216 GGCCGGAGAATAGGGTCTGGAGG - Intergenic
1134037559 16:11042394-11042416 GGCCAAGGGAGAGGGACAGGAGG + Intronic
1134280437 16:12812304-12812326 GGCAGGAGAAGAGGGCCTGGAGG - Intergenic
1134425102 16:14134686-14134708 AGACGGGAAAGAGGGACACGAGG - Intronic
1134440721 16:14298377-14298399 GCCTGGGGAAGGAGGACAGGAGG - Intergenic
1134660049 16:15977102-15977124 GGTCGGGGGAGAGGGAGTGGTGG + Intronic
1134804551 16:17113565-17113587 GGCAGGAGAAGGGGGACAGGAGG - Intronic
1134847019 16:17448753-17448775 GGCAGAGGAAGAGGAAGAGGAGG + Intronic
1135419734 16:22297676-22297698 GGGCGGGGAGGAGGGGCAGCCGG + Intronic
1135736124 16:24933157-24933179 AGCCGGGGAATAGGGGAAGGAGG - Intronic
1135950542 16:26910073-26910095 GGACAGGGAAGGGGGACAGTAGG - Intergenic
1136398290 16:30004809-30004831 TGCCGCAGAAGAGGGAGAGGAGG + Intronic
1136566538 16:31073759-31073781 GGGCGGGGAGGTGGGACCGGTGG + Intronic
1137448611 16:48549763-48549785 GGCCTGGGCAGAGGGATGGGGGG - Intronic
1137594839 16:49716693-49716715 AGCCGGGGAGCAGGGAGAGGCGG - Intronic
1137604767 16:49780087-49780109 AGCCAGGGTAGAGGTACAGGAGG + Intronic
1137724211 16:50646117-50646139 GGCGGGGGAAGGGGGCCAGGGGG + Intergenic
1138699512 16:58847069-58847091 GGGAGGGGGAGAGGGAGAGGAGG + Intergenic
1138900689 16:61265495-61265517 AGGCGGGGAAGAAGGAAAGGAGG - Intergenic
1139424915 16:66873672-66873694 GGAGGAGGAAGAAGGACAGGAGG - Intergenic
1139578118 16:67855319-67855341 GGCCAAGGGAGAGGGACACGAGG + Intronic
1139784942 16:69385538-69385560 CGCCGGGGAAGGGGGTCCGGGGG - Intronic
1139946278 16:70644725-70644747 GGAGGGGGAAGAGGAAGAGGAGG + Intronic
1140221623 16:73048160-73048182 GCCCGGGGAAGGGGGGCGGGCGG + Exonic
1140272976 16:73483041-73483063 GGAGGGGGAAGAGGGAGCGGAGG - Intergenic
1140666934 16:77236318-77236340 GGTCGGGGAGCAGAGACAGGAGG - Intergenic
1140767104 16:78170005-78170027 GGTATGGGAAGAGGGGCAGGTGG + Intronic
1141155518 16:81594061-81594083 AGCGGGGGAAGAGGGGGAGGGGG - Intronic
1141380864 16:83575516-83575538 GGCCGAGACAGAGGGACACGTGG - Intronic
1141485774 16:84339395-84339417 GGCCAGGGAGGAGGGAAGGGAGG - Intergenic
1141609177 16:85171412-85171434 GGCCTGGCACGAGGGGCAGGCGG - Exonic
1141635659 16:85312688-85312710 GGAGGGGGAGGAGGGAGAGGAGG + Intergenic
1141644736 16:85361448-85361470 GGCCTGGAAAGAGGGAGACGGGG - Intergenic
1141703455 16:85652703-85652725 GGCCCAGGAAGAGGGGCTGGCGG + Intronic
1142080689 16:88147231-88147253 GGCCTGGGAAGCTGGAAAGGTGG + Intergenic
1142137779 16:88459610-88459632 TGCTGGGGAGGAGGGAGAGGAGG - Intronic
1142137812 16:88459702-88459724 GGAAGGGGAAGAGGGGAAGGGGG - Intronic
1142844983 17:2667390-2667412 GGCCTATGAAGAGGGACAGGAGG + Intronic
1142884449 17:2903972-2903994 GGGCTGGGAAGAGGGGCAGAAGG + Intronic
1142941768 17:3385956-3385978 GGCCGAGGAGGAGGAACACGGGG - Intergenic
1142961824 17:3556364-3556386 GGACGGGGAAGGGGGCCAGCTGG + Intronic
1143173376 17:4943033-4943055 GGCAGGGAAGGAAGGACAGGAGG - Intronic
1143456176 17:7069531-7069553 GGCCGAGGCACAGGGACAGCAGG + Intergenic
1143869771 17:9949817-9949839 GGGAGGGGAAGAGGGAAAGAGGG - Intronic
1143887549 17:10076231-10076253 GGGAGAGGGAGAGGGACAGGGGG + Intronic
1144573915 17:16417142-16417164 TGCAGGGGAAGTGGGCCAGGAGG - Intronic
1144580434 17:16456067-16456089 GGAAGAGGAAGAGGGAGAGGAGG + Intronic
1144676218 17:17163758-17163780 GCGCCAGGAAGAGGGACAGGCGG - Intronic
1144726306 17:17504294-17504316 GGCCAAGGAAGTGGGACAAGAGG + Intergenic
1145220147 17:21081896-21081918 GGCAGGGGAATAGGGTCTGGAGG + Intergenic
1145262189 17:21361054-21361076 GGCCTGGGAAGAGGATAAGGAGG + Intergenic
1145283187 17:21483293-21483315 GGCTGGGGAGGAGGGAGAAGAGG - Intergenic
1145394295 17:22482507-22482529 GGCTGGGGAGGAGGGAGAAGAGG + Intergenic
1145397443 17:22506720-22506742 GGCCTGGGAAGAGAGACGTGGGG + Intergenic
1145868611 17:28256292-28256314 GGCCAGGGAAGAGGAAAAGGTGG + Intergenic
1145929513 17:28675083-28675105 GGAAGGGGAAGAAGGGCAGGAGG + Exonic
1145996207 17:29106350-29106372 GGCAGGGGTGGAGGGGCAGGGGG + Intronic
1146000218 17:29126320-29126342 GGACGGGGAGGAGGGAGGGGAGG + Intronic
1146229424 17:31095119-31095141 GGGAGGGGGAGAGGGAAAGGGGG - Exonic
1146625920 17:34435321-34435343 AGGGGGGGAAGAGGGAAAGGAGG - Intergenic
1146664056 17:34685177-34685199 GGAGGGGGAGGAGGGAGAGGAGG - Intergenic
1146896358 17:36544886-36544908 GGCGGGGGACGAGGGGAAGGTGG - Exonic
1147115665 17:38297364-38297386 GGCCGGGGAAGAGGCTTAGGTGG + Intronic
1147200762 17:38799736-38799758 GCCCGGGGAGGAGGGGCGGGCGG - Exonic
1147588602 17:41666994-41667016 GGCTGGGGAAGAGGCACCAGGGG - Intergenic
1147658561 17:42104925-42104947 GGCCTGGGAAGAGAGACAAGGGG + Exonic
1147761865 17:42803508-42803530 GCCAAGGGAAGAGGGTCAGGAGG - Intronic
1147976901 17:44253064-44253086 GGCCGGGGGTGAGGGGCAGGAGG + Intronic
1148414016 17:47492256-47492278 GGCCGGGGAAGAGGCTTAGGTGG - Intergenic
1148444747 17:47730798-47730820 GGCCCGGGAGGAGGGTGAGGTGG + Intergenic
1148460203 17:47835420-47835442 GGCAGGGGAAGAGGGGTTGGGGG + Intronic
1148868541 17:50642139-50642161 GGTCTGGGAAGAGAGACAGGAGG + Intronic
1148936337 17:51166734-51166756 GGTGGGGGAGGAGGGACCGGCGG + Exonic
1149512686 17:57256429-57256451 CGCCGGGGAGGAGGGGGAGGAGG + Intronic
1149599267 17:57882668-57882690 GGCTGAGGAGGAGGGACAGGAGG - Intronic
1149762760 17:59247384-59247406 GGCAGGGGATGAGGGAAGGGGGG - Intronic
1150285510 17:63951666-63951688 GGCCGGGGAGGCTGGAGAGGCGG - Exonic
1150437360 17:65164409-65164431 TGCCTGAGAAGAGGGACAGCTGG + Intronic
