ID: 912401635

View in Genome Browser
Species Human (GRCh38)
Location 1:109398037-109398059
Sequence GAGGAGTGGGCCGGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 995
Summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 920}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401635_912401652 19 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401635_912401646 5 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401635_912401644 -2 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401644 1:109398058-109398080 TCATTGGCTCGCGTCGCCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 25
912401635_912401647 6 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401635_912401649 13 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401635_912401648 7 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39
912401635_912401645 4 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401635 Original CRISPR GAGGAGTGGGCCGGGGAAGA GGG (reversed) Intergenic
900166318 1:1245535-1245557 GAGGAGTGGCCCTGGGCAGTGGG + Intronic
900205064 1:1428024-1428046 GAGGGGAGGGGAGGGGAAGAGGG + Intergenic
900205100 1:1428102-1428124 GAGGGGAGGGGAGGGGAAGAGGG + Intergenic
900279850 1:1859683-1859705 GAGAAGTGGGGTGGGGGAGAGGG + Intronic
900673249 1:3868821-3868843 GAGGAGTGGGCCGAGGGCGTGGG - Intronic
900969183 1:5980121-5980143 GAGGACTGGGCCAGGGAGGGTGG - Intronic
901264846 1:7902706-7902728 GAGGCGCTGGCCGGGGAAGCTGG - Intergenic
901436661 1:9250844-9250866 GGGGAGGGAGCCGGGGAAGCCGG - Intronic
901443801 1:9294811-9294833 GAGGAGGGGGACAGGGCAGAAGG - Intronic
901508375 1:9700981-9701003 GAGTAGGGGGCAGGGGAAGGAGG - Intronic
901730040 1:11272999-11273021 GAGGGGTGGGGCGGGGCTGAGGG - Intergenic
902305721 1:15537361-15537383 GAGAAGTGTGCTGTGGAAGAGGG + Intronic
902377727 1:16037722-16037744 GAGGAGTTGGATGTGGAAGATGG + Intergenic
902611501 1:17600253-17600275 TAGGACAGGGCAGGGGAAGAGGG - Intronic
902653832 1:17854013-17854035 GAGGAGTAAGACAGGGAAGAGGG + Intergenic
902717299 1:18281627-18281649 AAGGAGTGGGCTGAGGAGGAAGG - Intronic
902726231 1:18337972-18337994 GAGGGGAGGGCCGGGGGAGGCGG + Intronic
902830766 1:19010783-19010805 GAGGAGTGGGCAGGGGTCGGTGG + Intergenic
902929780 1:19722905-19722927 TAGGAGGAGGCCTGGGAAGAAGG - Intronic
903674348 1:25054823-25054845 GAGGAGGGGGCCGGGGAGAATGG + Intergenic
903766875 1:25740782-25740804 GATGGGTGGATCGGGGAAGAGGG + Intronic
903811227 1:26036032-26036054 GAGGAGTGGGGCGAGGAAAGCGG + Exonic
903849034 1:26295358-26295380 GAGGAGAGGACGGGGGAAGCAGG - Intronic
904008192 1:27374689-27374711 GAGGAGTGGGTTGGTGAGGAGGG + Intronic
904028282 1:27518638-27518660 GAGGAGTAGGCCAGGGCAGAGGG + Intergenic
904034064 1:27549798-27549820 GCTGAGTGGGCCGGGGATAAGGG - Exonic
904094282 1:27965562-27965584 GAGGAGTAGGCCGGGGAAGTGGG + Intronic
904275814 1:29383529-29383551 GAGGAACGAGCTGGGGAAGATGG - Intergenic
904351539 1:29910188-29910210 CAGGAGTGGGTCGGGGAGGGGGG + Intergenic
904356955 1:29946479-29946501 GAGGAGCTGGCGGTGGAAGAGGG + Intergenic
904533044 1:31181772-31181794 GAGGAGTGGGCAGGGCAACCGGG - Intronic
904713714 1:32450832-32450854 GAGGAGTAGGAGGAGGAAGAGGG - Intergenic
904768713 1:32869609-32869631 GGGGAGGTGGCAGGGGAAGATGG + Intronic
904939138 1:34152596-34152618 CAGGAGTGAGCAGGTGAAGAGGG - Intronic
905018958 1:34795306-34795328 GATGACTGGGCTGGGGAAGCAGG + Exonic
905391452 1:37638444-37638466 GAGAGGTGAGGCGGGGAAGAGGG + Intergenic
905393061 1:37650528-37650550 AGGGAGGGGGCTGGGGAAGAGGG + Intergenic
905409065 1:37755858-37755880 GAGGAGAGGGCCAGGGAACAAGG - Intronic
905528304 1:38655980-38656002 GAAGAGTGAGGCTGGGAAGACGG + Intergenic
906290744 1:44617862-44617884 GAGGAGAGGGGAGGGGAGGAGGG - Intronic
906666415 1:47625344-47625366 CAGGGGTGGGCAGGGGAAGAAGG - Intergenic
906798810 1:48718616-48718638 GAGGTGGGGGCAGAGGAAGAAGG + Intronic
907145135 1:52224351-52224373 GAGGGGTAGGCAGGGGAAGGTGG + Intronic
907218326 1:52885194-52885216 GAGGAGTGGGCCGGGCACGGTGG - Intronic
