ID: 912401634

View in Genome Browser
Species Human (GRCh38)
Location 1:109398032-109398054
Sequence GTGGGCCGGGGAAGAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 687
Summary {0: 1, 1: 1, 2: 2, 3: 66, 4: 617}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401634_912401644 3 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401644 1:109398058-109398080 TCATTGGCTCGCGTCGCCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 25
912401634_912401647 11 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401634_912401646 10 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401634_912401649 18 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401634_912401648 12 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39
912401634_912401645 9 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34
912401634_912401652 24 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401634 Original CRISPR GTGGGCCGGGGAAGAGGGAC AGG (reversed) Intergenic
900040086 1:453413-453435 GAGGCACTGGGAAGAGGGACCGG + Intergenic
900061518 1:688389-688411 GAGGCACTGGGAAGAGGGACCGG + Intergenic
900157862 1:1210775-1210797 GTGTGGAGGGGAAGAGGGGCAGG + Intergenic
900879952 1:5373633-5373655 GTGGGCAGGGGACTAGGGAATGG + Intergenic
900883926 1:5402184-5402206 GTGGGCCAGGGCAGGGGGGCAGG - Intergenic
901038885 1:6352344-6352366 GTGGGGAGGGGAAGAGGGAGGGG - Intronic
901199241 1:7457430-7457452 GTGGGTGGGGGCAGAGGCACGGG + Intronic
901317052 1:8316566-8316588 GAGGGCTGGGGAGGTGGGACAGG - Intergenic
901644434 1:10709015-10709037 ATGGGACGGGGGAGAGTGACAGG + Intronic
901730037 1:11272994-11273016 GTGGGGCGGGGCTGAGGGGCGGG - Intergenic
901836972 1:11930441-11930463 GTGGGTGGGGGCGGAGGGACGGG + Intergenic
902222560 1:14976349-14976371 GTGGCCGGGGCAAGAGTGACTGG - Intronic
902611498 1:17600248-17600270 CAGGGCAGGGGAAGAGGGAGGGG - Intronic
902659454 1:17891080-17891102 GTGGGCAGGGGGTGAGAGACGGG - Intergenic
902724154 1:18324022-18324044 GTGGGATGGGGGAGTGGGACCGG - Intronic
902878198 1:19353457-19353479 AAGGGCAGGGGAAGAGGGGCAGG - Intronic
903185213 1:21624949-21624971 ATGCTCAGGGGAAGAGGGACTGG + Intronic
903295847 1:22342740-22342762 CTCGGCTGGGGACGAGGGACAGG + Intergenic
903340923 1:22653765-22653787 CTGGGCCGGGCAGGAGCGACTGG - Intronic
903766877 1:25740787-25740809 GTGGATCGGGGAAGAGGGAAGGG + Intronic
903891840 1:26574925-26574947 GTGGGCGGGCCATGAGGGACAGG + Intronic
904006098 1:27364129-27364151 GTGGGCTGGGGCTGAGGTACAGG - Intronic
904028284 1:27518643-27518665 GTAGGCCAGGGCAGAGGGGCAGG + Intergenic
904099805 1:28015371-28015393 GTGGGCTAGGGAATAGGGAATGG + Intronic
904131801 1:28281049-28281071 GTGGGCAGGGGAAGGAGGAAGGG - Exonic
904298307 1:29538204-29538226 GTGGGACAGGGAAGAGAGAGGGG - Intergenic
904334547 1:29788103-29788125 GTGGCCCAGAGAAGAGAGACAGG - Intergenic
905359605 1:37410347-37410369 GTGGGGCGGGGCAAAGGGAGGGG + Intergenic
905526892 1:38646767-38646789 GTGGGGAGAGGAAGAGGGAGAGG - Intergenic
906741783 1:48191741-48191763 GTGGGGAGAGGGAGAGGGACAGG - Intergenic
907581275 1:55574810-55574832 GTGTGACGGGAAAGAGGGAAAGG - Intergenic
908272878 1:62437406-62437428 GAGGGCCTGGGAGGAGGGGCCGG + Intronic
908796379 1:67833977-67833999 GGGGGTCGGGGCAGATGGACGGG - Intergenic
909392981 1:75136668-75136690 AGGCGCCGGGGAAGAGGGACTGG + Exonic
909539142 1:76771341-76771363 GTGAGCCGGGGGAGTGGGAAAGG + Intergenic
909641313 1:77871086-77871108 GTGGGAAGGGGGAGAGGGAGAGG + Intronic
910138322 1:83998841-83998863 GGGGGCCCGGAAAGAGGGCCAGG + Intronic
911124448 1:94327515-94327537 GGGGGCGGGGCGAGAGGGACGGG + Intergenic
911343449 1:96668397-96668419 GTGGACTGGGAAAGACGGACTGG + Intergenic
911514258 1:98847672-98847694 ATGGGCCGGGGCGGGGGGACAGG - Intergenic
912401634 1:109398032-109398054 GTGGGCCGGGGAAGAGGGACAGG - Intergenic
912562006 1:110557674-110557696 GTGGGATGGGGCAGAGGGGCAGG + Intergenic
913056018 1:115160086-115160108 GAGGGCAGGGGAAGGGGGAGAGG + Intergenic
913674881 1:121131249-121131271 GTTGGCCCGAGAAGAGGGAGAGG - Intergenic
914026722 1:143918881-143918903 GTTGGCCCGAGAAGAGGGAGAGG - Intergenic
914665104 1:149826316-149826338 GTTGGCCCGAGAAGAGGGAGAGG - Intergenic
914670661 1:149867505-149867527 GTTGGCCCGAGAAGAGGGAGAGG + Intronic
914677738 1:149917266-149917288 GGGGGCAGGGGAAGAAGGGCAGG - Intronic
914718018 1:150267693-150267715 GTGAGCCAAGGGAGAGGGACTGG - Intronic
914747761 1:150512166-150512188 GTGGGCTTGGGAAGGTGGACGGG - Intronic
915312702 1:155012266-155012288 GTGGGCAGGGAAGGAGGGAGAGG + Intronic
915315399 1:155026023-155026045 GGGGGTGGGGGATGAGGGACGGG - Intronic
916003030 1:160634712-160634734 GGGGGCCGAGGGTGAGGGACAGG + Exonic
916511385 1:165474975-165474997 GTGGGCTGTGGGAGAGGGAAGGG + Intergenic
916694399 1:167221326-167221348 CGGGGCCGGGGCAGAGGGAGAGG + Intronic
918022894 1:180711601-180711623 GTGGGGAGGGGGAGAGGGAGAGG + Intronic
918077672 1:181182682-181182704 GTGGGCTGGGGGAGAGGCAGTGG + Intergenic
919036708 1:192320146-192320168 GTGGGAGGAGGAAGAGGGTCAGG + Intronic
919515312 1:198514974-198514996 GTAGGCAGGGAAAGAGGGAAAGG + Intergenic
919570606 1:199243190-199243212 GTGGGGAGGGGGAGAGGGAGAGG + Intergenic
920188853 1:204179531-204179553 GTGGGTGGGGGCAGAGGGAAGGG + Intergenic
920454970 1:206093848-206093870 TTGGTCGGGGGAGGAGGGACAGG + Intronic
920590515 1:207214266-207214288 GTGGGCCAGGGGAGAGGGCCAGG - Intergenic
920706880 1:208257888-208257910 GTGGGCAGGGGCACAGGGAATGG + Intergenic
921261659 1:213389736-213389758 GAGGACCGGGAAAGAGGGAAAGG - Intergenic
922402788 1:225277119-225277141 GGGGGACGGGGAAGGGGGAAGGG + Intronic
922999085 1:229991136-229991158 TTGGGCCGGAGAAGTGGGTCAGG + Intergenic
923045264 1:230350912-230350934 GAGGGTCGGTGAAGAGGGTCGGG - Intronic
923110268 1:230884686-230884708 GTGGGCAGGGGGTGAGGGAATGG - Intergenic
923250840 1:232178470-232178492 GTGGGCAGGGGACTAGGGAATGG - Intergenic
924314046 1:242777046-242777068 TAGGGCAGGGGCAGAGGGACTGG + Intergenic
1063155045 10:3371619-3371641 GTGGGCAGGGGACCAGGGAATGG + Intergenic
1063386222 10:5617767-5617789 GAGGGCCGGGGAAGATGAGCTGG + Intergenic
1064191780 10:13212790-13212812 CTGGGGCTGGGAAGAGGTACAGG - Intergenic