1150565073 17:66331601-66331623 AGCTGGGGAGGAGGGACTGGAGG + Intronic
1151133657 17:71924412-71924434 GGAAGGGGAAGAGGGAAAGGAGG + Intergenic
1151156766 17:72129790-72129812 GGGTGGGGCAGAGGGGCAGGAGG - Intergenic
1151172634 17:72260029-72260051 GCCAGGGGAGGAGGGGCAGGTGG + Intergenic
1151371949 17:73653229-73653251 GGCAGAGGAAGAGGGGGAGGTGG - Intergenic
1151492998 17:74443709-74443731 GGGCAGGGAAGAGGTAAAGGGGG - Intronic
1152249293 17:79203255-79203277 GGATGGGGAAGAGGGGCAGGTGG + Intronic
1152277581 17:79367214-79367236 GGGAGGGGAGGAGGGAGAGGAGG - Intronic
1152433329 17:80261090-80261112 AGCCGGGGAACAGGGTCAGTGGG - Intronic
1152471584 17:80492563-80492585 GGCAGGGCAGGAGGGCCAGGTGG + Intergenic
1152471609 17:80492648-80492670 GGCAGGGCAGGAGGGCCAGGTGG + Intergenic
1152538371 17:80963093-80963115 GGCTGGGGTAGAGGGATGGGAGG + Intronic
1152592436 17:81220292-81220314 GGCCCTGGATGATGGACAGGTGG + Intronic
1152749394 17:82055700-82055722 GGGCGGGGAGGGGGGAGAGGGGG - Intronic
1152870498 17:82751118-82751140 GGAAGGGGGACAGGGACAGGGGG - Exonic
1154318374 18:13324529-13324551 GAACGGGGAAGAGGGAGAAGCGG + Intronic
1154994732 18:21629103-21629125 GGCCGTGGCAGAGGAAGAGGGGG + Exonic
1155221654 18:23690347-23690369 GGCCCGGGAGGTGGGGCAGGAGG - Intronic
1155661102 18:28249108-28249130 GGCTGTGGAAGAGGGGCTGGGGG + Intergenic
1155842120 18:30659020-30659042 GGCAGGGGAACAGGGTCTGGAGG - Intergenic
1156463234 18:37333345-37333367 GGAGGGGGAAGAGGGAGAGGGGG - Intronic
1157366695 18:47071388-47071410 GTACGGGGAAGAGTGTCAGGGGG + Intronic
1157547555 18:48557147-48557169 GGCCTGGGGGTAGGGACAGGAGG + Intronic
1157618787 18:49003373-49003395 GGCAGGGGAGGAGGGAGAGGAGG - Intergenic
1157713103 18:49863549-49863571 GGTGGGGGAAGATGGCCAGGAGG + Intronic
1157811540 18:50700636-50700658 AGGAGGGGAAGAGGCACAGGAGG - Intronic
1158241641 18:55385037-55385059 GGCAGAGGAAGAGAGAAAGGGGG - Intronic
1158536961 18:58316793-58316815 GCCCAGGGAAGAAGGCCAGGAGG - Intronic
1158543073 18:58374450-58374472 GGCCGGGAAAGGGGGGCAGTGGG - Intronic
1158819090 18:61137593-61137615 GGCTGGGGGAGAGGGAAATGGGG - Intergenic
1159915390 18:74183154-74183176 GGAGCGGGAAGAGGGAGAGGAGG - Intergenic
1160585514 18:79911480-79911502 GACCTGGGGACAGGGACAGGTGG - Intronic
1160596150 18:79975728-79975750 GGCCGAGGAACAGGGACACGGGG + Intronic
1160686989 19:441523-441545 GGTGGGGGAACAGGGCCAGGAGG + Intronic
1160703508 19:518743-518765 GGCCGGGGATGGGGGGTAGGAGG + Intronic
1160721078 19:597134-597156 GGCCTAGGAGAAGGGACAGGTGG - Intronic
1160843143 19:1155320-1155342 GGCCGGGCAACAGGGGCTGGGGG + Intronic
1160875897 19:1296014-1296036 GGCCGCGGAATGGGGCCAGGGGG + Intronic
1160965655 19:1745993-1746015 GAGGGGGGAAGAGGGAGAGGAGG + Intergenic
1160965795 19:1746356-1746378 GGATGGGGAGGAGGGAGAGGAGG + Intergenic
1160980796 19:1815755-1815777 GGCCTGGCAGGAGGGGCAGGAGG + Exonic
1161209952 19:3061355-3061377 GGCCCAGGAAGTGGGGCAGGAGG - Intronic
1161370567 19:3908736-3908758 GGAAGGGGAAGAGGGGGAGGAGG - Intronic
1161415674 19:4145270-4145292 GGAGGGGGAGGAGGGAAAGGAGG + Intergenic
1161415752 19:4145510-4145532 GGCTGAGGAGGAGGGAGAGGAGG + Intergenic
1161595662 19:5149928-5149950 GGCAGGGGAGGCCGGACAGGCGG - Intronic
1162061340 19:8097263-8097285 GGGCTGGGAACAGGGAGAGGTGG + Intronic
1162143109 19:8596410-8596432 GGCCTGGGAAGACGGACATGTGG + Exonic
1162235988 19:9309893-9309915 GGCCTGGGAAGCGGGACTTGAGG + Intergenic
1162363138 19:10231315-10231337 GGGCTGGGACGAGGGACAGAGGG + Intergenic
1162398666 19:10432070-10432092 GGGCGGGGAGGGGGGAAAGGCGG + Intronic
1162523981 19:11197089-11197111 GGCCGCGGAGGAGGGCGAGGGGG + Intronic
1162600291 19:11663750-11663772 GGCCTGGGAAATGGGACAGGAGG - Intergenic
1162721999 19:12668161-12668183 GGCAGGGGAAGGGAGGCAGGAGG + Exonic
1162727038 19:12696091-12696113 GGGCGGGGAAGAGGTACATGGGG - Intronic
1162832996 19:13298722-13298744 GCCCGGGGAGGAGGGTCCGGAGG - Exonic
1163004513 19:14389157-14389179 GGAAGGGGAAGAGGGAGAGGGGG + Intronic
1163421397 19:17215572-17215594 GGCCGGGGAGTCGGGCCAGGTGG - Intronic
1163666801 19:18607181-18607203 GGCCGTGGAAGGGGGAATGGAGG - Intronic
1164292473 19:23880494-23880516 GACAGGAGAAGAAGGACAGGGGG + Intergenic
1164438331 19:28251733-28251755 GGCTGGGGATGGGGCACAGGTGG - Intergenic
1164818132 19:31222550-31222572 GGCAGCTGGAGAGGGACAGGAGG - Intergenic
1164962698 19:32448677-32448699 GGCCAAGGACGAGGTACAGGAGG + Intronic
1165333137 19:35152461-35152483 AGCCGAGGAAGCGGGACAGAGGG + Intronic
1165384976 19:35505112-35505134 GGGAGGGGAGGAAGGACAGGTGG - Intronic
1165794662 19:38511892-38511914 GGCTGGGGAGGAGGGACATTTGG + Intronic
1165994291 19:39833407-39833429 GGGAGGGCAAGCGGGACAGGAGG + Exonic
1166040978 19:40202756-40202778 GGCCGGGAAAGAGTGTGAGGTGG - Intronic
1166118755 19:40672208-40672230 GGCCAGGGAAAGGAGACAGGTGG - Intronic
1166139155 19:40796665-40796687 GGCCAGGGAAGGGGGACAGGTGG - Exonic
1166226574 19:41399401-41399423 GGCTGGGCAAGTGGGGCAGGAGG + Intronic
1166333330 19:42091184-42091206 TGCCTGGGAAGAGGGCGAGGAGG - Exonic
1166338370 19:42122450-42122472 GGCAGGGGAAGTGGGACAGATGG - Intronic
1166364005 19:42269457-42269479 GGACGGGGAGGGGGTACAGGGGG + Intronic
1166686605 19:44800307-44800329 GGACAGGGAAGAGGGGCAGAGGG + Intronic
1166861911 19:45816004-45816026 GGCCGACGGAGAGGGAGAGGGGG + Exonic
1167007773 19:46786941-46786963 GGGCTGGGAAGAGGGCCTGGTGG + Intronic
1167191326 19:47991876-47991898 GGAAGGGGAAGAGGGGAAGGAGG - Intronic