907289248 1:53402413-53402435 TAGGAGTGGCCTGGGGAAGCAGG - Intergenic
907464066 1:54623570-54623592 GAGGATTGGGGCGGGGAGGGAGG - Intronic
907498081 1:54858402-54858424 GGGAAGTGGGACTGGGAAGAGGG - Intronic
909527648 1:76644705-76644727 GAGAAATGGGCCGGAAAAGAGGG + Intergenic
910210053 1:84783339-84783361 GAGGTGGGGGCGGGGTAAGATGG - Intergenic
911556925 1:99356177-99356199 GACTAGTGGGGCGGGGAAGCAGG - Intergenic
911679899 1:100703143-100703165 GAGGAGAGGGAAGGGGAAGAAGG + Intergenic
912401635 1:109398037-109398059 GAGGAGTGGGCCGGGGAAGAGGG - Intergenic
912552773 1:110494907-110494929 GAGGAGAGGGGCTGGGAATAGGG - Intergenic
913056017 1:115160081-115160103 GAGGGGAGGGCAGGGGAAGGGGG + Intergenic
913264728 1:117033288-117033310 AGGGAGGGGGCCGGGGAAGGAGG + Intronic
914196809 1:145451966-145451988 GAGGAGGGGGAGGGGGAAGAAGG + Intergenic
914263610 1:146019613-146019635 GAGGAGGAGGCCGGGGTGGAGGG - Exonic
915109465 1:153553772-153553794 GGGGACTGGGCCTGGGGAGATGG + Intergenic
915249390 1:154577669-154577691 GAAGAGTGGGCCTGGGAGGGAGG - Exonic
915298154 1:154936449-154936471 GAGCACTGGGCTGGGGAAGGTGG - Intronic
915572429 1:156751747-156751769 GAGGAGTGGGTCCGGGAGGAGGG - Intronic
915597042 1:156901837-156901859 GGGCATTGGGCCTGGGAAGATGG + Intronic
915722179 1:157993596-157993618 GAGGAGCGGGCTGGGGAGGAGGG - Exonic
916074436 1:161192203-161192225 GAGGAGCTGTCCGGGGAACAGGG + Exonic
916332059 1:163628310-163628332 GAGGAGGGGGAGGGGGAGGAGGG - Intergenic
916339298 1:163710906-163710928 GAGGAAAGGGAAGGGGAAGAGGG - Intergenic
916415531 1:164588991-164589013 GGGGAGGGGGCTGGGGAGGAGGG - Intronic
916941695 1:169684480-169684502 GAGGAGCAGTCTGGGGAAGAGGG - Intronic
917290446 1:173467120-173467142 GAGGACAGGGCATGGGAAGAGGG + Intergenic
917310092 1:173669748-173669770 GAGGAGTGCGATGGGGTAGACGG - Intronic
917661625 1:177182131-177182153 GAGGGGTGGGGCAGGGAGGATGG - Intronic
917968627 1:180193822-180193844 CATGAGTGGGCAGGGGAGGAAGG + Intronic
918812885 1:189142788-189142810 GAAGAGTGGGAAGGGGATGAGGG - Intergenic
919825430 1:201500166-201500188 AAGGAGAAGGCCGAGGAAGAGGG - Intronic
919920269 1:202163111-202163133 GAGGAGCTGGCTGGGGAAGTGGG + Intergenic
919984180 1:202661387-202661409 GATGAGTGAGCTGGGGAGGAAGG - Intronic
919990293 1:202704630-202704652 TAGGGGTGGGCTGGGGAGGAGGG - Intronic
920188851 1:204179526-204179548 GTGGAGTGGGTGGGGGCAGAGGG + Intergenic
920342606 1:205284875-205284897 GAGGGGTGGGGAGGGGAAGATGG - Intergenic
920371310 1:205481088-205481110 GAGGAGGGGGGTGAGGAAGATGG - Intergenic
920565012 1:206966071-206966093 GAGGAGAGGGGTGGAGAAGAGGG + Intronic
920657449 1:207887412-207887434 GAGGAGGGGGTAGGGGAAGGGGG + Exonic
920737322 1:208544677-208544699 GAGGAGTGGGGTGGGGAGGTGGG + Intergenic
920829311 1:209450600-209450622 GAGGAGCAGGCTGGGGAGGAAGG - Intergenic
920851956 1:209634182-209634204 GGGGAGGGGGCTGTGGAAGACGG + Intronic
921218265 1:212954993-212955015 GAGGAGTGGCCCCTGGAAAAGGG - Intronic
922098613 1:222463533-222463555 GAGCAATGGGCCGGGGAAGCAGG + Intergenic
922188434 1:223296367-223296389 GAAGAGTGGGCCTAGGGAGAAGG + Intronic
922402786 1:225277114-225277136 GGGGAGGGGGACGGGGAAGGGGG + Intronic
922658489 1:227407424-227407446 GAAGGGTGGGATGGGGAAGAGGG + Intergenic
923244661 1:232119842-232119864 GAGGAGCAGGCTGGGGAGGAAGG - Intergenic
923402584 1:233629360-233629382 GTAGAGTGGGCCGGGGAAGAGGG + Intronic
923482386 1:234397333-234397355 GAGGAGGGGGAGGGGGAGGATGG + Intronic
923482535 1:234397636-234397658 GGGGAGGGGGAGGGGGAAGAGGG + Intronic
923482607 1:234397791-234397813 GGGGAGGAGGCGGGGGAAGAGGG + Intronic
923791173 1:237112399-237112421 GAGGAGGGGGCCGGGCACGGTGG - Intronic
923979141 1:239301417-239301439 GAGGAGTGGAGCTGGGAACAGGG - Intergenic
924052668 1:240093199-240093221 GAGGAGTGGGCCCCGGAGGTGGG + Exonic
924622910 1:245677990-245678012 GAGCATTGGGCCAGGGATGATGG + Intronic
924672992 1:246147949-246147971 GAGGAGAGGGGCTGGGAAGCGGG - Intronic
1062946192 10:1464105-1464127 GGGCAGTGTGCCGGAGAAGAGGG + Intronic