1064640659 10:17412236-17412258 GAGGGCCTGGGATGAGGGATAGG - Intronic
1065807889 10:29411711-29411733 GTGGTGCGGGGACGGGGGACGGG - Intergenic
1065825148 10:29564039-29564061 GTGGGCGGGGCAAGAGGGCAGGG - Intronic
1065952261 10:30662875-30662897 GTGGGCGGGGCAAGAGGGCAGGG + Intergenic
1067708249 10:48627126-48627148 TAGGGCCAGGGAAGAGGGAGGGG - Intronic
1067783962 10:49229219-49229241 GTGGGGCAGGGCTGAGGGACAGG - Intergenic
1068763000 10:60733356-60733378 GCGGGACGGGGAGGAGAGACTGG - Intronic
1069714962 10:70514768-70514790 GTGCGCCTGGGCAGAGGGCCAGG + Intronic
1069835440 10:71305058-71305080 GTGGGGTGGGGACTAGGGACAGG - Intergenic
1069917311 10:71795666-71795688 GTGGGGAGGGGAAGAGGCACTGG - Intronic
1070016791 10:72541608-72541630 GTGGGCAGGGGACTAGGGAATGG - Intronic
1071311656 10:84348489-84348511 GTGGGGAGAGGAAGAGGGAGAGG + Intronic
1072684799 10:97529774-97529796 GTGGGGAGAGGGAGAGGGACTGG + Intronic
1072806405 10:98426221-98426243 GTGGGCAGGGGCAGAGGGGCTGG + Intronic
1073178360 10:101569882-101569904 GTGGGCGGGGAAAGAGGGATGGG + Intergenic
1073291355 10:102414828-102414850 GTGGGAGGGGGAAGTGGGAGAGG - Intronic
1073313284 10:102559672-102559694 GGGGGCAGGGGAAGAGTAACTGG - Intronic
1073582555 10:104681471-104681493 GTGGGCTGAGGAAGAGGCTCTGG + Intronic
1073585676 10:104707803-104707825 GTGGGCTGGGGATGGGGGAAGGG - Intronic
1074360497 10:112821327-112821349 GGAGGCCGGGGAAGTGGGAGGGG - Intergenic
1074362028 10:112831351-112831373 GTGGGGCTGGGAAGAGGCGCTGG + Intergenic
1074541965 10:114372398-114372420 CTGGGCCGGGTAGGAGGGGCAGG + Intronic
1074915485 10:117951063-117951085 GTGGGCTGATGTAGAGGGACAGG + Intergenic
1074982941 10:118634170-118634192 GTGGGGAGGGGACGGGGGACAGG + Intergenic
1075650604 10:124126348-124126370 GAGGGGAGGGGAAGAGGGACGGG - Intergenic
1076536074 10:131178556-131178578 CAGGGCCTGGGAAGAGGCACAGG + Intronic
1076674847 10:132142493-132142515 GGAGGCCGGGGGAGAGGGGCCGG - Intronic
1076822024 10:132944167-132944189 GTGGGCCGGGGCACAGGGCAGGG + Intergenic
1076882619 10:133247116-133247138 GTGGTCGGGGGAAGTGGGGCGGG - Intergenic
1076966310 11:89320-89342 GAGGCACTGGGAAGAGGGACCGG + Intergenic
1077107395 11:848135-848157 GTGGCCAGGGGAAGGGGGCCGGG + Intronic
1077236366 11:1483837-1483859 GTGGGCAAGGGAAGGGGCACAGG + Intronic
1077248129 11:1548930-1548952 GTGGGCGGGGGGAGGGGGACGGG - Intergenic
1077385970 11:2269677-2269699 GGGGGCCGGGGTGGAGGGACGGG - Intronic
1077406628 11:2385339-2385361 CTGGGACGGGGAGGAGGGGCAGG - Intronic
1077538064 11:3133936-3133958 GGAGGCCAGGGAAGAGGGAGTGG + Intronic
1079563726 11:21854514-21854536 GTGGGCAGGGGACTAGGGAATGG + Intergenic
1080034555 11:27699203-27699225 GTAGAGCGGGGATGAGGGACCGG - Intronic
1080250398 11:30227185-30227207 GTGGGCAGGGGACTAGGGAATGG + Intergenic
1080600777 11:33819175-33819197 TTGGGCAGGGGAAGGGGGAAAGG - Intergenic
1080884204 11:36350347-36350369 GTGTGCCGGGGAGGAGGAAGTGG + Intronic
1081621340 11:44620657-44620679 GTGGGCTGGTGATGGGGGACAGG + Intergenic
1081831929 11:46121579-46121601 GAGAGCCGGGCGAGAGGGACTGG + Intergenic
1083069237 11:59959971-59959993 GTGGGAAGAGGAAGAGGGTCAGG + Intergenic
1083273073 11:61581550-61581572 GCGGTCCGGGGCAGACGGACTGG + Intergenic
1083275429 11:61594503-61594525 ATGGTCCGGTGAAGAGGGACGGG + Intergenic
1083686506 11:64379267-64379289 GTGGCCCAGGGAAGGGGGACCGG - Intergenic
1083777323 11:64900624-64900646 CTTGCCCTGGGAAGAGGGACAGG + Exonic
1083779475 11:64910505-64910527 GAGCACAGGGGAAGAGGGACAGG + Intronic
1083945868 11:65922223-65922245 GTGGGACAGGGAACAGGTACAGG + Intergenic
1084190160 11:67495054-67495076 GTGGGCCTGGGAATATGGAATGG - Intronic
1084269919 11:68023251-68023273 GAGGGCCGGGGAAGGGGGCGGGG - Intronic
1085022665 11:73218933-73218955 GTGGGCGGGGGAGGAGGGAGTGG + Intronic
1085139874 11:74130114-74130136 GTGGGGAGGGGGAGAGGGAGAGG + Intronic
1085411144 11:76291497-76291519 GTGTGGCTGGGAAGAGGGCCTGG - Intergenic
1085689779 11:78655603-78655625 GGGGGCTGTGGAGGAGGGACAGG + Exonic
1086144242 11:83533996-83534018 GTGGGGTGGAGAAGAGGGAAAGG + Intronic
1088613616 11:111602367-111602389 GGGGGCCGGGGCAGGGGGGCGGG - Intergenic
1088888305 11:114024878-114024900 GTTGGCCTGGGAAGAGGGCATGG + Intergenic
1088919835 11:114252783-114252805 GAGGGCTGGGGCCGAGGGACGGG - Intergenic
1089339089 11:117745435-117745457 GTGGGGCGGGGGACAGGGATGGG + Intronic
1089770322 11:120797794-120797816 GTGGGCAGGGAAAGAGGAATGGG + Intronic
1090202538 11:124866532-124866554 GTGGGTCGAGGCAGAGGGATGGG - Intronic
1090621244 11:128562828-128562850 GTGGGCAGTGGAGGAGGGAATGG - Intronic
1090748854 11:129728730-129728752 GAGGGACGGGGAAGGGTGACTGG + Intergenic
1091823570 12:3493209-3493231 GGGGGCTGGGGAAGAGGAAGTGG - Intronic
1092117081 12:6017025-6017047 GTGGGCCAGGGAGGAGGGGATGG + Intronic
1094041512 12:26125117-26125139 GGGGGCGGGGGAGGAGGGGCCGG + Exonic
1095598605 12:43989066-43989088 GTGGGCAAGGGAAAAGGGAGCGG + Intronic
1095904244 12:47361145-47361167 GTGGGGCAGGGAAGAGGGAGAGG - Intergenic
1096489833 12:52007366-52007388 GCGGGCCGGGGAAGAAGGTGGGG - Intronic
1097167601 12:57094006-57094028 GTGGAAGGGGGAAGAGGGAGTGG + Intronic
1097208197 12:57342279-57342301 GTGGGTGGGGGAAGAGGCACAGG - Intronic
1099607541 12:84824281-84824303 GTGGCCCAGGGATGAGGGAAGGG - Intergenic
1100226315 12:92559884-92559906 GTGGGAGGAGGAAGAGGGTCAGG - Intergenic
1100405799 12:94272081-94272103 GAAGGCCCGGGAAGAGGGCCAGG - Intronic
1102021050 12:109683192-109683214 GGGGGCAGGGGAGGAGGGACAGG + Intergenic
1102470687 12:113158252-113158274 GTGGGCTGGGGGAGGGGAACAGG - Exonic
1102569471 12:113818811-113818833 GTGGGGCCTGGAGGAGGGACAGG - Intronic
1102856956 12:116302471-116302493 GTGGGCACGGGGAGAGGGGCTGG + Intergenic
1103260988 12:119588379-119588401 GTGGGCTGGGGTGGAGGGGCAGG - Intergenic
1103715741 12:122944515-122944537 GTGAGCTGGGGCAGAGGGAGAGG + Exonic
1104030939 12:125065502-125065524 GAGGGCCGGGGACCTGGGACCGG - Exonic
1104637527 12:130447477-130447499 GGAGGCGGGGGAGGAGGGACAGG + Intronic
1104858995 12:131915136-131915158 GTGGGCAGGGGGCGAGGGGCTGG - Exonic
1104914403 12:132257442-132257464 GAGGGCCGGGGATGAGGGCATGG - Intronic
1104914414 12:132257469-132257491 GAGGGCCGGGGACGAGGGCGTGG - Intronic