1167290087 19:48619755-48619777 GGCCGGGGGAGAAGGAGAAGCGG - Intronic
1167295559 19:48646901-48646923 GGAGGGGGAGGAGGGAGAGGAGG + Intergenic
1167295574 19:48646934-48646956 GGAGGGGGAGGAGGGAGAGGAGG + Intergenic
1167628421 19:50607613-50607635 GGCAGGGGAGGAGCGACAAGAGG - Intergenic
1167762657 19:51459066-51459088 GGCCTGAGCAGAGGGACACGGGG + Intergenic
1168102230 19:54147385-54147407 GGGCGGGCAACAGGGCCAGGAGG + Intronic
1168295164 19:55374592-55374614 GGCCGGGGGTGAGGGTCAGAGGG - Intergenic
1168464987 19:56594997-56595019 GGGCGAGGAGGAGGGACAGGAGG - Intergenic
1168516263 19:57012719-57012741 GGCCAGGCAAGAGGGAGTGGTGG + Intergenic
925041501 2:734643-734665 TGCCATGGAAGAGGGACTGGTGG + Intergenic
925118554 2:1399971-1399993 GGCTGGAGAAGAGGGAAGGGTGG - Intronic
925146772 2:1587560-1587582 GGCGGGGACAGAGGGACAGAGGG - Intergenic
925146828 2:1587748-1587770 GGCGGGGACAGAGGGACAGAGGG - Intergenic
925146961 2:1588198-1588220 GGCAGGGACAGAGGGACAGAGGG - Intergenic
925607558 2:5673800-5673822 GGCCGGGGGTGGGGGACAGAGGG + Intergenic
925776400 2:7340118-7340140 GGCTGGGGAGGAGGCACTGGTGG + Intergenic
925913329 2:8587375-8587397 GGCCTGGGAGGAGGGAGGGGAGG - Intergenic
926259652 2:11247189-11247211 GGCAGGGGCAGGGGGGCAGGTGG + Intronic
926285215 2:11482693-11482715 GGCCGCGGAGGAGGGCCGGGCGG - Intergenic
926340158 2:11898679-11898701 GACAGGGGAAGGGGGAGAGGTGG + Intergenic
926972025 2:18475873-18475895 GGGAAGGGAAGAGGGAGAGGAGG + Intergenic
927500473 2:23579585-23579607 GGCAGTGGAAGTGGGACTGGAGG - Intronic
927515144 2:23667883-23667905 GGCCTGGAAAGAGGAACAGAGGG - Intronic
927553103 2:24016049-24016071 GGCCTGGGAACCGGGACCGGAGG - Intronic
927825918 2:26310235-26310257 GCCCTGAGAAGAGGGACATGGGG + Exonic
928125064 2:28609850-28609872 GGAAAAGGAAGAGGGACAGGTGG - Intronic
928669396 2:33585308-33585330 GGCCGAGGAGGAGGGAGAGGTGG - Exonic
929152094 2:38756720-38756742 GGGAGAGGAAGAGGGAGAGGGGG + Intronic
930172389 2:48265046-48265068 GGCTGGGGAAAAAGGACATGGGG - Intergenic
930358088 2:50346243-50346265 GGCCAGGGAAGATGGGCAGGAGG + Intronic
930755620 2:54969028-54969050 TGCTGGGGGAAAGGGACAGGTGG + Intronic
931205368 2:60140916-60140938 GGAGGGGGAAGAGGAAGAGGGGG - Intergenic
931517425 2:63058207-63058229 GGGAGGGGAAGAGGGTCGGGAGG + Intergenic
931602602 2:64019249-64019271 GGCCGGGGATGTGGGAGAGGCGG - Intergenic
932123530 2:69123116-69123138 AGCCAGGGAAGAGAGAGAGGAGG + Intronic
932257681 2:70301614-70301636 GGCCGCGTAAGAGGGGAAGGTGG + Intronic
933666796 2:84971078-84971100 AGCCGGGGGAGAGGGGCGGGGGG + Exonic
933686686 2:85147383-85147405 GGTGGGGAAAGAGTGACAGGTGG - Intronic
933987589 2:87604698-87604720 GGATGGGGAAGAGGGGGAGGTGG - Intergenic
934653333 2:96104518-96104540 GGCAGGAGAAGGGGAACAGGGGG - Intergenic
934899756 2:98149766-98149788 GGCGGGGGAATAGGGTCTGGAGG - Intronic
935008987 2:99113363-99113385 GGCTGGGGGAGAGGGGAAGGTGG + Intronic
935032747 2:99337806-99337828 GGCCGGGGAAGGGGTGCCGGGGG - Intronic
935072844 2:99711046-99711068 GGCTGGGGAGGAGCGACAGGAGG - Intronic
935110767 2:100092342-100092364 GGCCGGTGAGGATGGAGAGGAGG - Intronic
935196607 2:100820093-100820115 GGCAGGGGAGGAGGCAGAGGCGG + Intergenic
935198538 2:100835854-100835876 TGGAGGGGAAGAGGGGCAGGAGG - Intronic
935622803 2:105144044-105144066 GGACCGGGAGGAGGGAGAGGAGG - Intergenic
935720466 2:105974705-105974727 GGCTGGGGAAGAGGGAAGTGAGG - Intergenic
935874813 2:107494836-107494858 GAGAGAGGAAGAGGGACAGGAGG + Intergenic
936019570 2:108984485-108984507 TGCCGGAGCAGAGGGAAAGGAGG - Intronic
936220484 2:110598644-110598666 GGCCGGTGAGGATGGAGAGGAGG - Intergenic
936306251 2:111346110-111346132 GGATGGGGAAGAGGGGGAGGTGG + Intergenic
937302141 2:120849171-120849193 GGCTGGGGAAGAGGGGAATGAGG + Intronic
937502774 2:122500282-122500304 GGCAGGGAGAGAGGGACGGGAGG - Intergenic
937932684 2:127219102-127219124 GGCGGGGGAAGAGGGGACGGAGG - Intronic
937989431 2:127654125-127654147 GGCAGGAGAAGGTGGACAGGTGG + Intronic
937993081 2:127674966-127674988 GGCCGGGGAGGCGGGACTGCGGG - Intronic
938501533 2:131833335-131833357 GGCCGGGGAAGCGGGAGCAGAGG + Intergenic
939386415 2:141505115-141505137 GGGAGGGGAAGAGAGAGAGGGGG - Intronic
940956595 2:159735477-159735499 GGTAGGGGAAGAGGGACTAGAGG - Intronic
941951437 2:171160625-171160647 GGACAGGGAGGAGGGAAAGGGGG + Exonic
942306332 2:174610906-174610928 GGCTGGAGAAGAGGGCCGGGAGG - Intronic
942524010 2:176833610-176833632 GGCCGGGGAAAGGAGACAGGAGG + Intergenic
942948769 2:181699517-181699539 GCCTGGAGAAGAGGAACAGGAGG + Intergenic
945431473 2:209771043-209771065 GGCCGGGGAGGGGGGTGAGGTGG - Intergenic
946009426 2:216553038-216553060 GGCTTGGGAAGAGGGGCAGGTGG + Intronic
946276296 2:218634237-218634259 GGACTGGGAAGAGGGAGTGGAGG + Intronic
946409083 2:219507579-219507601 GGCAGGGCCAGGGGGACAGGAGG - Intergenic
946419073 2:219554743-219554765 GGCCGGGGGAGATGGAGAGAGGG + Intronic
947490402 2:230589877-230589899 GGCCAAGGAGGAGGAACAGGAGG + Intergenic
948023092 2:234753380-234753402 GGCCGGAGAATAGGGTCTGGAGG - Intergenic
948237363 2:236400928-236400950 GGCCAGGGCAGTGGGACTGGAGG - Intronic
948543030 2:238703478-238703500 GGCCAGGGAAGACAGAGAGGAGG - Intergenic
948814488 2:240502884-240502906 GGCCGTGGAGGTGGGGCAGGGGG - Intronic
1169288830 20:4331675-4331697 GGCTGGGGAAGAGGGAACTGGGG + Intergenic
1170030551 20:11939576-11939598 GCCCAGGGAAGAGGCACGGGAGG + Intergenic
1170322542 20:15116268-15116290 GGCTGAGGAGGAGGAACAGGAGG - Intronic
1170363156 20:15569531-15569553 GGCTGGGGAACAGGGACTAGAGG - Intronic