1062946208 10:1464171-1464193 GGGCAGTGCGCCGGAGAAGAGGG + Intronic
1062946222 10:1464237-1464259 GGGCAGTGCGCCGGAGAAGAGGG + Intronic
1063692962 10:8304457-8304479 GAGGAGTGGCCAGGAGAAAATGG + Intergenic
1063713756 10:8506851-8506873 GGGTAGTGGGGTGGGGAAGAAGG - Intergenic
1063979323 10:11441116-11441138 CAGGAGGAGGCCTGGGAAGATGG - Intergenic
1064007205 10:11708101-11708123 GGGGAGGGGGCGGAGGAAGACGG + Intergenic
1064244428 10:13657572-13657594 GAGGGGTGCTCCGGGGAGGAGGG + Intronic
1064939844 10:20721700-20721722 GAGAAGTGGGTCTGGGTAGAAGG - Intergenic
1065342604 10:24722199-24722221 CAGGAGTGGCACTGGGAAGAAGG - Exonic
1065939770 10:30553769-30553791 GAAGAGTGGGCAGGAGGAGAAGG - Intergenic
1066627284 10:37419645-37419667 GAGGAGAGGGTAGGTGAAGAGGG - Intergenic
1068121136 10:52782965-52782987 GAGCAGTAGGCCTGGGAAGGCGG - Intergenic
1069242222 10:66157182-66157204 GAGTAGTGGGAGGGGGACGAGGG - Intronic
1070382573 10:75894168-75894190 GAAGAGTGGGAGGGGGACGAGGG - Intronic
1070626295 10:78053661-78053683 CAGGAGCGGGCCGGGGATGGGGG + Intronic
1070779249 10:79127915-79127937 GAGCAGTGGCCCTGGGAAGCTGG - Intronic
1071187137 10:83058779-83058801 AAGGAGTGGCCTGGGGAGGAGGG - Intergenic
1071518548 10:86315002-86315024 CAGCAGTGGGCGGGGGCAGAAGG - Intronic
1072407506 10:95168765-95168787 GAGGAGTGGGGCAGGGGAGCAGG + Intergenic
1072454996 10:95567684-95567706 GAGGAGAGGGGAGGGGAGGAAGG + Intergenic
1072497166 10:95973140-95973162 GAGGAGGGGGCGGGGGGAAATGG + Intronic
1072806403 10:98426216-98426238 GGGCAGTGGGCAGGGGCAGAGGG + Intronic
1072917243 10:99545571-99545593 GAGGAGGGGGAGGCGGAAGAGGG + Intergenic
1072960791 10:99927148-99927170 GAGGGGTGGCAAGGGGAAGACGG + Intronic
1073267653 10:102237875-102237897 GTGGGGTGGGCGGGGGAGGAGGG - Intronic
1073473977 10:103740963-103740985 AGGGAGTGGGCACGGGAAGAAGG + Intronic
1074145646 10:110714873-110714895 GAGGGGTGGCCCAGGGAAAAAGG + Intronic
1074169576 10:110919486-110919508 GAGGGGTGGGGCGGGGAGGCTGG + Intergenic
1074377133 10:112950073-112950095 GAAGAGAGGGGCGGGGAAGCCGG - Intergenic
1074472506 10:113740343-113740365 GAAGAGTGGGAGGGGGATGAGGG + Intergenic
1074983593 10:118639032-118639054 AAGGACTGGGCCAGGGAGGAAGG - Intergenic
1075092011 10:119449051-119449073 GGGGACTGGGCCGGGGACTATGG + Intronic
1075123632 10:119682310-119682332 GAAGAGAGGGCAAGGGAAGAGGG - Intergenic
1075294183 10:121258974-121258996 GGAGAGTCGGCCTGGGAAGAGGG + Intergenic
1075650606 10:124126353-124126375 GTGGAGAGGGGAGGGGAAGAGGG - Intergenic
1076100205 10:127771309-127771331 TAGCAGTGGGCCTGGGATGAAGG - Intergenic
1076232589 10:128834342-128834364 GAGGAGGTGGCAGGGGTAGAGGG + Intergenic
1076778366 10:132710476-132710498 TAGGCGTGGGCCGGGCAAGTAGG + Intronic
1077015240 11:396387-396409 GGGGGGTGGGCTGTGGAAGATGG + Intronic
1077059247 11:610519-610541 GAGGGCTGGGCCGGGGCAGGCGG - Exonic
1077231164 11:1458744-1458766 GGGAAGAGGGCCGAGGAAGAGGG + Intronic
1077452875 11:2661522-2661544 GAGTAGTGGGTCAGGAAAGATGG - Intronic
1077839751 11:5961217-5961239 GGGGTGGCGGCCGGGGAAGAGGG - Intergenic
1077987191 11:7365048-7365070 GCGGGGTGGGCCTGGGAGGAGGG - Intronic
1078146381 11:8724340-8724362 GAGAAGTGGCCCAGGGTAGAGGG - Intronic
1078679818 11:13464970-13464992 GAGGAGTGGGGCGGGGGTGGGGG - Intergenic
1078729090 11:13959701-13959723 GAGGAGAGGGAGGAGGAAGAAGG + Intergenic
1079092656 11:17491894-17491916 GAGCACTGGGCCGGGCAGGAAGG - Intergenic
1079119798 11:17673742-17673764 GCTGAGTGGGCTGGGGAAGGGGG - Intergenic
1079129409 11:17738605-17738627 GAGGAGAGGGCCAGGGGAGGGGG - Intronic
1080008427 11:27433516-27433538 GAAGAGTGGGCCGGGCATGGTGG - Intronic
1080416887 11:32077310-32077332 GAGGACTGGGCAGAGGTAGATGG - Intronic
1080418128 11:32088687-32088709 GAGGAGTGGGAGGAGGAACAGGG - Intronic
1081155485 11:39684445-39684467 GAGGGGAGGGAAGGGGAAGAAGG - Intergenic
1081497675 11:43631927-43631949 CAGGTGTGGGCCTGTGAAGAGGG - Intronic
1081680463 11:44998972-44998994 GAGGGGTGCGCGGGGGAGGAAGG - Intergenic