1104914428 12:132257510-132257532 GAGGGCCGGGGACGAGGGCGTGG - Intronic
1104914453 12:132257578-132257600 GAGGGCCGGGGACGAGGGCTGGG - Intronic
1104914459 12:132257591-132257613 GAGGGCCAGGGATGAGGGCCGGG - Intronic
1104975207 12:132549076-132549098 GTGGCCGGGGGAGGAGGGTCTGG + Intronic
1104981885 12:132576909-132576931 CTGTGCTGGGGAAGAGGGGCCGG - Exonic
1106269241 13:28138328-28138350 GCGGGCAGGGGAAGAGGGAGCGG - Intergenic
1106512248 13:30421920-30421942 GTGGGGCGGGGAGGAGGGAGAGG + Intergenic
1106512258 13:30421942-30421964 GTGGGGCGGGGAGGAGGGAGAGG + Intergenic
1107426270 13:40296231-40296253 GTGGGCAGGGGACTAGGGAATGG + Intergenic
1107427342 13:40306973-40306995 GTGGGCGGGGGACTAGGGAATGG + Intergenic
1107439678 13:40414647-40414669 GAGGGCTGGGGAAGGGGGAGAGG + Intergenic
1108323356 13:49307120-49307142 GTGGGCTGGGGATGGGGGGCGGG - Intergenic
1108485443 13:50918779-50918801 GGGTGCCGGGGCAGTGGGACGGG + Intronic
1109326730 13:60876921-60876943 GTGCTCCTGGGAAGAGGGAGAGG + Intergenic
1112496831 13:99911771-99911793 CTGGGCCGAGGAAGAGTGGCTGG - Intergenic
1113578825 13:111414010-111414032 GTGGAGCTGGGAAGAGGGCCTGG - Intergenic
1113750922 13:112775997-112776019 GGGGTCCGGGGAAGAGGGCTGGG - Intronic
1113806712 13:113114246-113114268 GTGGGATGTGGAAGTGGGACAGG - Intronic
1114932548 14:27492064-27492086 GTGGGAGGAGGAAGAGGGCCAGG + Intergenic
1115323813 14:32114875-32114897 GTGGGCAGGGGAAGGCGCACAGG - Intronic
1118072861 14:62264822-62264844 GTTTGCAGGGGAAGAGGGAGTGG + Intergenic
1118142838 14:63103698-63103720 GTGGGGGGGGGAAGTGGGAGGGG - Intergenic
1118181402 14:63497006-63497028 GTGGGCAGGGGGAGGGGTACTGG - Intronic
1118647235 14:67851656-67851678 GTGTACCTGGGAAGAGGGAATGG + Intronic
1119562880 14:75605027-75605049 GCGGGCAGGGGTAGGGGGACCGG + Intronic
1119744353 14:77033596-77033618 GAGGGGCGGGGAACAGGGAGGGG + Intergenic
1119868685 14:77994514-77994536 GTGGGGAGAGGGAGAGGGACAGG + Intergenic
1122058839 14:99123287-99123309 AAGGGCAGGGGAAGAGGGAAGGG - Intergenic
1122081214 14:99269139-99269161 GGGGGTCGGGGAAGGGGGAGTGG - Intronic
1122306487 14:100769904-100769926 GTGGGCCTGGGGAGTGGGTCTGG - Intergenic
1122344141 14:101047726-101047748 TTGGGCAGGGGAAGGGGGTCTGG - Intergenic
1122690879 14:103531678-103531700 GTGGGACGGGATAGAGGGAGTGG + Intronic
1122881711 14:104693265-104693287 GTGGGGTGGGGGAGAGGGAGTGG + Intronic
1123128594 14:105967887-105967909 GTGGGCCAGGGAAGAGTGCACGG - Intergenic
1123448404 15:20345585-20345607 GGGGGCCTGGGGAGAGGGAGGGG - Intergenic
1124252474 15:28115924-28115946 GTGGGACAGGAAGGAGGGACTGG + Intronic
1124392223 15:29269594-29269616 GCGGGCCGGGGAAGACGCCCGGG - Exonic
1125930492 15:43596190-43596212 GTGGTCCTGGGAAGAGTAACGGG - Exonic
1125943660 15:43696022-43696044 GTGGTCCTGGGAAGAGTAACGGG - Exonic
1127499522 15:59543465-59543487 CTGCGCCGAGGAAGAGGGAGGGG + Intergenic
1128073294 15:64810701-64810723 GGGGGCCAGGCAAGAGGGGCGGG - Intergenic
1128309457 15:66621467-66621489 GTGTGCAGTGGAAGAGGGGCTGG + Intronic
1128380690 15:67109868-67109890 GTGGGCCGTGGAGGAGGAGCGGG - Intronic
1128565405 15:68697780-68697802 CTGGGCTGGGAAAGAGGCACAGG + Intronic
1128813507 15:70588382-70588404 GTGGGGTGGGGAGGAGGCACAGG - Intergenic
1129295031 15:74595563-74595585 GTGGGCAGAGGAAGAGCGAAGGG - Intronic
1129712122 15:77825769-77825791 CTGGGCTGGGGAAAAGGGCCTGG + Intergenic
1130859752 15:87875551-87875573 GTGGGCTGGGGTAGGGGGAAGGG - Intronic
1130895396 15:88166458-88166480 GTGAGCCGGGGACTAGGGCCTGG + Intronic
1131120670 15:89821586-89821608 GTGGGCTGGGGGAGGGAGACAGG + Intergenic
1131678531 15:94697347-94697369 CTGGGCCTGGGAAGAGTGTCTGG + Intergenic
1132128401 15:99251363-99251385 GGGAGCTGGGGAAGAGGGAGCGG - Exonic
1132419273 15:101651996-101652018 CTGGGCCGGGGAGGCGGAACTGG - Intronic
1132441819 15:101874205-101874227 GAGGCACTGGGAAGAGGGACCGG - Intergenic
1132536375 16:483145-483167 TGGGGCCGGAGTAGAGGGACGGG + Intronic
1132871684 16:2118238-2118260 GGGGGCCGGAGCAGAGGGACAGG + Exonic
1133019172 16:2959297-2959319 ATGGGCAAGGGAGGAGGGACTGG + Intergenic
1133597186 16:7304135-7304157 GAGAGCCAGGGAGGAGGGACCGG + Intronic
1133737816 16:8629265-8629287 GTGAGCCGGGCAGGAGTGACGGG - Intronic
1134037558 16:11042391-11042413 GTGGGCCAAGGGAGAGGGACAGG + Intronic
1134207900 16:12252719-12252741 GTGAGCCAGGGAAGCGGAACAGG - Intronic
1134299353 16:12975733-12975755 GTGGGGCTGGGAGGGGGGACTGG + Intronic
1134520845 16:14918657-14918679 GGGGGCCGGAGCAGAGGGACAGG - Intronic
1134550733 16:15137316-15137338 GGGGGCCGGAGCAGAGGGACAGG + Intronic
1134708515 16:16317308-16317330 GGGGGCCGGAGCAGAGGGACAGG - Intergenic
1134715730 16:16357341-16357363 GGGGGCCGGAGCAGAGGGACAGG - Intergenic
1134951087 16:18351337-18351359 GGGGGCCGGAGCAGAGGGACAGG + Intergenic
1134959027 16:18394818-18394840 GGGGGCCGGAGCAGAGGGACAGG + Intergenic
1135024196 16:18986650-18986672 GAGGGCCTGGAAAGAGGGGCTGG - Intronic
1135315859 16:21443818-21443840 GAGGGCCTGGAAAGAGGGGCTGG + Intronic
1135368785 16:21876079-21876101 GAGGGCCTGGAAAGAGGGGCTGG + Intronic
1135422359 16:22313784-22313806 TTGGTCCTGGGAAGAGGGATGGG + Intronic
1135443032 16:22495063-22495085 GAGGGCCTGGAAAGAGGGGCTGG - Intronic
1136267931 16:29131861-29131883 GAGAGCCGGGGAAGAGGAAGGGG - Intergenic
1136296812 16:29308686-29308708 GGGGGCATGGGCAGAGGGACGGG - Intergenic
1136296862 16:29308857-29308879 GGGGGCACGGGCAGAGGGACAGG - Intergenic
1136312536 16:29422568-29422590 GAGGGCCTGGAAAGAGGGGCTGG + Intergenic
1136325969 16:29524301-29524323 GAGGGCCTGGAAAGAGGGGCTGG + Intergenic
1136440658 16:30264285-30264307 GAGGGCCTGGAAAGAGGGGCTGG + Intergenic
1136566537 16:31073756-31073778 GGGGGGCGGGGAGGTGGGACCGG + Intronic
1136672746 16:31873238-31873260 GTGGAACGTGGAAGAGGGGCTGG - Intergenic
1136924193 16:34356311-34356333 GTGGGCTGGAGCAGAGGGAAGGG - Intergenic
1136980380 16:35055495-35055517 GTGGGCTGGAGCAGAGGGAAGGG + Intergenic
1137397248 16:48124896-48124918 GTAGTCAGGGGAAGATGGACAGG + Intronic
1137448614 16:48549766-48549788 GAGGGCCTGGGCAGAGGGATGGG - Intronic
1137523196 16:49211215-49211237 GTGGGGAGAGGGAGAGGGACGGG + Intergenic