1170587999 20:17750118-17750140 GGCCGGGGAAGAGGGTCGGATGG - Intergenic
1170736213 20:19016049-19016071 GGCCAGGGCTGAGGGCCAGGAGG - Intergenic
1170888941 20:20363622-20363644 GACGGGAGAAGAGGGAAAGGCGG + Intergenic
1171207246 20:23290675-23290697 GGCCCTGGGAGAGTGACAGGAGG - Intergenic
1171232493 20:23498851-23498873 GTCTGGGGTAGAGGGACGGGAGG - Intergenic
1171266603 20:23776419-23776441 GGCAGGGGCGGAGGGGCAGGGGG - Intergenic
1172259450 20:33549758-33549780 GGCAGGGGCAGAGGGACAACAGG + Intronic
1172433681 20:34913508-34913530 GGCTGGTGAAAAGGGGCAGGCGG + Intronic
1172440942 20:34966062-34966084 GGCTGGGAAAGAGGGTCGGGGGG + Intergenic
1172484064 20:35287972-35287994 GCTGGGGGCAGAGGGACAGGGGG + Exonic
1173397736 20:42696251-42696273 GGAGGAGGAAGGGGGACAGGAGG - Intronic
1173472873 20:43337179-43337201 GGCCGTGGAAGAAGGGCTGGTGG - Intergenic
1173933617 20:46842360-46842382 GGCTGGGGAAGAGGAAAATGAGG + Intergenic
1174338606 20:49882384-49882406 GGCCGGGGAAGAGAGTGAAGTGG - Intronic
1174488677 20:50876977-50876999 GGCCGGGGCTGATGGACAGTGGG + Exonic
1175084195 20:56445219-56445241 GGGAGGGGAGGAGGGAGAGGTGG - Intronic
1175120239 20:56711046-56711068 GGAGGGGGGAGAGGGAGAGGAGG - Intergenic
1175218812 20:57405415-57405437 AACCTGGGGAGAGGGACAGGAGG + Intronic
1175729866 20:61346902-61346924 GGATGGGGATGAGGGACAGATGG - Intronic
1175855425 20:62118454-62118476 GGAGGTGGAAGGGGGACAGGAGG + Intergenic
1175860845 20:62149251-62149273 GGCCTGGGAAGAGGGAGTGCAGG + Intronic
1175887190 20:62298879-62298901 GGCTGGGGCAGAGGGACACACGG + Intergenic
1176005571 20:62860942-62860964 GGCCGGGGCGGAGGCAAAGGGGG - Intronic
1176172195 20:63701041-63701063 AGCCGGGGATGATGGAGAGGTGG + Intronic
1177031617 21:15987120-15987142 GGATGAGGAAGAGGGACAAGTGG - Intergenic
1178413381 21:32384097-32384119 GGCAGGACAAGAGGGACAAGGGG + Intronic
1178444932 21:32631074-32631096 GGCGGGAGCAGAGGGACAGGAGG + Exonic
1179520003 21:41936692-41936714 GGCTGAGGAGGAGGGAGAGGAGG - Intronic
1180845621 22:18979847-18979869 GGCCAGGGAACAGGGAAATGGGG + Intergenic
1181283299 22:21735342-21735364 GGCGGGAGAAGAGGGACAGCGGG + Intronic
1181298641 22:21863057-21863079 AGACGGGGAGGAGGGAGAGGAGG - Intronic
1181595708 22:23913312-23913334 GGAGGGGAAAGAGGGACAGAGGG - Intergenic
1181623445 22:24106368-24106390 GGCCCCTGAAGAGGGGCAGGAGG - Intronic
1181711874 22:24696216-24696238 GGAGGGGGAAGAGGGGGAGGAGG - Intergenic
1181754873 22:25016676-25016698 GGCTGGGGAAGAGGGGAATGGGG + Intronic
1181792521 22:25278685-25278707 GGGAGGGGAAGAGGGGGAGGGGG + Intergenic
1181883377 22:25999529-25999551 GGAGGGGGAAGAGGGGGAGGAGG - Intronic
1181883383 22:25999544-25999566 GGAGGGGGAAGAGGGGGAGGGGG - Intronic
1182269082 22:29142206-29142228 GGCCGAGGCAGAGGGAGAGGAGG - Intronic
1182582112 22:31320377-31320399 GGCCAAGGAAGTAGGACAGGTGG + Intergenic
1182915508 22:34025845-34025867 GGAAGGGGAAGAGGAAGAGGAGG - Intergenic
1183159930 22:36106074-36106096 GACCTGGGAAGAGGGAAAGGGGG - Intergenic
1183311506 22:37112313-37112335 GGGCTGGGACGAGGGACAGTGGG - Intergenic
1183334525 22:37239066-37239088 GGAGGGGGAAGAGGGAGAGAAGG - Intronic
1183671518 22:39275714-39275736 GGCGGAGGAGGAGGGACAGATGG - Intergenic
1183951641 22:41356018-41356040 GCCCGGAGGAGAGGGACATGTGG + Exonic
1184259270 22:43305448-43305470 GGCTGGGGAAGAGGCTCAGGCGG + Intronic
1184288523 22:43485974-43485996 GGCTGGGGGAGATGGACAGCAGG - Intronic
1184419497 22:44371417-44371439 GAGCCGGGAAGAAGGACAGGCGG + Intergenic
1184449706 22:44575731-44575753 GGAAGAGGAAGAGGGAAAGGAGG + Intergenic
1184461501 22:44640424-44640446 GGCCGGGGAGGAGGGAGGAGGGG + Intergenic
1184480002 22:44740842-44740864 GCCCTGGGAAGAGGAAGAGGAGG + Intronic
1184631549 22:45784586-45784608 GGCACGGGAGAAGGGACAGGAGG + Intronic
1184689824 22:46112474-46112496 GGACGAGGAAGAGAGAAAGGAGG - Intronic
1184765261 22:46569027-46569049 GGCCGGGCAGGAGGGACAGCAGG + Intergenic
1184838099 22:47035881-47035903 GCAGGGGGAAGAGGAACAGGAGG - Intronic
1185123873 22:48993136-48993158 GGGAGGGGAAGAAGGAGAGGAGG - Intergenic
1185179393 22:49350347-49350369 GCCCAGGGAGGAGGGAGAGGTGG + Intergenic
1185316927 22:50183331-50183353 GCCTTGGGAAGAGGGTCAGGTGG - Intergenic
1185345209 22:50307809-50307831 GGAGGGGGAAGAGGGGGAGGGGG + Intergenic
1185345225 22:50307838-50307860 GGAGGGGGAAGAGGGGGAGGGGG + Intergenic
949505092 3:4719905-4719927 GGCTGGGGCAGGGGGACAGATGG + Intronic
950018498 3:9770059-9770081 GGCTGGGGAAGGGGCACGGGTGG + Intronic
950184136 3:10934740-10934762 GGCCGGGGAAGAGGCTCCTGGGG + Intronic
950187038 3:10951689-10951711 GGATGGGGAGGAGGGAGAGGAGG - Intergenic
950211556 3:11127068-11127090 GGCCGTGGTAGAGTGAGAGGGGG + Intergenic
950283281 3:11725105-11725127 GGAGGGGGAGGAGGGGCAGGAGG - Intergenic
950434041 3:12967869-12967891 CGCCGCGGAAGAAGCACAGGGGG + Intronic
950524868 3:13517714-13517736 GGCCCAGGAAAAAGGACAGGAGG + Intergenic
950672308 3:14534672-14534694 GTCAGGGGAGGAGGGACAGAGGG + Intronic
951987704 3:28639261-28639283 GGCTGAGGAGGAGGGAGAGGAGG + Intergenic
952006189 3:28845136-28845158 GGCAGGAGAGGAGAGACAGGTGG - Intergenic
953020931 3:39112584-39112606 GGCAGTGGAAAAGGGAGAGGTGG + Intronic
953026707 3:39149524-39149546 GGCAGGAGTAGAGGGACATGGGG - Intronic
953403432 3:42647175-42647197 GACAGGGGAAGAGGGATAGAGGG + Exonic
954316540 3:49804559-49804581 GGCCGTGGATGGTGGACAGGTGG - Exonic
954442372 3:50528735-50528757 GGCAGAGGTTGAGGGACAGGGGG - Intergenic