1081857153 11:46311155-46311177 GAGGAGTGGGGAGGTGGAGATGG - Exonic
1081990580 11:47335261-47335283 GAGGAGTGGGCAGTGGGAGTGGG - Intronic
1083049564 11:59765149-59765171 GATGAGTGTGTTGGGGAAGATGG + Intronic
1083275427 11:61594498-61594520 CAGGAATGGTCCGGTGAAGAGGG + Intergenic
1083275624 11:61595491-61595513 GAGGGGGGGGTTGGGGAAGAGGG - Intergenic
1083298930 11:61730236-61730258 GAGGAGTGGGAGGGAGAAGGTGG - Intronic
1084464375 11:69313544-69313566 GAGGTGTGTGGGGGGGAAGATGG + Intronic
1084470422 11:69356203-69356225 GAGGAGTAGGGAGGGAAAGAAGG + Intronic
1085022664 11:73218928-73218950 AGGGAGTGGGCGGGGGAGGAGGG + Intronic
1085053852 11:73392997-73393019 GAGTAGTGGTGTGGGGAAGAAGG - Intronic
1085310036 11:75510744-75510766 GAGGAGGGGGGAGGGGGAGAAGG - Intronic
1086146743 11:83560520-83560542 GAGGAGTGGGTTGGGGATGGTGG + Intronic
1086608210 11:88723019-88723041 GAGGAGGGAGCAGGAGAAGAAGG - Intronic
1088357686 11:108960675-108960697 GAGGTGTGTGCCTGGGAGGAGGG - Intergenic
1088888304 11:114024873-114024895 TTGGAGTTGGCCTGGGAAGAGGG + Intergenic
1089096283 11:115922700-115922722 GAGGAGAGGGCAGGGCAAGAGGG - Intergenic
1089216636 11:116838048-116838070 GAGGACAGGGCGGGGGAAGGGGG - Intergenic
1089309242 11:117547054-117547076 GAGGAGTGGGGAGAGGGAGAGGG + Intronic
1089619329 11:119713514-119713536 GGGGAGGGGGCAGGGGAAGGGGG - Intronic
1089658346 11:119968811-119968833 GTGGAGTGAGCTGGTGAAGATGG + Intergenic
1089810551 11:121128057-121128079 GAGGTGTGCGCCGTGGAGGACGG + Exonic
1090387246 11:126364322-126364344 GAGGAGAGGGCAGGAGACGAGGG + Intronic
1090389810 11:126381520-126381542 GAGGAGAGGGCAGGAGACGAGGG + Intronic
1091225731 11:133955883-133955905 GAGGGGAGGGGCGGGGAAGGGGG - Intronic
1091235062 11:134016173-134016195 GAGGAGGGGGCCGGGCCACAGGG + Intergenic
1091408520 12:223972-223994 GAGGTGAGGGCCTGGGAAGCGGG - Exonic
1091456243 12:610266-610288 GGGGACTGGGCAGGTGAAGAGGG - Intronic
1091601085 12:1918157-1918179 GAGGAGTGGGCAGAGGATGGAGG + Intronic
1091796378 12:3299630-3299652 GAGGTGGGGACAGGGGAAGAGGG - Intergenic
1091801079 12:3324839-3324861 GAGGATGGGGCCGGGCAGGAGGG + Intergenic
1091807636 12:3367147-3367169 GAGGAGTGTGCTGGGGGTGAGGG + Intergenic
1092168856 12:6360737-6360759 GAGGAGAAGGCAGGGGAGGAGGG + Intronic
1092436829 12:8454691-8454713 GAAGAGTGGGAGGGGGATGAGGG + Intergenic
1092483388 12:8880633-8880655 GGGGAGTGGGAGGGGGAGGAGGG + Intronic
1092881435 12:12890723-12890745 GAGGAGTGGGCAGTGGAGGGAGG + Intergenic
1094147282 12:27244054-27244076 GATGGGTGGGGCCGGGAAGACGG + Intronic
1094499254 12:31007906-31007928 GAGGCGGGGGCCAGGGAGGAGGG + Intergenic
1094654047 12:32403880-32403902 GAGCATTGGGCCGGGCACGATGG - Intronic
1095672410 12:44876363-44876385 GAGGGGCGGGCCGGGGGAGGCGG + Intronic
1095998109 12:48106147-48106169 GAGGAGGGGGCTGGGGCAGGAGG + Intronic
1096059248 12:48682428-48682450 GGAGAGTGAGCCGGGGAAGGGGG + Intergenic
1096114549 12:49047925-49047947 GAGGTGTAGGCTGGGGAATAGGG - Intronic
1096155509 12:49339362-49339384 GAGGAGTGTGGCTGGGCAGAGGG - Intergenic
1096314947 12:50556360-50556382 GAGGAGTCGGCCGGGCTCGATGG - Intronic
1096475546 12:51907104-51907126 GAGTAGTGGGTGGGGGTAGAGGG - Intronic
1097041364 12:56158042-56158064 GAGGAGAGGGCGGGAAAAGAGGG + Intronic
1097192856 12:57227751-57227773 GAGGAGGAGGCAGAGGAAGAGGG - Intergenic
1097226416 12:57479101-57479123 GAGCAATTGGCCGGGGATGACGG + Exonic
1097248796 12:57621144-57621166 GGAAATTGGGCCGGGGAAGAGGG + Intronic
1097282654 12:57854231-57854253 GAGCAGAGGGAAGGGGAAGAAGG + Intergenic
1097639238 12:62159709-62159731 GAAGAGTGGGAGGGGGATGAGGG + Intronic
1097691326 12:62737146-62737168 GAGTAGCGGGCCATGGAAGAAGG + Intronic
1097712452 12:62932054-62932076 TAGGTGAGGGCTGGGGAAGAGGG + Intronic
1098299289 12:69037729-69037751 GAAAAGTGGGCCGGGCAAGGTGG - Intergenic
1098316527 12:69199125-69199147 GAGAAGTGGGAGGAGGAAGAGGG + Intergenic
1099362173 12:81717829-81717851 GAGGAGGGGAATGGGGAAGAAGG + Intronic
1099581404 12:84451552-84451574 GAAGAGTGGGAAGGGGACGAGGG - Intergenic