1137724208 16:50646114-50646136 GGGGGCGGGGGAAGGGGGCCAGG + Intergenic
1138374149 16:56551202-56551224 GTGTGCCGGGGCAGGGGGGCAGG - Intergenic
1138889852 16:61128851-61128873 GAGGGGCGGGGAAGGGGGAAGGG + Intergenic
1139784945 16:69385541-69385563 GAGCGCCGGGGAAGGGGGTCCGG - Intronic
1139887171 16:70216618-70216640 GAGGGCCTGGAAAGAGGGGCTGG + Intergenic
1140424133 16:74846306-74846328 AAGGGCTGGGGAAAAGGGACTGG - Intergenic
1140431364 16:74906837-74906859 GAAGGGCGGGGAAAAGGGACTGG + Intronic
1140634556 16:76896163-76896185 GTGGGTCGGGGGAGAGGGGAGGG + Intergenic
1140666935 16:77236321-77236343 GTGGGTCGGGGAGCAGAGACAGG - Intergenic
1141703454 16:85652700-85652722 ATGGGCCCAGGAAGAGGGGCTGG + Intronic
1141841540 16:86577102-86577124 GTGGGCCAGGAAGGAGGGAGAGG - Intronic
1141858282 16:86699741-86699763 GTGGACAGGTGAAGAGGGCCAGG + Intergenic
1141924850 16:87161292-87161314 AGGGGCCGGGGGAGAGGGAAAGG + Intronic
1142002229 16:87670509-87670531 CTGGGCCTGGGGAGAGGGACAGG - Intronic
1142239766 16:88939940-88939962 GTCGGCCGGGGATAAGGGGCGGG - Exonic
1142320229 16:89377468-89377490 GTGGGCCGGGGCAGGAGGGCTGG + Intronic
1142497005 17:311228-311250 GTGGACCGAGGAGGAGGGACGGG - Intronic
1142599800 17:1048071-1048093 CTGGGCTGGGCTAGAGGGACAGG - Intronic
1142762581 17:2050689-2050711 GAGGGCCGGGGAAGCGGGGGTGG + Intergenic
1142844982 17:2667387-2667409 GAGGGCCTATGAAGAGGGACAGG + Intronic
1142851001 17:2704749-2704771 GTGGGCCAGGGAACAGTGGCTGG - Intronic
1142968529 17:3595909-3595931 CTGGGCCGGGGAACAGGGTCAGG + Intronic
1143323373 17:6082285-6082307 GGGGGCGCGGGAAGTGGGACAGG + Intronic
1143627826 17:8121365-8121387 TTGGGGCAGGGAAAAGGGACAGG + Exonic
1144022826 17:11252141-11252163 GTGGGTCTGGAGAGAGGGACAGG - Intronic
1144752568 17:17659608-17659630 GTGGGGTGGGGAAGAGAGAGAGG - Intergenic
1144860246 17:18297435-18297457 GTGGGGAGAGGGAGAGGGACAGG - Intronic
1145750845 17:27353997-27354019 CCGGGCCGGCGAAGAGGGAGGGG + Intergenic
1145786078 17:27594734-27594756 GTGGGCAGGGGTGGAGGGGCAGG - Intronic
1145883083 17:28365631-28365653 CTGGGCTGGTGAAGTGGGACAGG + Intronic
1146000210 17:29126304-29126326 GAGGGACGGGGAGGAGGGACGGG + Intronic
1146000217 17:29126317-29126339 GAGGGACGGGGAGGAGGGAGGGG + Intronic
1146097982 17:29951025-29951047 TTGGGTGGGGGAAGAGGGAAAGG - Intronic
1146722133 17:35130879-35130901 GTGGGGCGGGGTAGGGGAACAGG + Intronic
1146905487 17:36615204-36615226 GTGGGCCGGGGAGGAGGGGCTGG + Intergenic
1148050822 17:44769254-44769276 TGGGGCCGGGGTAGGGGGACAGG + Intronic
1148143239 17:45342922-45342944 GTGGGTAGGGAAAGAGAGACAGG + Intergenic
1148593042 17:48830978-48831000 GTGGGCGGGGCAGGCGGGACGGG + Intronic
1148751678 17:49948912-49948934 GTGGGAGGGGGCAGAGGGAAGGG + Intergenic
1148908673 17:50927991-50928013 GTGGGCCAGGGTTGTGGGACAGG - Intergenic
1149512685 17:57256426-57256448 GTGCGCCGGGGAGGAGGGGGAGG + Intronic
1149599268 17:57882671-57882693 GTAGGCTGAGGAGGAGGGACAGG - Intronic
1149626550 17:58084007-58084029 AGGGGCCGGGGAAGAGGGGGTGG + Intronic
1149762763 17:59247387-59247409 GTTGGCAGGGGATGAGGGAAGGG - Intronic
1150284390 17:63946998-63947020 GTGGGCTGGGGATGGGGGACCGG - Intronic
1150425607 17:65074768-65074790 GGGGGCTGGGGGAGAGGGGCGGG - Intergenic
1151681807 17:75626341-75626363 GTGGGCCGGGGCAGAGGCGAGGG + Intergenic
1151814788 17:76466409-76466431 GTGGGCGGGGGCATCGGGACGGG + Intronic
1151919176 17:77140964-77140986 GGGGGCCGGGGAGGCGGGAGGGG - Intronic
1152227460 17:79099017-79099039 GTGGGCCGGGGATGCGGGGTGGG - Intronic
1152244751 17:79179512-79179534 GCTGGCCGGGGGAGAGGGACTGG - Intronic
1152356459 17:79809980-79810002 GGGGGCAGGGGGAGAGGGAAAGG + Intergenic
1152538370 17:80963090-80963112 GGGGGCTGGGGTAGAGGGATGGG + Intronic
1152594419 17:81231512-81231534 GTGGGCGAGGGAGGAGGGAACGG - Intronic
1152654220 17:81512592-81512614 GTGGGCCGGGTCAGGCGGACGGG - Exonic
1152870488 17:82751099-82751121 GGGGGACGGGGACGGGGGACGGG - Exonic
1152870503 17:82751127-82751149 GGGGTCGGGGGAAGGGGGACAGG - Exonic
1153831688 18:8929527-8929549 GTGGGCAGGGGACTAGGGAATGG + Intergenic
1155066988 18:22276457-22276479 GTGGGGCGGGGAGGCGGGGCTGG + Intergenic
1157301641 18:46483833-46483855 GTGGGCCAGGGAACAGGGATGGG + Intronic
1157333765 18:46722274-46722296 CTGGGCTTGGGAAGAGGGCCTGG - Intronic
1157501677 18:48194884-48194906 GGGGGAGGGGGCAGAGGGACTGG + Intronic
1157545072 18:48540889-48540911 GTGGGCCGGGGAAGACCGTAGGG + Intronic
1157721920 18:49931874-49931896 GTGGGCAGGGGCAGAGTGCCTGG - Intronic
1158648011 18:59264717-59264739 GTGGGATGGGGTGGAGGGACTGG - Intergenic
1159662689 18:71118417-71118439 GTGGGGTGGGGAGGAGGGAGCGG - Intergenic
1160125685 18:76169437-76169459 GCGTGTCAGGGAAGAGGGACTGG + Intergenic
1160450888 18:78965371-78965393 GTGGGCGGGAGCAGAGGGACGGG - Intergenic
1160573219 18:79832456-79832478 ATGGGCAGGTGAAGACGGACAGG - Intergenic
1160643114 19:158943-158965 GAGGCACTGGGAAGAGGGACCGG + Intergenic
1160776688 19:859755-859777 CTGGGCCTGGGGTGAGGGACAGG + Intronic
1160826475 19:1082649-1082671 GTGGCCCGGGTAGGAGGGGCAGG + Intronic
1160949394 19:1658308-1658330 GTGGGCCGGGGATGGGAGCCTGG - Intergenic
1161021384 19:2013278-2013300 AGGGGCAGGGTAAGAGGGACCGG + Intronic
1161323422 19:3651779-3651801 GTGGGGAAGGGAAGCGGGACGGG + Intronic
1161349887 19:3785768-3785790 GTGTGCCGGGGGCGGGGGACAGG - Intronic
1161399394 19:4060690-4060712 GGCGACCGGGGAAGGGGGACCGG + Intronic
1161403784 19:4080891-4080913 GTGGGGAGGGGAAGGGGGAGGGG + Intergenic
1161434032 19:4251194-4251216 GTGTGCTGGGGGAGAGGGACCGG - Intronic
1161979884 19:7624856-7624878 GCGGGCTGGGGAAGAGGGTCAGG - Intronic
1162158564 19:8696160-8696182 GGGGGCTGAGGAAGAGGGTCAGG + Intergenic
1162331499 19:10032629-10032651 CTGGGCAGGGGCAGGGGGACCGG + Intergenic
1162584583 19:11551289-11551311 GTGGGGAGGGGAAAGGGGACAGG + Intronic
1162803146 19:13122053-13122075 GTGGGGCCGGGAGGTGGGACTGG + Intronic
1163579808 19:18131748-18131770 GAGGGTCGGGGGAGAGGGAAGGG - Intronic
1163665879 19:18603988-18604010 GTGGGCCGGGGCAGAGACGCTGG - Intronic
1163666802 19:18607184-18607206 TTGGGCCGTGGAAGGGGGAATGG - Intronic
1163702953 19:18795662-18795684 CCAGGCTGGGGAAGAGGGACGGG + Intergenic