954464295 3:50645686-50645708 TGCCAGGGCAGAGGGACAGCAGG - Intronic
954679124 3:52332114-52332136 GGCCGGGTGAGAGGGAGAAGGGG - Intronic
954967671 3:54625584-54625606 GGCCAGGGAAGAGGGTCTTGTGG + Intronic
955485047 3:59426678-59426700 GTCGGGGCATGAGGGACAGGAGG - Intergenic
955647431 3:61154956-61154978 GGCAGGGGAAGAGGGCCTGTCGG - Intronic
956889927 3:73602688-73602710 GGCGGGGGAAGAAGGACAATGGG - Intronic
959158807 3:102698494-102698516 GGCAGAGGCAGAGCGACAGGCGG + Intergenic
960097100 3:113699173-113699195 AGCCGGGGACGCGGGGCAGGCGG - Intergenic
960706911 3:120490840-120490862 GGCAGGGGAAGATGGACTAGAGG - Intergenic
961787023 3:129353456-129353478 AGCTGGGGATGGGGGACAGGTGG - Intergenic
961804160 3:129476819-129476841 ACCTTGGGAAGAGGGACAGGTGG + Intronic
963742922 3:149097862-149097884 AGCTGGGGAAGGGGGAGAGGTGG + Intergenic
964374391 3:156035381-156035403 GGAAGGGGAGGAGGGAGAGGAGG - Intergenic
964491615 3:157242092-157242114 GGCAGGGGAAGAAGGACAGTGGG - Intergenic
965507818 3:169535480-169535502 GGATGGGGAAGAGGCCCAGGTGG - Intronic
965606005 3:170498100-170498122 GGCCAGGGAAAGGGGACAGTAGG - Intronic
965772203 3:172193156-172193178 GGGCGGGAATGAGGGAAAGGTGG - Intronic
966260434 3:177971545-177971567 GGACTGGTAAGAGGGATAGGAGG + Intergenic
966861404 3:184232859-184232881 GGCAGGGGGAGAGGGGCAGAGGG + Intronic
966886320 3:184379850-184379872 GGCAGGGGAGGAGGGAGGGGCGG - Intronic
966901886 3:184492561-184492583 GAGCGGGAGAGAGGGACAGGGGG + Intronic
966930658 3:184673463-184673485 TCCAGAGGAAGAGGGACAGGTGG - Intronic
967596253 3:191329427-191329449 GGCCGGGGACGCGGAGCAGGTGG + Exonic
967677998 3:192323555-192323577 GGCCAGGAAAGGGGGACATGGGG + Intronic
968132976 3:196202801-196202823 TGCCGGGGAAGGGGGAGAGTGGG + Intronic
968445797 4:651411-651433 GGCCTGGGATGAGGGCCTGGAGG + Intronic
968534414 4:1113984-1114006 GGCCCGGGGAGCGGGATAGGAGG + Intergenic
968956489 4:3722285-3722307 GGGCGGGGTGGAGGGTCAGGTGG + Intergenic
969054116 4:4390922-4390944 GGCAGGGGCAGGGGGAGAGGAGG + Intronic
969322174 4:6418908-6418930 GGCCTGGGCACAGAGACAGGAGG + Intronic
969394094 4:6909644-6909666 GCCCCCGGAAGAGGGACAGCCGG + Intronic
969454695 4:7294647-7294669 GGGAGAGGAAGAGGGAGAGGGGG - Intronic
969454758 4:7294807-7294829 GGAGGGGGAGGAGGGAGAGGAGG - Intronic
969454770 4:7294831-7294853 GGAGGGGGAGGAGGGAGAGGAGG - Intronic
969454857 4:7295057-7295079 GGAGGGGGAGGAGGGAGAGGAGG - Intronic
969513141 4:7631213-7631235 GGCCGGGGAAGAGTCACCGCTGG + Intronic
969569822 4:8001787-8001809 GGCCAGGGAAGTGGGGAAGGGGG - Intronic
969583787 4:8080469-8080491 GGCCAGGGAAGGGGGACATAAGG + Intronic
969624439 4:8295171-8295193 GACAGGGATAGAGGGACAGGTGG - Intronic
971482302 4:27125577-27125599 GGCTGGAGCAGAGGGAAAGGGGG - Intergenic
973801465 4:54482826-54482848 GCCTGGGGAAGGAGGACAGGAGG - Intergenic
976144730 4:82031509-82031531 GGGCAGGGAAGAGGGACTTGGGG - Intronic
976146031 4:82043864-82043886 GGCAGGGGAGGAGGGCTAGGCGG - Intronic
978346746 4:107777957-107777979 GGCAGGGAAGGAGGGAGAGGGGG + Intergenic
978541647 4:109822440-109822462 GGCCGAGGAGGAGGAAGAGGAGG + Exonic
979278152 4:118836040-118836062 GGCCGGGGAAGAGGCGCGGCGGG - Exonic
982215581 4:153080242-153080264 GGGAGGGGGAGAGGGAAAGGGGG - Intergenic
982322907 4:154098854-154098876 GGCCGGGGAAAAGGGAGATAGGG - Intergenic
982877906 4:160671132-160671154 GGGCGGGGGAGAGAGAGAGGGGG - Intergenic
982933195 4:161435436-161435458 GGGAGGGGAAGAGGGAGAAGTGG + Intronic
983284492 4:165722071-165722093 GGGCAGGGAAGAGGGAAAGGAGG - Intergenic
983931485 4:173457832-173457854 GACTGGGGAAAAGGGACAGCAGG - Intergenic
984222450 4:176994691-176994713 GGAAGGGGAAGAGGGAGGGGAGG - Intergenic
984316035 4:178133684-178133706 GGCCGGAGAAGAGTGAGAGAAGG + Intergenic
985089441 4:186348424-186348446 GGCTGGGGAGGGGGGGCAGGTGG - Intergenic
985549242 5:524705-524727 GCGCGGGGCAGCGGGACAGGCGG + Intergenic
985671630 5:1209790-1209812 AGATGGGGAAGAGAGACAGGGGG - Intronic
985767791 5:1789232-1789254 GGCAGGAGAAGAGGGTCTGGAGG + Intergenic
986064759 5:4224185-4224207 GGGCAGGGTGGAGGGACAGGAGG + Intergenic
986307088 5:6524075-6524097 GGCGGAGGGAGAGGGAGAGGAGG - Intergenic
986591227 5:9372974-9372996 GTCAAGGGAAGAGTGACAGGAGG + Intronic
986726219 5:10599467-10599489 GGAGGAGGAAGAGGGACTGGGGG - Intronic
987062694 5:14257565-14257587 GGGTGGGGAAGGGGGACAGACGG + Intronic
987398802 5:17453376-17453398 GGCCAGGTGAGGGGGACAGGAGG - Intergenic
987751064 5:22039006-22039028 GGCAGTGGCAGGGGGACAGGAGG - Intronic
990407256 5:55503868-55503890 GGCAGGGGAAGAAGTAGAGGGGG + Intronic
990872313 5:60445635-60445657 GGCTGGGGAAGGGGGAAATGGGG + Intronic
991054478 5:62306425-62306447 GGCCGAGGGAGGGGGACCGGAGG - Intronic
992521586 5:77556963-77556985 TGCTGGGCAAGAGGGAAAGGGGG + Intronic
992578998 5:78151881-78151903 GGGAGGGGAAGGGGGAGAGGAGG - Intronic
992579017 5:78151919-78151941 GGGAGGGGAAGGGGGAGAGGAGG - Intronic
993021090 5:82591779-82591801 TGCAGGGAAAGAGGGGCAGGAGG + Intergenic
993386369 5:87267832-87267854 GGCAGGGGAGGAGGGACGGAGGG - Intergenic
993464638 5:88230071-88230093 GGTCGGGGGAGAGGGTGAGGTGG + Intronic
994197175 5:96934852-96934874 GGGAGGGGAAGAGGCAGAGGAGG + Intronic
994335972 5:98566796-98566818 GTCCAGAGGAGAGGGACAGGTGG + Intergenic
995188814 5:109298974-109298996 GGGAGGGGAAGGGGGAGAGGGGG + Intergenic
997180098 5:131819436-131819458 GGGAGAGGAGGAGGGACAGGGGG + Intronic
997524564 5:134544055-134544077 GGCCTGGGCAGAGACACAGGCGG + Intronic
997680780 5:135749344-135749366 GGCTGGGGGAGGGGGACAGTGGG - Intergenic