1100521924 12:95383386-95383408 GCTGAGTGGTCCAGGGAAGATGG + Intergenic
1100616483 12:96235250-96235272 CAGGAGTGAGCCAGGCAAGAAGG - Intronic
1101446180 12:104738316-104738338 GAGGATTGGGTGGGGGAACAGGG - Intronic
1101692198 12:107093105-107093127 GAGGAGGGGACCGGAGAAGGCGG + Exonic
1102409029 12:112701033-112701055 GAGGAGTAGGTCTGGGAGGAAGG - Intronic
1102504369 12:113374448-113374470 GGGGAGGGGGCGGGGGCAGAGGG - Intronic
1102856954 12:116302466-116302488 GAGGGGTGGGCACGGGGAGAGGG + Intergenic
1103642549 12:122363634-122363656 GGGGAGGGGGCGGGGGCAGAAGG - Intronic
1103971349 12:124674632-124674654 GAGGAGTGGGGCAGCGCAGAAGG - Intergenic
1104052570 12:125205997-125206019 GAGTGGTGGGGTGGGGAAGAAGG + Intronic
1104110615 12:125700771-125700793 GAGGAGGGAGTCGGGGAAGGTGG + Intergenic
1104399799 12:128465912-128465934 GAGGAGAGGCCCGGGGATAAGGG + Intronic
1104402430 12:128487303-128487325 GTGAAGTTGGTCGGGGAAGAGGG - Intronic
1104606699 12:130194663-130194685 GAGGAGAGGGCCGGGCATGGTGG + Intergenic
1104718984 12:131034175-131034197 GCAGGGTGGGCAGGGGAAGAAGG - Intronic
1104844661 12:131840779-131840801 GTGGTGGTGGCCGGGGAAGAAGG - Exonic
1105931327 13:25055597-25055619 GAGTAGTCTGCCGGGGAGGACGG + Intergenic
1106243102 13:27925535-27925557 GAGGAAGAGGACGGGGAAGAAGG - Exonic
1106481876 13:30143072-30143094 GTGCAGTGGGCGGGGGAAGGTGG + Intergenic
1106512247 13:30421915-30421937 GAGAGGTGGGGCGGGGAGGAGGG + Intergenic
1106512257 13:30421937-30421959 GAGAGGTGGGGCGGGGAGGAGGG + Intergenic
1107415083 13:40192794-40192816 GAAGAGTGGCCCGGGAAGGAGGG + Intergenic
1108378189 13:49833201-49833223 GGGGAGTGAGGCAGGGAAGATGG + Intergenic
1108732722 13:53251554-53251576 AAGGAGTGGGGTGGGGGAGAAGG + Intergenic
1109971729 13:69779363-69779385 GAGGAGAGGGGAGGGGAGGAAGG - Intronic
1110428152 13:75392601-75392623 GAGGAGGAGGAGGGGGAAGAAGG - Intronic
1110810454 13:79806691-79806713 GGGGAGTGGGCCGGGCGAGGTGG - Intergenic
1112354322 13:98661392-98661414 GGGGAGTGGGCCAGGGAGAAGGG + Intergenic
1112398151 13:99052274-99052296 GAGTAGTGGGCCAGGGGTGAGGG - Intronic
1112513027 13:100026838-100026860 GAGGAGTTGGAAGGGGAAGCAGG - Intergenic
1112576012 13:100637450-100637472 GAGGAGTGAGACGAGGAGGAGGG + Intronic
1113635305 13:111915163-111915185 GTGGAGGTGGCAGGGGAAGAAGG - Intergenic
1113660704 13:112104910-112104932 GCGGAGCGCGCGGGGGAAGAGGG + Intergenic
1113745081 13:112738707-112738729 GAGGAGGGGGACGGGGAGGCAGG - Intronic
1113745932 13:112744557-112744579 GAGCAGAGGGCCGGGGAGGGAGG - Intronic
1113750924 13:112776002-112776024 GGGAAGGGGTCCGGGGAAGAGGG - Intronic
1113908303 13:113830461-113830483 GAGGAGGGGCCCGGGGCAGGTGG - Intronic
1113908331 13:113830536-113830558 GAGGAGGGGCCCGGGGCAGGTGG - Intronic
1113908359 13:113830611-113830633 GAGGAGGGGCCCGGGGCAGGTGG - Intronic
1113908387 13:113830686-113830708 GAGGAGGGGCCCGGGGCAGGTGG - Intronic
1113908414 13:113830762-113830784 GAGGAGGGGCCCGGGGCAGGTGG - Intronic
1115498306 14:34027492-34027514 GGGGAGGGGGAGGGGGAAGAAGG + Intronic
1116975775 14:51114188-51114210 GAGGAAAGGGCCTGGAAAGAGGG + Intergenic
1117406813 14:55411887-55411909 GAGGAGGGGCCTGGGGAAGGGGG + Intergenic
1118313312 14:64708396-64708418 GCGGAGTGGGGCGGGGACAAGGG + Intronic
1118647194 14:67851493-67851515 GGGGAGTGGGCAGTGGAGGAAGG + Intronic
1119539185 14:75427881-75427903 AAGGAGGGGACCGGGGAGGAGGG - Intronic
1119539585 14:75429132-75429154 GATGAGGAGGCTGGGGAAGATGG + Intronic
1119558238 14:75569643-75569665 GAGAAGTGAGCAGGGGTAGATGG - Intergenic
1120738156 14:88078514-88078536 GAGGAGTGGGCAGTGGAGGAAGG - Intergenic
1120864737 14:89286158-89286180 GAGGAGTAGGGAGGGGAGGAGGG + Intronic
1121193403 14:92048791-92048813 GAGGAGCAGCCTGGGGAAGAGGG + Exonic
1121304801 14:92899401-92899423 GAGGAGTGGGGAGGGGAGGCAGG - Intergenic
1121400926 14:93676403-93676425 GAGGAGAGGGCAGGTGAACAGGG + Intronic
1121566316 14:94912610-94912632 GAGGCTTGGGCATGGGAAGACGG + Intergenic
1121643606 14:95502438-95502460 TAGGAGCCAGCCGGGGAAGATGG - Intergenic