1163784528 19:19267926-19267948 GTGGGTCAGGGAAGGGAGACTGG + Intronic
1163909586 19:20176812-20176834 GTGGGGAGAGGGAGAGGGACAGG + Intronic
1165427579 19:35754532-35754554 CTGGGCCAGGAAGGAGGGACCGG - Intergenic
1165993132 19:39827142-39827164 GTGGGCAGGGGAGGAAGGAAAGG + Intronic
1166039053 19:40191444-40191466 GTGGCCCGGGGAAGCAGCACGGG + Intergenic
1166986202 19:46661115-46661137 CTGGGGCGGGGAGGTGGGACCGG - Exonic
1167016213 19:46842712-46842734 GTGGGAAGGGGGAGAGGAACTGG - Intronic
1167129246 19:47573395-47573417 GTGAGCCGGGGAGGAGCGGCGGG + Intergenic
1167381783 19:49142560-49142582 GCGGGTGGGGGAAGAGGGAGAGG - Intronic
1167556483 19:50199387-50199409 GTGTGCCGGGGAAAAGGAAAGGG - Intronic
1167560508 19:50224035-50224057 GGGGGTGGGGGAAGGGGGACTGG - Intronic
1167569303 19:50276902-50276924 GTGGGTTGGGGCAGGGGGACAGG + Intronic
1167570633 19:50286532-50286554 GCGGGCCGAGGCAGAGGGCCGGG + Exonic
1167602911 19:50464974-50464996 GTGGGACCGAGATGAGGGACGGG - Intronic
1168000500 19:53441979-53442001 GTGGGCCTGGGAACAGGCAGAGG + Intronic
1168349611 19:55668611-55668633 GTGGGGCGGGGTGGGGGGACGGG - Intronic
1168464988 19:56595000-56595022 GAGGGGCGAGGAGGAGGGACAGG - Intergenic
1168468969 19:56625632-56625654 GTGAGCAGGGGGAGCGGGACGGG - Exonic
1168516262 19:57012716-57012738 TTGGGCCAGGCAAGAGGGAGTGG + Intergenic
924988444 2:290357-290379 GTGGGCCCGGCAAGCAGGACCGG - Intergenic
925186607 2:1850931-1850953 GTGGGCAGGGCAAGAGGTCCAGG - Intronic
925257441 2:2502303-2502325 GGGGAGCGAGGAAGAGGGACAGG - Intergenic
925262468 2:2540508-2540530 GAGGGCCTGGGAAGATAGACAGG + Intergenic
925587196 2:5475558-5475580 AGGGGCCTGGGAAGAGGGAGAGG + Intergenic
925776399 2:7340115-7340137 GTGGGCTGGGGAGGAGGCACTGG + Intergenic
925907911 2:8550486-8550508 GTGGGCCGGGGACCTGGGAGTGG + Intergenic
926162890 2:10501051-10501073 TCGGGCAGGGGAGGAGGGACCGG - Intergenic
927062820 2:19440537-19440559 GTGGGCAGGGGATGAGAGGCGGG - Intergenic
927846673 2:26475889-26475911 GAGGGCCTGGGAGGAGGGAGTGG - Intronic
928125065 2:28609853-28609875 GTGGGAAAAGGAAGAGGGACAGG - Intronic
928202030 2:29253612-29253634 GTGGGTTGGGGAGGAGGGATGGG + Intronic
928262817 2:29782860-29782882 GAGGACTGGGGAAGAGGAACTGG - Intronic
929089715 2:38202984-38203006 GTGGAGCGGGGAAGGGGCACTGG - Intergenic
929152091 2:38756717-38756739 GTGGGGAGAGGAAGAGGGAGAGG + Intronic
929799664 2:45088816-45088838 GTGGGCTGGGGAGGAGGACCGGG + Intergenic
930988920 2:57626936-57626958 GTGGGCAGGGGTAGAGGCAATGG - Intergenic
931432551 2:62219825-62219847 GTGGGCAGGGGACCAGGGAGTGG + Intronic
931634943 2:64332575-64332597 GTGGGGCTGGGAAGAGGGGGAGG + Intergenic
932120116 2:69091000-69091022 GTGGGGTGGGAAAGAGGAACAGG + Intronic
933666793 2:84971075-84971097 GGGAGCCGGGGGAGAGGGGCGGG + Exonic
935232407 2:101110394-101110416 GTGGGGCGGGGAAGAGGGATGGG - Intronic
935396870 2:102619199-102619221 GGGGGCGGGGGAGGAGGGAAGGG + Intergenic
935541837 2:104357729-104357751 GAGGGCCTGGAAAGAGGGATAGG - Intergenic
937080443 2:119136460-119136482 GAGGGCCTGGGATGTGGGACAGG - Intergenic
937678003 2:124613257-124613279 GTGGTCCAGGGAAGAGAGTCAGG + Intronic
939091709 2:137787410-137787432 GTGGGCAGGGGACTAGGGAATGG - Intergenic
939360904 2:141171339-141171361 CTGGGGTGGGGAAGAGGGAAGGG - Intronic
939403267 2:141722619-141722641 GTGGGCAATGGGAGAGGGACAGG - Intronic
940640738 2:156342352-156342374 GGGGGCCGGGGGAGGGGGGCGGG - Intergenic
942024511 2:171899222-171899244 GTGGGGAGAGGAAGAGGGAGAGG - Intronic
942548353 2:177088714-177088736 GCGGGCCGGGGAGGGGGGAGGGG + Intergenic
943727792 2:191269676-191269698 GTGGGCTGGGGAAAAGGAAAGGG + Intronic
944526798 2:200627658-200627680 GGGGGTCAGGGAAGAGGGGCAGG - Intronic
946875860 2:224129272-224129294 GAGGGCAGGGGAAGTGGGAGGGG - Intergenic
947712570 2:232324497-232324519 GGGAGCCGGGGCAGAGGGGCAGG - Intronic
947919101 2:233854259-233854281 GGGGGTTGGGGAAGCGGGACTGG - Intronic
948651830 2:239450390-239450412 GTGGGGAGAGGGAGAGGGACAGG + Intergenic
948765514 2:240216950-240216972 GTGGGGTGGGGTGGAGGGACAGG + Intergenic
948765562 2:240217053-240217075 GTGGGGTGGGGTGGAGGGACGGG + Intergenic
1169961979 20:11170531-11170553 ATGGGCATGGGAAGAAGGACGGG - Intergenic
1170339813 20:15311784-15311806 GTGGGGAGGGAAAGGGGGACAGG + Intronic
1170649738 20:18228490-18228512 GGGGGGTGGGGAAGAGGGAAGGG - Intergenic
1170811807 20:19679532-19679554 GTGGGGAGGGGGAGAGGGAGAGG + Intronic
1172122541 20:32607458-32607480 CTGGGCCTGAGCAGAGGGACGGG - Intronic
1172199301 20:33114027-33114049 GTGGGCTGGGGAATGGGGATGGG - Intergenic
1173201950 20:40960958-40960980 GGGGGCCAGGGAAGGGGGAGGGG + Intergenic
1173640176 20:44596317-44596339 GTGGGTCAGGGAAGAGGAAGAGG + Intronic
1173845049 20:46182887-46182909 GTGGGAAGGGGCTGAGGGACTGG + Intronic
1174373203 20:50108048-50108070 GTGGGCCATGGAAAAGGGATGGG + Intronic
1174417549 20:50377322-50377344 GTGGCCTGTGGAAGAGGGGCAGG + Intergenic
1174579864 20:51563736-51563758 GTGGGGAGGGGGAGAGGGAGAGG + Intergenic
1175070740 20:56331782-56331804 GTGGGCAGGGGACTAGGGAATGG - Intergenic
1175692799 20:61077662-61077684 GTGGCCCGGGGAAGAAGGGAGGG - Intergenic
1175940125 20:62533917-62533939 GTGGGTGGGGGCAGGGGGACCGG + Intergenic
1178405753 21:32321821-32321843 GCGGGCTGTGGAAGAAGGACAGG + Exonic
1179250008 21:39664548-39664570 GCGGGACGGGGAAGGGGGTCAGG - Exonic
1179492908 21:41752823-41752845 GTGCGTAGGGGAAGAGGGAAGGG + Intronic
1179707255 21:43188820-43188842 GGGGGCGGGGGAAGAGGAAGAGG - Intergenic
1179722042 21:43321594-43321616 GAGGGTCGGGAAGGAGGGACAGG - Intergenic
1179725716 21:43340305-43340327 AGGGGCTGGGGAGGAGGGACAGG + Intergenic
1181036964 22:20174375-20174397 GGGGGCCGGGGAAGAGCGGCAGG + Intergenic
1181264241 22:21621160-21621182 GGGGGTTGGGGAGGAGGGACAGG - Intronic
1181728787 22:24830000-24830022 GTGGACAGGGGAAGAGGGCCAGG - Intronic
1182094087 22:27614548-27614570 ATGGTCCCGAGAAGAGGGACGGG + Intergenic
1182590758 22:31377904-31377926 GAGGGGAGGGGAAGAGGGAGGGG - Intergenic
1183393947 22:37561003-37561025 GGGGGCCCGGGGAGATGGACAGG + Intronic
1183703896 22:39465186-39465208 GGGGGCAGGGGAAGAGGGAGGGG + Intronic
1183733717 22:39632014-39632036 GCGGGTCGGGGAGGAGGGACGGG + Intronic