997696218 5:135863062-135863084 GGCTTGGGAACAGAGACAGGTGG + Intronic
998007809 5:138668693-138668715 GGCCGGGGCAGAGGGCACGGGGG - Intronic
998185219 5:139974295-139974317 GGGAGGGGAAGAGGAAAAGGGGG - Intronic
998819684 5:146047451-146047473 GGGGTGGGGAGAGGGACAGGAGG + Intronic
999251161 5:150183238-150183260 GGCCTGGGAAGATGGAGAGGGGG + Intronic
999574343 5:152958158-152958180 GGCCGGGGTACAGGGGGAGGTGG + Intergenic
1000258066 5:159559871-159559893 GGCGGGGGATGGGGGTCAGGGGG - Intergenic
1000443143 5:161286409-161286431 GGAGGGGGAAGAAGGACAGCAGG - Intergenic
1000627982 5:163561515-163561537 GGCCAGGGAAGAGGAGCAGAAGG + Intergenic
1000930220 5:167242545-167242567 GGCTGGAGAAGAGGAACAGGAGG - Intergenic
1001999109 5:176187149-176187171 GGCTGCAGAAGAGGGAAAGGAGG + Intergenic
1002107924 5:176889293-176889315 GGCCTGAGAACAGGGACAGAAGG + Intronic
1002327612 5:178420336-178420358 GGCAGGGGAGGAGGGAGTGGAGG - Intronic
1002402072 5:178996461-178996483 GGCGGGGGAAGAGAGAAAGGTGG - Intergenic
1002419704 5:179139241-179139263 GGCAGTGGAGGAGGGAGAGGAGG + Intronic
1002448212 5:179302927-179302949 GGGCGGGGGCGAGGGACAGGAGG + Intronic
1002639201 5:180622683-180622705 GGCCTGGGTACAGGGTCAGGAGG - Intronic
1003166131 6:3680059-3680081 TGCCGGGGTAAAGGGAGAGGAGG - Intergenic
1004016758 6:11738450-11738472 GGCTGGGAGAGAGGGGCAGGTGG - Intronic
1005022636 6:21432450-21432472 GGCAGGGGAAGAGGGGAAGAGGG + Intergenic
1005149071 6:22727340-22727362 GGCCAAGGAAGAGGAAAAGGGGG + Intergenic
1006077081 6:31540542-31540564 GGCAGGGGAAGAAGGGAAGGGGG + Exonic
1006091594 6:31631866-31631888 GGGCGTGGAGGTGGGACAGGGGG + Exonic
1006376881 6:33676641-33676663 GCTCGGTGGAGAGGGACAGGTGG + Intronic
1006386289 6:33732879-33732901 GGTAGGGGAAGGAGGACAGGTGG - Intronic
1006642893 6:35497627-35497649 GGTCGGGGAAGAGGGAGAAAGGG - Intergenic
1006806350 6:36792171-36792193 GGCGGGGGAGGATGGGCAGGGGG - Intronic
1006970575 6:38040955-38040977 GGCAGGGGGAGGGGCACAGGCGG - Intronic
1007056013 6:38885592-38885614 GTCACGGGAAGAGGGAGAGGCGG - Intronic
1007340344 6:41187258-41187280 GGACGGGGCAGTGGGAAAGGCGG + Intergenic
1008419720 6:51284041-51284063 GGTGGGGGAAGAGGGTTAGGAGG + Intergenic
1008421577 6:51306658-51306680 GGAGGAGGAAGAGGGAGAGGAGG - Intergenic
1010995631 6:82529026-82529048 GGTAGGGGGAGAGGAACAGGAGG + Intergenic
1011261250 6:85472110-85472132 GGTGGGGGAAGTGGGAAAGGTGG - Intronic
1012399855 6:98834378-98834400 GGACGGGGAGGAGGGCTAGGAGG + Intergenic
1012912782 6:105136770-105136792 GGCCAGCGAGGAGGGACAGAGGG + Intronic
1013633740 6:112009336-112009358 TGCCGGAGAAGAGGCCCAGGAGG + Intergenic
1013792723 6:113855248-113855270 GGCCGGGGAGGGGGAAGAGGCGG - Intergenic
1015488895 6:133802527-133802549 GGCCTGGAAAAAGGGAGAGGAGG - Intergenic
1015516886 6:134091371-134091393 GCCTGGGGAAGAGGGAGTGGAGG + Intergenic
1015965398 6:138692439-138692461 GGCCGGGGGAGGGGAACCGGCGG - Intronic
1017110556 6:150928503-150928525 GGACAGGAAAGTGGGACAGGAGG - Intronic
1017696683 6:157022152-157022174 GGCCGCGGAAGGGGGCGAGGTGG + Intronic
1017759454 6:157556758-157556780 GGCTGGAGCAGAGTGACAGGTGG + Intronic
1017788416 6:157774794-157774816 GGCCTGGGGAGAGGGAGAGAGGG + Intronic
1018027270 6:159816181-159816203 GGGCGGGGCAGGGGGAGAGGTGG - Intronic
1018909515 6:168094065-168094087 TGCCTGGGAAGAGGGGCAGTTGG - Intergenic
1018911607 6:168103810-168103832 GCCTGGGGAAGAGGAAGAGGAGG + Intergenic
1018957422 6:168419576-168419598 GGCTGGGGAAGGGGGAGAGAGGG + Intergenic
1019051596 6:169188031-169188053 GGACAGGGATGGGGGACAGGGGG - Intergenic
1019227812 6:170529665-170529687 GGGTGGGGGAGAGGGAAAGGGGG - Intergenic
1019308102 7:345926-345948 GACAGGAGAAGAGGGAGAGGGGG + Intergenic
1019327643 7:446137-446159 GGAGGGGGAAGAGGGAGAGATGG + Intergenic
1019410684 7:905282-905304 GGACGGGGGACACGGACAGGGGG + Intronic
1019517413 7:1446142-1446164 GGGTGGGGAAGAGGGTGAGGAGG + Intronic
1019618926 7:1980102-1980124 GGCCTGGAGAGGGGGACAGGAGG + Intronic
1019658615 7:2211190-2211212 GGCCCTGGATGAGGGAGAGGAGG - Intronic
1019964042 7:4484515-4484537 GGGAGGGGGAGAGGGAAAGGGGG + Intergenic
1020103203 7:5407122-5407144 GGCTGGGGTGGTGGGACAGGGGG + Intronic
1020418394 7:7970369-7970391 GGCTGGGGGAGAGGGAGAGAGGG - Intronic
1022154408 7:27644818-27644840 CGCTGGGGAAGAGGGAAAGTTGG - Intronic
1022207573 7:28179712-28179734 GGCCGGGGACGCGGGCCCGGGGG - Intronic
1022400753 7:30034667-30034689 GGCAGAGGAAGAGGAAGAGGAGG + Intronic
1022739388 7:33107020-33107042 GGAGGGGGAAGAGGGACACAGGG + Intronic
1022788831 7:33666161-33666183 GGCTGGGGATGAGGGAAATGGGG - Intergenic
1023052648 7:36266730-36266752 GGCTGGGCAAGAGGGGAAGGGGG - Intronic
1023794861 7:43783225-43783247 GGCTGGGAAACAGGGATAGGAGG - Intronic
1024262356 7:47582021-47582043 GGCCGGGGAAGGAGGAAACGCGG - Intronic
1024953334 7:54888659-54888681 GCCCTGGGGAGAGGGACAGTGGG - Intergenic
1025214583 7:57045288-57045310 GGCCAAGGAAGAGGAAGAGGAGG + Intergenic
1025657370 7:63531524-63531546 GGCCAAGGAAGAGGAAGAGGAGG - Intergenic
1026015702 7:66669274-66669296 GGCCGGGGAAGGGGGACAATGGG - Intronic
1026114457 7:67484558-67484580 GGGTGGGGAAGAAGGACTGGAGG + Intergenic
1026571938 7:71538880-71538902 GGGAGGGAAAGAGGGACAGAGGG + Intronic
1026714577 7:72776948-72776970 GGAGGGGGAAGAAGGAAAGGAGG + Intronic
1026892124 7:73988443-73988465 GGCCGGGGAAGGGGGACAATGGG - Intergenic
1027005144 7:74686322-74686344 GGCCGGAGAATAGGGTCTGGAGG - Intronic