1121847565 14:97186711-97186733 GAGGAGAGGGGAGGGGCAGATGG - Intergenic
1122293800 14:100693875-100693897 GAGAAGGGGGCTGGGGGAGAGGG - Intergenic
1122293953 14:100694483-100694505 GAGGGATGGGGCGGGGAAGCGGG + Intergenic
1122329677 14:100904030-100904052 GACAAGTGGGAGGGGGAAGAGGG + Intergenic
1122924656 14:104894074-104894096 GAGGGCTGGGCCCGGGATGAGGG - Intronic
1122959566 14:105088238-105088260 GAGGAGTGGGCGGAGGAGAAGGG + Intergenic
1123002172 14:105301366-105301388 GAGCTGTGGGCGGGGGAAGGGGG + Exonic
1123022656 14:105408943-105408965 GAGGAGGGGGAGGGGGAGGAGGG - Intronic
1123434849 15:20247654-20247676 GAGGAGAGGGGAGGGGATGAGGG + Intergenic
1124500115 15:30220940-30220962 TGGGACTGGGCCGAGGAAGAGGG + Intergenic
1124743460 15:32317726-32317748 TGGGACTGGGCCGAGGAAGAGGG - Intergenic
1124878170 15:33615887-33615909 AAGGAGTGGAGTGGGGAAGATGG - Intronic
1125182044 15:36888573-36888595 GAGGCTTGGGCCGCGGCAGAGGG - Intergenic
1125426742 15:39556461-39556483 GAGATGTGGGGTGGGGAAGAAGG + Intergenic
1125629074 15:41132786-41132808 GAGGAGTAGTCTGGGGAGGAGGG - Intergenic
1125867031 15:43061809-43061831 GAAGGGTGGGTGGGGGAAGAGGG + Intronic
1125887058 15:43236986-43237008 AAAGAGTGGGCCCAGGAAGATGG + Intronic
1126578060 15:50217097-50217119 GAAGAGTGGGAGGGGGACGAGGG + Intronic
1127274504 15:57430570-57430592 GAGAAGTGGGCAAGGGAAGTGGG + Intronic
1128044832 15:64608624-64608646 TAGGGGTGGGCAGGGGAAGGTGG - Intronic
1128083508 15:64870665-64870687 GATGAAGGGGCCTGGGAAGATGG - Intronic
1128558214 15:68646124-68646146 GAGGTGGGGGATGGGGAAGAAGG - Intronic
1129268729 15:74408572-74408594 GAGCAGTGGTCCTGGGATGAAGG - Intergenic
1129460908 15:75699705-75699727 GAGGGCTGGGCCGGGGGAGGAGG + Intronic
1129611339 15:77060696-77060718 AAGGAGGGGGCTGGGGAGGAGGG + Intronic
1129665312 15:77576322-77576344 GAGGAGGAGGAGGGGGAAGAGGG + Intergenic
1129817187 15:78565464-78565486 GAGGATTGGGCGGGGCCAGAGGG + Intergenic
1130907087 15:88248221-88248243 GATGAGGAGGCCTGGGAAGAGGG + Intronic
1131630710 15:94174158-94174180 GAGGAGTGGGAAGGTGATGAAGG - Intergenic
1132023707 15:98386510-98386532 GAGGAGAGGGCAGAGGAGGAAGG - Intergenic
1132128719 15:99253570-99253592 GAGAAGTGGGTGGGGGCAGATGG + Intronic
1132414508 15:101610779-101610801 GAGGACTGCGCCTGGGAGGAGGG - Intergenic
1132481191 16:166903-166925 GAGGAGTGCGATGGGGCAGAGGG + Intergenic
1132572994 16:652074-652096 GAGGTGTGGGCTGGGGCAGCTGG + Intronic
1132599469 16:767499-767521 GAGGAGGGGCCCGTGGAGGAGGG + Intronic
1132629334 16:909254-909276 AAGGAGGGCGCTGGGGAAGATGG + Intronic
1132673137 16:1110017-1110039 GAGGAAAGGGCAGGGGAACAGGG + Intergenic
1132885896 16:2181750-2181772 GAGGGTTGGGCTGGGGACGAGGG + Intronic
1133813231 16:9177362-9177384 GAGGAGAGGGGAGGAGAAGAGGG - Intergenic
1133813247 16:9177403-9177425 GAGGGGAGGGGAGGGGAAGAGGG - Intergenic
1134024629 16:10944570-10944592 GGGCTGTGGGCCGGGGAGGAAGG + Exonic
1134692104 16:16197728-16197750 GAGGAGGAGGCTGGGGCAGAGGG + Intronic
1134751822 16:16631227-16631249 GAGGAGGGGGGGGGGGGAGAAGG - Intergenic
1135691455 16:24540385-24540407 GAGGACGAGGACGGGGAAGAGGG - Exonic
1135761260 16:25139942-25139964 GAGGAGTCAGCCAGGTAAGAAGG - Intronic
1136227195 16:28866891-28866913 CCGGAGTGGGCCGGGGAGGAGGG + Exonic
1136401532 16:30021789-30021811 AAGGAGGGGGCGGGGGAGGACGG + Intronic
1136415104 16:30098176-30098198 GTGGGGTAGGCGGGGGAAGATGG - Intergenic
1136556288 16:31009727-31009749 GAGGAGAGGGCCATGGAACACGG - Intronic
1137414873 16:48266508-48266530 GAGGAAAGGGGCGGGGAAGAAGG - Intronic
1137594286 16:49713598-49713620 CAGAAGCGGGCAGGGGAAGAAGG - Intronic
1137764932 16:50970791-50970813 GAGGACTGGGAAGGGGAAGGAGG + Intergenic
1138358569 16:56406068-56406090 GAGGAGGGGGAGGGGGGAGAGGG + Intronic
1138474783 16:57264240-57264262 GGGGAGTAGGCCGAGGAAGGAGG - Intronic
1138900691 16:61265503-61265525 AAGGAGGGAGGCGGGGAAGAAGG - Intergenic
1139176799 16:64699060-64699082 GAGGACTTGGCAGGGCAAGAAGG + Intergenic