1183902644 22:41018145-41018167 GTTGGCCTGAGATGAGGGACGGG + Intergenic
1183952425 22:41359059-41359081 GTGGGGCAGGGAAGAGGAAAGGG - Exonic
1183952566 22:41359745-41359767 GTGTGATGGGGAGGAGGGACAGG + Exonic
1184249305 22:43251129-43251151 GAGAGCCGGGGCAGAGGGAATGG + Intronic
1184259269 22:43305445-43305467 GGGGGCTGGGGAAGAGGCTCAGG + Intronic
1184663844 22:45977372-45977394 CTGGGCGGGGGAAGAGGGCTTGG + Intergenic
1184933700 22:47702200-47702222 GAGGGGAGGGGAAGAGGGAGTGG - Intergenic
1185167019 22:49267455-49267477 GAAGTCCGGGGAACAGGGACAGG - Intergenic
1185395228 22:50583249-50583271 AGGGGTCGGGGAAGAGGGCCCGG - Intronic
949494540 3:4619573-4619595 GAGGGCAGGGGAAGGGGGAAGGG - Intronic
949507278 3:4739627-4739649 GTGGGACGGACAAGAGGTACAGG - Intronic
950029387 3:9842174-9842196 ATGGGCCGGGGATGTGGGAAGGG - Intronic
950657970 3:14449088-14449110 ATGGGCCAGAGAAGAGGGAGCGG + Intronic
953020930 3:39112581-39112603 GTGGGCAGTGGAAAAGGGAGAGG + Intronic
953177960 3:40568832-40568854 GTGGGCAGGGGACTAGGGAATGG + Intronic
953190893 3:40686949-40686971 GTGTGCCGGGGGAGGGAGACTGG + Intergenic
954330783 3:49889159-49889181 GGGGGCAAGGGAAGAAGGACTGG - Intronic
956084765 3:65597603-65597625 GTGGACCAGGGAGGAGGGGCGGG - Intronic
956093235 3:65689971-65689993 CTGAGCCGGGGAAGGGGCACGGG - Intronic
958533302 3:95363872-95363894 GTGGGACAGGGAAAATGGACTGG + Intergenic
958688309 3:97427548-97427570 GTGGGAGGAGGAAGAGGGCCAGG + Intronic
959050371 3:101519040-101519062 GGGGAGCGGGGAAGAGGGAATGG + Intergenic
959398234 3:105868550-105868572 GCAGGCCGGGGAGGAGGGAGAGG - Intronic
959615207 3:108339817-108339839 GTTGGCCAGGGAAGAGTGGCTGG + Intronic
960024026 3:112988196-112988218 GTGGGGCAGGGAAGTGGGGCAGG - Intergenic
961033111 3:123623654-123623676 GTGGGCGGGGGCAGAGGGAGAGG - Intronic
961042383 3:123686484-123686506 GTGGGGCAGGGCAGAGGGGCTGG + Intronic
961361232 3:126369005-126369027 GTGGGAGGGGGAATGGGGACTGG - Intergenic
961392094 3:126558268-126558290 GTGAGTCGGGGAAGAGGTTCAGG + Intronic
961716400 3:128860383-128860405 GGGGGCCGGGCAGGAGGGAGGGG + Intergenic
961782091 3:129326374-129326396 GTAGGCCAGGGAGGTGGGACAGG - Intergenic
962715794 3:138124908-138124930 GTAGCCAGGGGAAGAGGGAGGGG + Intronic
963783369 3:149509341-149509363 GTGGGCAGGGGAGAAGGGACAGG - Intergenic
965747379 3:171939377-171939399 GTGAGCCTGGCAAGAGGCACAGG + Intergenic
965882305 3:173400539-173400561 GTGGGGTGGGGTAGAGGGGCAGG - Intronic
966234888 3:177689648-177689670 GTGGGGCGGGGAGGGGGGAGTGG + Intergenic
966907505 3:184538583-184538605 CTGGGCCTGGGAAGAGGCTCTGG - Intronic
967762340 3:193240599-193240621 GGGGGCCGGGGGAGGGGGGCGGG + Intergenic
967844731 3:194034694-194034716 GAGGGCCCGGGCAGTGGGACTGG + Intergenic
967888994 3:194351621-194351643 GTGAGCAGAGGCAGAGGGACTGG + Intergenic
968440771 4:623495-623517 GTGGGACGGGGAAGGGGTGCTGG - Intergenic
968445796 4:651408-651430 GAGGGCCTGGGATGAGGGCCTGG + Intronic
968582677 4:1402302-1402324 GTGGGGCAGGGGAGTGGGACCGG + Intergenic
968584128 4:1408087-1408109 AAGGGGAGGGGAAGAGGGACGGG - Intergenic
968614688 4:1572104-1572126 GTGGGGCTGGGATGGGGGACGGG - Intergenic
968620618 4:1601950-1601972 GTGGGCCGGGGGAGATGGGATGG + Intergenic
968620655 4:1602034-1602056 GTGGGCCGGGGGAGATGGGACGG + Intergenic
968913309 4:3486463-3486485 GTGTGGCGGGGAAGGGTGACTGG + Intronic
969339173 4:6529631-6529653 CTGTGCCAGGGAAGAGGGATGGG - Intronic
969569825 4:8001790-8001812 GTGGGCCAGGGAAGTGGGGAAGG - Intronic
969673694 4:8603372-8603394 GGGGGCTGGGGAAGAGGGAGGGG - Intronic
971924924 4:32996500-32996522 GTGGGCCGGGGTATGGGGGCAGG - Intergenic
972285758 4:37646427-37646449 GTGGACGGGGGAGGAGGGAATGG + Intronic
973931154 4:55793927-55793949 TGGGGATGGGGAAGAGGGACGGG + Intergenic
974590542 4:63942914-63942936 GGGGGCCGGGGAGCAGGGGCCGG + Intergenic
974932824 4:68378792-68378814 GTGGGCTGGGGCAGAGGCATGGG + Intergenic
975286774 4:72630617-72630639 GGGGGCGGGGGAAGAGTGAAAGG - Intergenic
975349112 4:73326620-73326642 GTGATCTGGGGAAGAGGGGCCGG - Intergenic
975400330 4:73929975-73929997 GTGGGAGGGGGAAGAGGATCAGG + Intergenic
975661059 4:76689490-76689512 GTGGGCCGGGGCAGCGCGGCTGG - Intronic
975984427 4:80189446-80189468 GCGGGCTGGGAAAGAGGGAAGGG + Intronic
976840739 4:89429983-89430005 GTGGGCTAGTGAAGAGGGAATGG - Intergenic
977424754 4:96853543-96853565 GTGGGAATGGGAAGAGGGAAAGG + Intergenic
978743419 4:112164448-112164470 GTGGGGTGGGGAAGAGGGGAGGG + Intronic
979703926 4:123698154-123698176 GAGGGCAGGGGAAGAGGGCATGG - Intergenic
981128457 4:141132855-141132877 CGGGGCTGGGGAGGAGGGACGGG - Intronic
982547440 4:156752151-156752173 GTGGGGCGGGGAAGAGGAAGAGG - Intergenic
983762742 4:171432414-171432436 TTTGGCCAGGGAAGTGGGACGGG - Intergenic
984222451 4:176994694-176994716 GGGGGAAGGGGAAGAGGGAGGGG - Intergenic
985671633 5:1209793-1209815 GTGAGATGGGGAAGAGAGACAGG - Intronic
985677320 5:1238744-1238766 GGGGTCAGGGGAGGAGGGACAGG + Intronic
985844597 5:2334907-2334929 GTGGGCCTGGGCAGCGGGCCCGG - Intergenic
986330025 5:6711169-6711191 GAGGGCAGGGGAAGAGGGGAAGG + Intergenic
986726222 5:10599470-10599492 GTAGGAGGAGGAAGAGGGACTGG - Intronic
986773497 5:10994334-10994356 GGGGGCCGGGGAAGGAGGAGGGG + Intronic
989103266 5:37839472-37839494 GCGGGCCGGGGAGCAGGGAGCGG - Intronic
989618364 5:43359948-43359970 GTGGGCAGGGGACTAGGGAATGG - Intergenic
991054479 5:62306428-62306450 GCGGGCCGAGGGAGGGGGACCGG - Intronic
991449161 5:66733301-66733323 GTGGTGGGGGGAAGAGGGAGGGG - Intronic
991746488 5:69747648-69747670 CTGGGCCTGAGAAGAGGGACTGG - Intergenic
991751217 5:69807593-69807615 CTGGGCCTGAGAAGAGGGACTGG + Intergenic
991798088 5:70327593-70327615 CTGGGCCTGAGAAGAGGGACTGG - Intergenic
991825866 5:70622962-70622984 CTGGGCCTGAGAAGAGGGACTGG - Intergenic
991830506 5:70682487-70682509 CTGGGCCTGAGAAGAGGGACTGG + Intergenic
991890429 5:71326915-71326937 CTGGGCCTGAGAAGAGGGACTGG - Intergenic
992126641 5:73649289-73649311 GTGGGGAGTGGAAGGGGGACAGG + Intronic
992406092 5:76459241-76459263 GTGGGCAGAGGCCGAGGGACGGG + Intronic
992478849 5:77130139-77130161 GTGGGGCGGGGGTGAGGGAGGGG + Intergenic
992564345 5:77983304-77983326 GTGGGAGGAGGAAGAGGGTCAGG + Intergenic