1027269977 7:76513782-76513804 TCCCGAGGAAGAGGGACGGGGGG + Intronic
1028582766 7:92424428-92424450 GGTGGGGGAAGGGCGACAGGAGG - Intergenic
1029211873 7:98916027-98916049 GGCCAGGGGAGGGGGGCAGGGGG - Intronic
1029337707 7:99916409-99916431 GTCCAAGGAAGAGGGACAGGAGG - Intronic
1029444387 7:100604409-100604431 GGCCCTGGAAGAGGGATGGGTGG - Intronic
1029710743 7:102298089-102298111 AGCCAGGGAAGAGTGGCAGGAGG + Intronic
1030182983 7:106730233-106730255 AGCTGGAGAAGAGGGAGAGGGGG + Intergenic
1030222402 7:107110607-107110629 GGCCTGGGAAGAGGGCCTCGTGG - Intronic
1031208238 7:118790233-118790255 GGAGGAGGAAGAGGGGCAGGAGG + Intergenic
1031361639 7:120856252-120856274 GGGCGGGGACGAGGGGGAGGTGG - Intronic
1031559357 7:123219033-123219055 GCTCGGGAAAGAGGGATAGGGGG + Intergenic
1031717627 7:125128045-125128067 GGCTGGGGCAGAGGGAAAGGTGG - Intergenic
1032215239 7:129952566-129952588 GGCCGAGGAAGGGAGAGAGGCGG - Exonic
1032479601 7:132235762-132235784 GGGAGGGGAAGATGGAGAGGGGG + Intronic
1033072229 7:138214702-138214724 GGCAGGAGAATAGGGTCAGGGGG - Intergenic
1033099931 7:138460939-138460961 AGCCCGGGGAGAGGGCCAGGAGG + Intronic
1033285249 7:140035857-140035879 GGAGGGGGAAGAGGAAGAGGAGG + Intronic
1034193690 7:149229831-149229853 GGATGGGGCAGAGGGAAAGGAGG + Intergenic
1034349655 7:150407653-150407675 GGACGGGGAGGAGGGTCTGGGGG + Intronic
1034784989 7:153917483-153917505 GGCCAGGGAAGAGGGAACAGCGG - Intronic
1035021788 7:155804781-155804803 GGCCGGGGAGGAGGGCGGGGAGG + Intronic
1035076003 7:156177989-156178011 AGTCGGGGAAGAGGGAGAAGTGG + Intergenic
1035076173 7:156179058-156179080 GGCCGGGGCAGCAGGGCAGGCGG + Intergenic
1035251407 7:157599897-157599919 GGCAGGTGGAGAGGGGCAGGTGG - Intronic
1035251463 7:157600087-157600109 GGCAGGTGGAGAGGGGCAGGTGG - Intronic
1035607222 8:937900-937922 GCCTGGGGTAGGGGGACAGGAGG + Intergenic
1035625743 8:1069236-1069258 GGGCAGGGAAGTGGGAGAGGTGG + Intergenic
1035989612 8:4474755-4474777 GGCTGGGGAGGAGAAACAGGAGG - Intronic
1036172029 8:6496519-6496541 GGCGGGGGAAGGGGGGCGGGGGG - Intronic
1036468960 8:9032767-9032789 GGGAGGGGAAGAAGCACAGGTGG + Exonic
1036493900 8:9252049-9252071 GGAGGGGGAAGGGGGAGAGGGGG + Intergenic
1036642141 8:10591383-10591405 GGCAGGGGCAGAGGCACAGGCGG - Intergenic
1036849912 8:12194176-12194198 GGCCTGGGGATAGGGTCAGGAGG + Intergenic
1036871276 8:12436449-12436471 GGCCTGGGGATAGGGTCAGGAGG + Intergenic
1037216741 8:16463860-16463882 GGCTGAAGAAGAGGGAAAGGAGG - Intronic
1037308473 8:17530175-17530197 GACCGGGGATGGGGGGCAGGGGG - Intronic
1037691258 8:21183350-21183372 GAATGGGGAAGAGGGAGAGGAGG - Intergenic
1037906775 8:22720069-22720091 GGGCTGGGCACAGGGACAGGTGG + Intronic
1038170501 8:25127400-25127422 GGAAGGGGAAGAGGGGAAGGGGG + Intergenic
1038421594 8:27437364-27437386 GGTGGGGCAAGAGGGACAGGTGG - Intronic
1038569502 8:28648345-28648367 GGCAGAGGAAGAGGGATATGGGG - Intronic
1038675742 8:29621365-29621387 GGCTGGGGGTCAGGGACAGGAGG - Intergenic
1038727652 8:30095566-30095588 GGCGGGGGAAGATGGGCCGGGGG + Intronic
1039317304 8:36387795-36387817 GGAAGGGGAAGAGGAAGAGGAGG - Intergenic
1039398993 8:37252662-37252684 TGACGGGGCAGAGGGAAAGGAGG + Intergenic
1039493552 8:37965236-37965258 AACCGGGGCAGAGGGACCGGCGG - Intronic
1039745540 8:40422827-40422849 GGCAGGGGCTGAGAGACAGGTGG + Intergenic
1039778571 8:40761053-40761075 GGCTGGGGCAGTGGGGCAGGGGG + Intronic
1039890435 8:41682173-41682195 GGCGGGGGCAAAGGGACAGTGGG - Intronic
1039921668 8:41897503-41897525 CGCCGGGGATGGGGGACGGGCGG - Intergenic
1040112222 8:43571632-43571654 CCCCGGGGGACAGGGACAGGAGG - Intergenic
1040555593 8:48475078-48475100 AGCCTGGGAAGATGGGCAGGGGG - Intergenic
1040599331 8:48869215-48869237 GGACGGGGAAGTGGGAAGGGAGG + Intergenic
1040683072 8:49837440-49837462 GGCAGGAGAATAGGGTCAGGAGG + Intergenic
1040858027 8:51970372-51970394 GGCAGGGGGTAAGGGACAGGGGG - Intergenic
1041029735 8:53724582-53724604 GGGCGGGGAGGAGGGGGAGGGGG - Intronic
1041330478 8:56719101-56719123 GGAGAGGGAAGAGGGAGAGGAGG - Intergenic
1042052316 8:64724786-64724808 AGCCAGGGAAGAGAAACAGGAGG - Intronic
1042497560 8:69471954-69471976 GGCAGGGGAATAAGGAAAGGAGG + Intronic
1042532735 8:69832413-69832435 GGACGGGGCAGAGGGACTGGGGG + Exonic
1043094182 8:75945781-75945803 GGCTGAGGAAGAGGAAGAGGGGG - Intergenic
1044014196 8:87030922-87030944 GGAGGGGGAAGGGGGGCAGGAGG - Intronic
1044750492 8:95411167-95411189 GGCAGGGGAAGGAGGACAGAAGG - Intergenic
1045013853 8:97981812-97981834 GGCTGGGGATCTGGGACAGGAGG - Intronic
1045474607 8:102542497-102542519 GGAGGGGGAGGAGGGAGAGGAGG - Intergenic
1046644195 8:116766804-116766826 GGCTGGGGAGGAGGCACAGAGGG + Intronic
1046804538 8:118465172-118465194 GGTGGGGGAAGAGGGAAGGGAGG + Intronic
1046962378 8:120124970-120124992 GGGCGGGGATGGGGGAGAGGAGG + Intronic
1047254787 8:123207003-123207025 GGAGGGGGAAGAGGAAGAGGAGG - Intronic
1047696235 8:127406272-127406294 GGAAGGGGAAGGGGGAAAGGGGG + Intergenic
1047741746 8:127812162-127812184 GGGAGGGGAAGAGGGAGAGAGGG + Intergenic
1048922295 8:139242178-139242200 GGAAGGGGAAGAGGCAGAGGAGG + Intergenic
1048986804 8:139739147-139739169 GCATGGGGAAGAGGGGCAGGAGG - Intronic
1048990203 8:139756351-139756373 GGTGGGGGTAGAGGGACAGCAGG + Intronic
1049277030 8:141725105-141725127 TGCCTGGGAGAAGGGACAGGAGG - Intergenic
1049381848 8:142320094-142320116 AGCCCAGGGAGAGGGACAGGAGG - Intronic
1049415323 8:142492355-142492377 GGATGGGGAACAGGGACAGACGG + Intronic
1049476814 8:142800707-142800729 GGCTGGCGGAGAGGGACATGCGG + Intergenic