1139219305 16:65163596-65163618 AAGGAGAGGGCTCGGGAAGAGGG - Intergenic
1139475427 16:67200373-67200395 GATGTGTGGGCTGGGGGAGATGG + Intronic
1139675017 16:68517649-68517671 GAGGAGGAGGCTGGGGAGGAAGG + Intergenic
1139711456 16:68779566-68779588 GAGGGGTTGGCCGGGCACGATGG + Intronic
1140384197 16:74519875-74519897 GAGGAGTGGGACCAGGAAGATGG - Intronic
1140685080 16:77425753-77425775 GAGGAGTGGGCCGGGCACGGTGG + Intronic
1140974279 16:80044277-80044299 GAGGAGTGGGGAAGGGAAAAGGG + Intergenic
1141310872 16:82912146-82912168 GAGGAGTGGGCTGGAGATTAAGG - Intronic
1141331757 16:83117390-83117412 GAGGAGATGGCAGTGGAAGATGG - Intronic
1141608014 16:85166444-85166466 GAGGAGGAGGCCGGTGATGATGG - Intergenic
1141636070 16:85314608-85314630 AAGGAGTGGGGCGAGGAAGGAGG - Intergenic
1141678017 16:85527685-85527707 CAGCAGCGGGCCGGGGAAGTGGG + Intergenic
1141801024 16:86309440-86309462 GAGGAGAGGGCCGTGTAAAAGGG - Intergenic
1141910726 16:87056846-87056868 GAGGTGTGGGCCGGGTAGGGCGG + Intergenic
1141911928 16:87066327-87066349 GAGGAGTGTGCGGGGGAGAAGGG + Intergenic
1142001293 16:87665764-87665786 GAGGGATGGGCTGGGGAAGGAGG - Intronic
1142105148 16:88298700-88298722 GAGGAGTGGGGAGAGGAAGGTGG - Intergenic
1142234509 16:88915436-88915458 GAGGAGTGGAACGTGGAGGAGGG + Intronic
1142535045 17:608898-608920 GAGCAGTGGGCCGGGCATAATGG - Intronic
1142608778 17:1096700-1096722 GAGGAGAGAGCTGGGGAAGGGGG + Intronic
1142608794 17:1096737-1096759 GAGGAGAGAGCTGGGGAAGGGGG + Intronic
1142608824 17:1096811-1096833 GAGGAGAGAGCTGGGGAAGGGGG + Intronic
1142608879 17:1096951-1096973 GAGGAGAGAGCCGGGGAAGGGGG + Intronic
1142715609 17:1745417-1745439 GAAGAGTGGGCGGGGCTAGAGGG + Intronic
1142779751 17:2172302-2172324 GCGGAGGGGGGCGGGGAGGAAGG + Intronic
1143183579 17:4998154-4998176 GAGGTGAGGGCTGGGGAAGGGGG + Exonic
1143617712 17:8063903-8063925 GGGGAGTGGGCAGAGGGAGAAGG - Intergenic
1143628906 17:8126027-8126049 GAGGTGCGGGCCGGGGACGGAGG - Intergenic
1143766825 17:9143305-9143327 GAGGCATGAGCCTGGGAAGAGGG + Intronic
1144072755 17:11689324-11689346 GTGGAGTGGGCATTGGAAGAAGG - Intronic
1144168722 17:12637748-12637770 GACTAGTGGGCCGAGGCAGATGG - Intergenic
1144338669 17:14295713-14295735 CAGGTGTGGGCAGGGGGAGAAGG + Intergenic
1145824251 17:27865156-27865178 GATGAGTGGGCTGAGGAAGAGGG + Intronic
1145826209 17:27878949-27878971 GAGGAGGGGGCGGGGCAGGACGG + Exonic
1145902567 17:28498091-28498113 GAGGAATTGGCAGGGGCAGAGGG - Intronic
1146187229 17:30731852-30731874 GAGTAGCTGGCCGGGGAAGGAGG + Intergenic
1146255926 17:31391621-31391643 GAAGAGTGGGGAGGGGAAGGAGG - Exonic
1146409620 17:32571225-32571247 GGGGAGTGGGGCGTGGAAGCAGG + Intronic
1146633964 17:34490702-34490724 GAGGAGTGTTTAGGGGAAGAGGG - Intergenic
1146757927 17:35449375-35449397 GAGGAGGGGTCCGGGGAAGGCGG - Intergenic
1147187550 17:38720759-38720781 GAGGAGTGGGGCAGGAAGGAGGG + Intronic
1147690767 17:42313064-42313086 TAGGAGGGGGCCGGGGAGGGAGG + Intergenic
1148680159 17:49469126-49469148 GAGGAATGGGCTGGGGAGGCAGG + Intronic
1149863880 17:60139724-60139746 GAGGAGGGGGCCGCGGGCGAAGG - Intergenic
1149993040 17:61393380-61393402 GAAGTGTGGGCCAGGGAAGGGGG - Intergenic
1150267762 17:63842274-63842296 GAGAAGTGGGAAGGGGAAGCAGG - Intronic
1150675588 17:67244572-67244594 GAGGAGGGGGCGGGGAAAGGGGG + Intronic
1150739676 17:67769336-67769358 GAGCAGTAGGCAGGGGCAGAGGG - Intergenic
1151193696 17:72416624-72416646 GAGGGGGGTGCGGGGGAAGAGGG + Intergenic
1151365507 17:73613785-73613807 GAGGAGGGGGACAGGGAAGGGGG + Intronic
1151462488 17:74262794-74262816 AAGGAGTGGGGTGGGGAAGTGGG + Intergenic
1151540794 17:74763668-74763690 GAGGTGTGGGCTGGGGGAGCGGG + Intronic
1151699620 17:75736404-75736426 GAGGTGTGGGCGTGGGAACAGGG + Intronic
1151842361 17:76627361-76627383 GCGCAGTAGGCCGGGGCAGAGGG - Intronic
1151919179 17:77140969-77140991 GGGGAGGGGGCCGGGGAGGCGGG - Intronic
1151946303 17:77321781-77321803 CAGGAGGGGGCCAGGGGAGACGG + Intronic
1151967860 17:77440993-77441015 GTGGAGTGAGCTGGGGGAGAAGG + Intronic