992605062 5:78447844-78447866 GGGGGCAGGGGAGGAGGGAGGGG - Intronic
992944391 5:81795330-81795352 AGGGACTGGGGAAGAGGGACAGG + Intergenic
993386301 5:87267578-87267600 ATGGGCGGGAGAAGAGGGAAGGG - Intergenic
993538641 5:89120265-89120287 GTAGGCCTAGGAAGAGGGAAGGG + Intergenic
994820944 5:104650560-104650582 GGGGGCTGGGGAAGAGGGGCAGG - Intergenic
995214578 5:109581073-109581095 CTGAGCTGGGAAAGAGGGACTGG - Intergenic
995224636 5:109689533-109689555 GTGGGGCGGGAAAGAGGGAGGGG + Exonic
995528072 5:113066697-113066719 GAGGAGCGGGGAAGAAGGACAGG + Intronic
997600746 5:135136795-135136817 GTGGGCGGGGGAGGGGGGAGGGG - Intronic
998062817 5:139132552-139132574 GTGGGCAGTGGGAGAGGGATGGG + Intronic
999114285 5:149148862-149148884 GTGGGGCTGGGCAGAGGGGCTGG - Intronic
999265594 5:150264899-150264921 GTGGGCAGGGGAGCAGGGCCTGG + Intronic
999286083 5:150395105-150395127 GTGGGCTGGGGGAGGTGGACTGG - Intronic
1000222495 5:159227445-159227467 GTGGAGAGGGGAAGAGGGTCTGG - Intergenic
1000253586 5:159517585-159517607 GTGGTCCAGTGGAGAGGGACAGG + Intergenic
1000740072 5:164957659-164957681 GTGGGATGGGGAAAAGGGATAGG + Intergenic
1000930221 5:167242548-167242570 GTAGGCTGGAGAAGAGGAACAGG - Intergenic
1002183039 5:177441353-177441375 GTGGGCAGGGGGAGTGGGGCGGG - Intronic
1002733761 5:181365530-181365552 GAGGCACTGGGAAGAGGGACCGG - Intergenic
1002750782 6:108590-108612 GAGGCACTGGGAAGAGGGACCGG + Intergenic
1003098674 6:3160624-3160646 GTGGGCCGGGGATGGGGAAGGGG + Intergenic
1003598533 6:7496595-7496617 GTGGGCCAGGGAGGAGGGGAGGG + Intergenic
1003973558 6:11322176-11322198 GTGGGCCGGGGGCAAGGGAAGGG + Intronic
1004044301 6:12011411-12011433 GTTGGTCCGGGAAGAGGGACGGG - Intronic
1004152309 6:13133271-13133293 GTGGGGAGAGGAAGAGGGAGAGG - Intronic
1006254771 6:32821959-32821981 AGGGGCTGGGGAAGAGGGAAAGG + Intronic
1006414251 6:33893939-33893961 GTGGGGAGGGGAAGAGGAAGGGG + Intergenic
1006829558 6:36960648-36960670 GTGGGTGGGGGTAGAGGGAGGGG - Intronic
1007073046 6:39050119-39050141 CTGGGCTGGGGAACAGGGGCAGG - Intronic
1007406401 6:41638398-41638420 GTGGGCCAGGGAAGAGGGGAGGG + Intronic
1008673339 6:53795045-53795067 GCGGGCGGGGGTACAGGGACGGG + Exonic
1008861552 6:56155049-56155071 GTGGGAGGGGGGAGAGGGTCAGG - Intronic
1009353540 6:62710324-62710346 GTGGGAGGGGGACGAGGGAAGGG + Intergenic
1010030660 6:71267399-71267421 GTGGGGAGGGGGAGAGGGAGAGG + Intergenic
1010280164 6:74014080-74014102 TTGGGCTGGGGAAGAGAGAAAGG + Intergenic
1011022810 6:82833193-82833215 GTGGGCAGGGGACTAGGGAATGG + Intergenic
1011607129 6:89117024-89117046 GGGGGCGGGGGGAGAGGGAACGG - Intronic
1013327779 6:109064645-109064667 GTGGGGTGGGGGAGAGGGAAAGG + Intronic
1014001234 6:116368924-116368946 GTGGGCGGGGGCGGGGGGACGGG + Intronic
1015516885 6:134091368-134091390 GAGGCCTGGGGAAGAGGGAGTGG + Intergenic
1015965399 6:138692442-138692464 GCGGGCCGGGGGAGGGGAACCGG - Intronic
1017151970 6:151288674-151288696 GTGGGAGTGGGAAGAGTGACAGG - Intronic
1018352095 6:162970528-162970550 GTGGGTGGGGGAAGAGAGGCTGG - Intronic
1018877875 6:167841427-167841449 GTGGGCTGGGGAAGGGGAACTGG + Intronic
1019238008 6:170637850-170637872 GAGGCACTGGGAAGAGGGACCGG - Intergenic
1019279212 7:191975-191997 GTGGGCGGGGGGGGGGGGACGGG + Intergenic
1019429341 7:991470-991492 GTGGGGCGGGCAGGAGGGAAGGG + Intergenic
1020347779 7:7183213-7183235 GAGGGCCCGGGAGGAGGGACTGG - Intronic
1021313326 7:19117764-19117786 GTGGGACGGGGGAGGGGGACTGG - Intergenic
1021759667 7:23891258-23891280 GTTGGCAGGGGTAGAGGGGCTGG + Intergenic
1021828046 7:24573733-24573755 CGGGCGCGGGGAAGAGGGACCGG + Intronic
1022250775 7:28605859-28605881 TTGAGCCTGGGAAGGGGGACTGG + Intronic
1023004884 7:35853428-35853450 CTGGGCGGGGGAAGTGGGTCAGG + Intronic
1023160404 7:37291931-37291953 GTGGGCAGAGGGAGAGGGAGGGG - Intronic
1023873769 7:44276164-44276186 CTGAGCCGGGGAGGAGGGAAAGG + Intronic
1023878706 7:44306790-44306812 GTGGGCAGGGGAGGAGGGTAAGG + Intronic
1023879055 7:44308352-44308374 GTGGCTGGGGGAAGAGAGACAGG + Intronic
1023972123 7:44999677-44999699 GGGGGCGGGGGACGGGGGACGGG - Intronic
1024116035 7:46194591-46194613 GGGGGCAGGGGAAGAGAGAGGGG + Intergenic
1024695790 7:51855512-51855534 GTGGGCAGGGGACTAGGGAATGG + Intergenic
1024972041 7:55079315-55079337 GTGCAGCGGGGAAGAGGGGCGGG + Intronic
1025108983 7:56196882-56196904 GGGGGAGGGGGAAGAGGGAGAGG - Intergenic
1025262190 7:57426700-57426722 GTGGGCCTGGGCACAGGGGCAGG - Intergenic
1026114456 7:67484555-67484577 GTTGGGTGGGGAAGAAGGACTGG + Intergenic
1026892311 7:73989400-73989422 GGGGGACAGGGAAGGGGGACAGG + Intergenic
1027199954 7:76057702-76057724 GTGGGACTGAGAAGAGGGAAGGG - Intronic
1027722478 7:81761806-81761828 GTGGGCCGGGGAGCGGGGAATGG + Intronic
1028478647 7:91279845-91279867 GTTGGCCAGGGAAGAGGTTCGGG + Intergenic
1028983565 7:96992896-96992918 GTGGGCCGAGGCTGAGGGAGCGG + Intergenic
1029139526 7:98400516-98400538 GCGGGGCGGGAAAGAGAGACAGG + Intronic
1029203697 7:98855715-98855737 TGGGGCCGGGGAACAGGGAATGG + Intronic
1029291426 7:99504941-99504963 GTGGGGCGGGGAAGGGGGCGGGG - Exonic
1029444388 7:100604412-100604434 GGGGGCCCTGGAAGAGGGATGGG - Intronic
1029457561 7:100678885-100678907 GTGGCCCGGGGAAGGGGGCTGGG - Exonic
1029475974 7:100784839-100784861 GTGGGCATGGGAAATGGGACTGG + Intronic
1029685058 7:102141500-102141522 GTGGGCCCAGGAAGTGGGATTGG + Intronic
1031974510 7:128085222-128085244 GACAGCCGGGGAAGAGGGTCGGG - Intronic
1034304314 7:150037798-150037820 GCCAGCGGGGGAAGAGGGACTGG + Intergenic
1034304622 7:150039000-150039022 GGGGGGCGGGGAAGAGGGTCTGG + Intergenic
1034349652 7:150407650-150407672 GGGGGACGGGGAGGAGGGTCTGG + Intronic
1034442645 7:151094436-151094458 GGGTGCCGGGGAAGTGGGGCAGG - Intronic
1034682488 7:152939752-152939774 ATGGACCGGGGAGGAGGGAGAGG + Intergenic
1035021787 7:155804778-155804800 GGGGGCCGGGGAGGAGGGCGGGG + Intronic
1035242197 7:157539614-157539636 GTGATCCCGGGAAGAGGGGCAGG + Exonic
1035251408 7:157599900-157599922 GTGGGCAGGTGGAGAGGGGCAGG - Intronic
1035251464 7:157600090-157600112 GTGGGCAGGTGGAGAGGGGCAGG - Intronic
1035262524 7:157671103-157671125 GTGGGCAGGGGACGGGGGGCGGG - Intronic
1035509760 8:168759-168781 GAGGCACTGGGAAGAGGGACCGG + Intergenic