1049599144 8:143498953-143498975 GGGCGGGGAAGAGGGGCACAGGG + Intronic
1049698031 8:143993205-143993227 GGCTGGGGAGCTGGGACAGGAGG - Exonic
1049737712 8:144218706-144218728 GGGAGGGGAGGGGGGACAGGAGG - Intronic
1050141807 9:2523850-2523872 GGCTGAGGGAGAGGCACAGGTGG - Intergenic
1050231670 9:3532334-3532356 GGCAGAGGGAGAGGGAAAGGTGG - Intergenic
1050744204 9:8857953-8857975 GGCCCGGGAAGAGGAGGAGGAGG - Intronic
1051183855 9:14438869-14438891 GCCCGAGGAAGAGGGACATGGGG + Intergenic
1051371968 9:16366416-16366438 GGCTGGGGAAGGGGGACACCAGG - Intergenic
1052183622 9:25562817-25562839 GGAAGGGGAAGAGGGAAATGGGG + Intergenic
1052996951 9:34556116-34556138 CTGCGGGGAAAAGGGACAGGTGG - Intronic
1053090882 9:35275427-35275449 GGCTGGGGAATAGGAACAGGAGG - Intronic
1053114343 9:35488965-35488987 GGCAGGAGAATAGGGACTGGAGG - Intergenic
1054744850 9:68843908-68843930 GGCCTGGGAAGAGGGGAAGCTGG + Intronic
1054750341 9:68898708-68898730 TGCAGGGAAAGAGGGAGAGGAGG - Intronic
1055812506 9:80165658-80165680 GTCCAGGGAAGACAGACAGGGGG + Intergenic
1056165557 9:83937445-83937467 GGGAGGAGAAGAGGGAAAGGGGG + Intergenic
1056823193 9:89858946-89858968 GGCTGGGGAAAAGGGAAATGGGG + Intergenic
1057127952 9:92634010-92634032 GGGCAGGGCAGAGGCACAGGTGG + Intronic
1057542940 9:95992741-95992763 GGCCAGGGTGGAGGGACATGAGG + Intronic
1057773038 9:97984055-97984077 GGCCGGGGAAGGGGCGCGGGTGG + Intronic
1058139432 9:101342367-101342389 GGGAGGGGGAGAGGGAGAGGAGG + Intergenic
1059535308 9:115075144-115075166 GGCTGGGGGAGAGGCAGAGGAGG + Intronic
1060184644 9:121556834-121556856 GGCTGGGGAGGAGGGTCAGGTGG + Intergenic
1060219954 9:121759270-121759292 GGCTGGGGAGTAGGGACAAGGGG - Intronic
1060319024 9:122538148-122538170 GGCAGGGGCAGGGGGACTGGGGG - Intergenic
1060332460 9:122685826-122685848 GGATGGGGAGGAGGGAAAGGGGG - Intergenic
1060734641 9:126059228-126059250 GGCTGGGTAGGAGGGACAGAGGG - Intergenic
1061005766 9:127927823-127927845 GGTCGGGGAAGGGGGCCGGGTGG - Intronic
1061039762 9:128133337-128133359 GGCTGGGGAAAAGGGAAATGGGG - Intergenic
1061085035 9:128393558-128393580 GGCCGGTGCAGAGGGGGAGGCGG - Intergenic
1061246258 9:129402521-129402543 GGCCGAGGAGGAGGAAGAGGAGG - Intergenic
1061625469 9:131838527-131838549 GGCCGGGAGAGAGGGTGAGGTGG - Intergenic
1061757127 9:132823134-132823156 AGCTGGGGAGGAGGGGCAGGAGG + Intronic
1062018523 9:134304551-134304573 GGCCGGGGGTCAGGGACAGTAGG - Intergenic
1062076711 9:134593661-134593683 GGGCTGGGAAGAGAGAGAGGAGG - Intergenic
1062114813 9:134802651-134802673 GGTGGGGGAAGAGGGCCACGCGG + Intronic
1062225483 9:135447241-135447263 GGCCGTGGCAGGGGGACAGGGGG + Intergenic
1062400724 9:136371525-136371547 GGCCTGGGGGCAGGGACAGGTGG + Intronic
1062541706 9:137044489-137044511 GGCTGGGGAAAAGGGCTAGGAGG - Intronic
1062542884 9:137049300-137049322 GGCCAGTGAGGAGGGACAGCAGG + Intronic
1203361728 Un_KI270442v1:222328-222350 GGCGGGGGAAGGGGGAGAGCCGG + Intergenic
1185734859 X:2488919-2488941 GCAGGGGGAAGAGGGCCAGGCGG + Exonic
1186485665 X:9932604-9932626 GGCTGTGGGAGAGGGACAGGCGG - Exonic
1186655293 X:11605445-11605467 GGCAGGAGAAGAAGAACAGGGGG + Intronic
1187067424 X:15854640-15854662 CGCCGGGGATGGGGGAGAGGGGG - Intronic
1187849181 X:23574529-23574551 GGCGGGGGAAGGGTGAGAGGGGG + Intergenic
1187995486 X:24921960-24921982 TGCCAGGGAAGAGGAACAAGTGG + Intronic
1189069607 X:37849457-37849479 GGCAGGAGAATAGGGTCAGGAGG - Intronic
1189416385 X:40817786-40817808 GGCAGGAGAATAGGGACTGGGGG - Intergenic
1190066477 X:47244995-47245017 GGCTGGGGGTGAGGGAGAGGTGG - Exonic
1190109715 X:47582239-47582261 GGCCCAGGGAGAGGGAGAGGAGG + Intronic
1190367416 X:49709363-49709385 GGGAGGGGGAGGGGGACAGGGGG + Intergenic
1191721274 X:64230668-64230690 GGCCTGGGAAGAGGGGGTGGAGG - Intergenic
1192119194 X:68438911-68438933 GGCAGGGGAATAGGGTCTGGAGG + Intergenic
1192342581 X:70276528-70276550 TGCCAGGGAAGAGGAACAGTGGG + Intronic
1192583383 X:72302535-72302557 AGGCTGAGAAGAGGGACAGGAGG - Intronic
1193190493 X:78564330-78564352 AGACTGGGAAGAGGAACAGGAGG - Intergenic
1193369425 X:80676880-80676902 GGGAGGGGAAGAGGGAGAGGAGG - Exonic
1194669090 X:96708211-96708233 GGGTGGGGAAGAGTCACAGGAGG - Intronic
1195196656 X:102503640-102503662 AGCCTGGGGAGAGGGAAAGGGGG - Intergenic
1195238615 X:102927899-102927921 GTCCAGGGAAGAGGCACAGGTGG + Intergenic
1195768970 X:108328377-108328399 GGAAGGGGGAGAGGGAAAGGGGG + Intronic
1197505380 X:127296231-127296253 GGCCAGAGAAGAGTGACAGACGG + Intergenic
1197774478 X:130110564-130110586 GGGCGGGGAAGAAGGGCGGGCGG - Intronic
1198266252 X:135011708-135011730 GGAAGAGGAAAAGGGACAGGAGG + Intergenic
1198960291 X:142175424-142175446 GCCCTGGGAAAAGGGGCAGGAGG - Intergenic
1199975389 X:152892177-152892199 GGTCAGGGAAGAAGGAGAGGAGG + Intergenic
1200098321 X:153674408-153674430 GGCCGGGGAAGAGGTGGAGGAGG - Intronic
1200100151 X:153686135-153686157 GGCCGAGGCAGAGGGCGAGGTGG - Intronic
1200181870 X:154155668-154155690 TGCCAGGGATGAGGGACTGGCGG - Intronic
1200187519 X:154192782-154192804 TGCCAGGGATGAGGGACTGGCGG - Intergenic
1200193169 X:154229922-154229944 TGCCAGGGATGAGGGACTGGCGG - Intronic
1200198924 X:154267726-154267748 TGCCAGGGATGAGGGACTGGCGG - Intronic
1200374733 X:155767637-155767659 GGAGGGGGAAGAGAAACAGGAGG + Intergenic
1200399312 X:156009953-156009975 GGCCCTGGAGGAGGAACAGGAGG + Exonic
1201063887 Y:10070602-10070624 GGCAGGGGATGGGGGACAGGTGG + Intergenic
1201300278 Y:12498849-12498871 GGAGGAGGAAGAGGGACAGGAGG - Intergenic