1037037624 8:14187127-14187149 GTGGGTCAGGGAAGAGGCAAAGG + Intronic
1038676145 8:29624460-29624482 GTGGGGCTGGGAAGAGGACCAGG + Intergenic
1038963545 8:32548185-32548207 GTGTGGTGGGGAAGAGGGAGGGG + Intronic
1039251882 8:35674984-35675006 GTGGGACAGGGTAGAGAGACAGG - Intronic
1039300648 8:36205195-36205217 GTGGGCAGGGGACTAGGGATTGG + Intergenic
1039778568 8:40761050-40761072 GTGGGCTGGGGCAGTGGGGCAGG + Intronic
1039836472 8:41260268-41260290 GTGGCCCGGGGATGAGAGGCAGG - Intergenic
1039921669 8:41897506-41897528 GAGCGCCGGGGATGGGGGACGGG - Intergenic
1040536443 8:48315230-48315252 TTGGGGCAGGGAGGAGGGACTGG + Intergenic
1040829853 8:51664476-51664498 GTGTGCCTGGGAAGACAGACTGG + Intronic
1041029738 8:53724585-53724607 GTGGGGCGGGGAGGAGGGGGAGG - Intronic
1042093090 8:65180591-65180613 GTGGGAAGGGGAAGAGGAGCAGG - Intergenic
1044233160 8:89801982-89802004 GTGGGCAGGGGGATAGGGAATGG - Intergenic
1044474933 8:92614761-92614783 TTGGGCAGGGGAAGAGGGCTTGG + Intergenic
1044611027 8:94092125-94092147 TTGGGGTGGGGAAGAGGGGCAGG + Intergenic
1044822171 8:96161734-96161756 GCAGGCTGGGGAAGAGGGATTGG - Intergenic
1044919121 8:97149252-97149274 GTGGGCAGGGGACTAGGGAATGG - Intronic
1047048598 8:121083215-121083237 GTGGGCAGGGGACTAGGGAATGG - Intergenic
1047254788 8:123207006-123207028 GTGGGAGGGGGAAGAGGAAGAGG - Intronic
1048483038 8:134819241-134819263 GTGGGAAGGGGAAGAGGAAGGGG + Intergenic
1048922294 8:139242175-139242197 GTGGGAAGGGGAAGAGGCAGAGG + Intergenic
1048927215 8:139281868-139281890 GTGGGGCAGGAAAGAGGGAGGGG - Intergenic
1048969412 8:139636392-139636414 GGGGGCCGGGGTATGGGGACTGG - Intronic
1049080297 8:140437809-140437831 GTGGTCCTGGGAGGATGGACTGG - Intronic
1049408641 8:142462728-142462750 GTGGCCTGGGGGAGGGGGACTGG + Intronic
1049410295 8:142470949-142470971 GTGTGCAGGGGCAGAGGGAGCGG + Intronic
1049487449 8:142873982-142874004 CTGGCCAGGGGAAGAGGAACAGG + Exonic
1049556562 8:143285278-143285300 GTGGGTGGAGGAGGAGGGACAGG + Intergenic
1049583563 8:143423152-143423174 CAGGGCCCGGGAAGTGGGACCGG - Intronic
1049677134 8:143895152-143895174 ATGGGCCGTGGGAGATGGACGGG + Intergenic
1049683730 8:143930965-143930987 GAGTGACAGGGAAGAGGGACTGG - Intronic
1049748688 8:144273655-144273677 GTGGGCCGGGGTGGAGGGGCGGG - Intronic
1049761661 8:144334459-144334481 GTGGGTGGGGGAGGAGGGAGAGG - Intronic
1051269811 9:15344570-15344592 GTGGGCAGGGGACTAGGGAATGG - Intergenic
1051994201 9:23194560-23194582 GTGGGTGGGGGAAGAGGGGGTGG + Intergenic
1052039489 9:23721685-23721707 GTAGGCAGAGGAAGAGGGAGGGG - Intronic
1052049033 9:23824637-23824659 GTGGGCCGGGGAGGGCGGAAGGG - Intronic
1052917075 9:33931546-33931568 GAGGGCAGGGGCAGAGGGACAGG + Intronic
1053430442 9:38038729-38038751 GTTGGCCTGGGAAGCGGGGCTGG - Intronic
1055266372 9:74499099-74499121 GTGTGGCCAGGAAGAGGGACTGG - Intronic
1055506503 9:76954847-76954869 GTGGGGAGAGGGAGAGGGACAGG - Intergenic
1056068087 9:82957808-82957830 GTGGGCAGGGGAAAAGGAAGGGG + Intergenic
1056233249 9:84568378-84568400 ATGGTCATGGGAAGAGGGACTGG - Intergenic
1056817427 9:89811816-89811838 GTGGGGTGGGGAGGAGGGCCGGG + Intergenic
1056856258 9:90132143-90132165 GTGGGCCGGGGAAGAGGCACTGG - Intergenic
1056970703 9:91199436-91199458 GTGGCTCTGGGAAGAGGGAGTGG - Intergenic
1057592405 9:96383696-96383718 CCGGGCCGGGGAAGAGGGCGCGG + Exonic
1057629846 9:96710765-96710787 GTGGGCAGGGGACTAGGGAACGG - Intergenic
1058139459 9:101342421-101342443 ATGGGGAGGGGAAGAGGGAAGGG + Intergenic
1059380491 9:113919741-113919763 GTGGTCCTGGGAAGTGGGCCAGG + Intronic
1060158638 9:121338935-121338957 GTGGGCCAGGGGAAGGGGACAGG - Intergenic
1060590045 9:124810851-124810873 GTGGCCCTGGGAAGGGAGACTGG - Exonic
1060662242 9:125411208-125411230 GTGGCCAGGGGGAGAGGGAAGGG - Intergenic
1061057868 9:128233769-128233791 GTAGGCCAGTGAAGAGGGCCCGG + Intronic
1061408108 9:130403696-130403718 GGGGGCCTGGGAACTGGGACTGG - Intronic
1061449042 9:130658966-130658988 AGGGGCCAGGGAAGACGGACAGG + Intergenic
1061680668 9:132241193-132241215 GTGGGACGGGGAAGAGGCGGTGG + Intronic
1061937170 9:133864243-133864265 GTGTGCTGGGGACGAGGAACAGG + Intronic
1062182073 9:135196245-135196267 ATGGGAAGGGGAAGAGGGAAGGG - Intergenic
1062182117 9:135196370-135196392 ATGGGAAGGGGAAGAGGGAAGGG - Intergenic
1062182156 9:135196482-135196504 ATGGGAAGGGGAAGAGGGAAGGG - Intergenic
1062182194 9:135196582-135196604 ATGGGAAGGGGAAGAGGGAAGGG - Intergenic
1062182228 9:135196669-135196691 ATGGGAAGGGGAAGAGGGAAGGG - Intergenic
1062294108 9:135814616-135814638 GTGGGTTGGGGAAGATGGAGTGG - Intronic
1062400723 9:136371522-136371544 GTGGGCCTGGGGGCAGGGACAGG + Intronic
1062656166 9:137605475-137605497 ATGGGGCGGGGAATAGGGGCTGG + Intergenic
1062758214 9:138318146-138318168 GAGGCACTGGGAAGAGGGACCGG - Intergenic
1185640566 X:1587954-1587976 GAGGGCAGGGGAAGAGGGGGAGG - Intergenic
1186147927 X:6644267-6644289 GTGGGCAGGGGCATAGGGAATGG - Intergenic
1186169271 X:6859816-6859838 GTGGGCAGGGGATTAGGGAATGG - Intergenic
1186542996 X:10420096-10420118 GTAGGCTGGGGAAGAGAGGCAGG - Intergenic
1187074242 X:15918028-15918050 GTGGGCAGGGGACTAGGGAATGG + Intergenic
1188240220 X:27777571-27777593 GTGGTACTGGGAAGAGTGACAGG + Intergenic
1189377514 X:40477029-40477051 GTGGGCATGGGCAGTGGGACGGG + Intergenic
1189386398 X:40540267-40540289 GTGGGCAGGGGAAGAAGGAATGG - Intergenic
1189555802 X:42144123-42144145 GTGGGCTGTGGGAGAGGGAATGG + Intergenic
1190025422 X:46917681-46917703 GTGGGCAGGGAAAGATTGACAGG + Intronic
1191911111 X:66151263-66151285 CTGGGGTGGGGTAGAGGGACTGG - Intergenic
1192583384 X:72302538-72302560 GTGAGGCTGAGAAGAGGGACAGG - Intronic
1192790156 X:74373660-74373682 GTGGTAGGGGGAAGAGGGACAGG + Intergenic
1196239872 X:113330909-113330931 GTGGAGAGGGGAGGAGGGACAGG - Intergenic
1196776745 X:119345049-119345071 GTGGGTGGGGGAAGAGGAAGTGG - Intergenic
1200049772 X:153422555-153422577 GTGGGGCGGGGCAGGGGGACAGG - Intergenic
1200085251 X:153601106-153601128 TTGGGCTGGGGAAGAGGGTGGGG - Intergenic
1200141267 X:153904223-153904245 GTTGGCCGGAGACGAGGGACAGG - Intronic
1201300279 Y:12498852-12498874 GGGGGAGGAGGAAGAGGGACAGG - Intergenic
1202093408 Y:21217597-21217619 GTGGGAGAGGGAAGAGGGAGAGG + Intergenic