1152400760 17:80065037-80065059 GAGGAGGGGGAGGGGGAAGACGG - Intronic
1152432626 17:80257782-80257804 GAGGGCTGGGGCGGGGAAGCAGG + Intergenic
1152598355 17:81249195-81249217 GAGGAGGGGGAGGGGGAGGAGGG + Intronic
1152705478 17:81841400-81841422 GAGCTGGGGGCCGGGGCAGACGG + Intergenic
1153170692 18:2312510-2312532 GAGGAGTGGGGCAGGGGAGGAGG + Intergenic
1153270768 18:3318978-3319000 GAGGAGGGGGCCGGGCATGGTGG - Intergenic
1153290709 18:3499124-3499146 GAGGAGCGGCCGGGGGAGGAGGG + Exonic
1155145279 18:23078205-23078227 GTGGAGTGGACTGGGGAACAAGG - Intergenic
1155654400 18:28177295-28177317 GGGGAGGGGGCGGGGGAACAGGG + Exonic
1156258462 18:35422335-35422357 GAGGTTTGGGCCTGGGGAGAAGG + Intergenic
1156490609 18:37493677-37493699 GAGGTGGGGGAGGGGGAAGATGG + Intronic
1157301639 18:46483828-46483850 AAGCAGTGGGCCAGGGAACAGGG + Intronic
1157363319 18:47039412-47039434 GAGGAGAGGACTGGGGAGGATGG - Intronic
1157422162 18:47556273-47556295 GAGGAGTGGGCTGGTGAGGTGGG - Intergenic
1157537505 18:48470820-48470842 GAGGAGGGTCCTGGGGAAGAAGG + Intergenic
1157619290 18:49006799-49006821 GAGGAGGGGGCTGGGGAGCAGGG + Intergenic
1157753044 18:50195077-50195099 GAGGCGAGGGCCGGCGAGGAGGG + Exonic
1158004843 18:52660831-52660853 TAGGAATAGGCTGGGGAAGAAGG - Intronic
1158610357 18:58935080-58935102 GAGGAGTGGGGAGGAGGAGAAGG - Intronic
1158755023 18:60312996-60313018 GATGAGTGGGAGGGGAAAGAGGG - Intergenic
1158874718 18:61722521-61722543 GAGGAGGTGGGCGGGGGAGAAGG - Intergenic
1159115284 18:64106481-64106503 GAGGAATGGGCAGAGGGAGAGGG - Intergenic
1159868717 18:73736198-73736220 GCGGAGTGGGAAGGGGAGGAAGG + Intergenic
1159988296 18:74872140-74872162 GAGGAGGGGGGCGGGGCTGACGG - Intronic
1160125684 18:76169432-76169454 GAGGAGCGTGTCAGGGAAGAGGG + Intergenic
1160511722 18:79456691-79456713 GAGGAGCGGGCCGAGGAGGAAGG + Intronic
1160575127 18:79848848-79848870 GAGGAGTGGCCCCGGGCAGGTGG + Intergenic
1160811836 19:1016195-1016217 GAGGGGTGGGCGGGGGGAGGGGG + Intronic
1160975352 19:1790119-1790141 GAGGAAAGGGGAGGGGAAGAGGG - Intronic
1161007009 19:1941865-1941887 GAGCACTGGGTGGGGGAAGAAGG - Intronic
1161030778 19:2056821-2056843 GAGGAGGGGGAAGGGGAGGAGGG - Intergenic
1161101551 19:2424379-2424401 GAGGAGTGGCCTGGGGCAGTGGG - Intronic
1161313719 19:3608267-3608289 GAGGAGAGGGCATGGGAAGTGGG + Intergenic
1161346362 19:3770593-3770615 GAGGAGGGGGCCCGGGAGGGCGG + Exonic
1161370571 19:3908744-3908766 GAGGAGAGGGAAGGGGAAGAGGG - Intronic
1161403781 19:4080886-4080908 GAGGGGTGGGGAGGGGAAGGGGG + Intergenic
1161403859 19:4081086-4081108 GAGGAGGGGGCCGGGCATGGTGG + Intergenic
1161422317 19:4182598-4182620 GCGGGGCGGGGCGGGGAAGAAGG + Exonic
1161520051 19:4718791-4718813 GAAGAATGGACCGGGGAAGACGG - Intronic
1161924226 19:7289277-7289299 GAGGACTGGCCTGGGGAAGCTGG + Intronic
1162024201 19:7884537-7884559 GAGGAGGGGGAGGGGGAGGAGGG + Intergenic
1162024206 19:7884552-7884574 GAGGAGGGGGAGGAGGAAGATGG + Intergenic
1162024221 19:7884587-7884609 GAGGAGAGGGAGGAGGAAGATGG + Intergenic
1162024241 19:7884632-7884654 GAGGAGAGGGAGGAGGAAGATGG + Intergenic
1162024260 19:7884677-7884699 GAGGAGAGGGAGGAGGAAGATGG + Intergenic
1162237777 19:9321863-9321885 GAGGAGGAGGCGGGGGAGGAGGG - Intergenic
1162316532 19:9942198-9942220 GAGAAGTGGGTGGTGGAAGAAGG + Intergenic
1162384777 19:10354295-10354317 GAGGAGTGGCCCGGGAAATCGGG - Intronic
1162483131 19:10941084-10941106 GAGGAGTGGGGCAGGGAGGGAGG + Intergenic
1162697578 19:12488109-12488131 GAGGAGTGGGCCGGGCGTGGTGG - Intronic
1162789386 19:13055217-13055239 GAGGAGTGGGGAGGGGGGGAGGG - Intronic
1162947360 19:14052044-14052066 GAGGTGTGGGTCGGGGAGGCTGG + Intronic
1163005651 19:14395398-14395420 GAGGATCGGGCCTGGGACGATGG - Intronic
1163029894 19:14537213-14537235 GAGGAGGAGGCGGGGCAAGAAGG + Intronic
1163127453 19:15251875-15251897 GGGGAGGGCGCCTGGGAAGAGGG + Intronic
1163407471 19:17131884-17131906 GGGGGGTGGGGCGGGGAACAGGG + Intronic
1163441588 19:17324765-17324787 GAGGAGTGGGCCGGTGGACGAGG - Exonic
1163666803 19:18607189-18607211 GAAGATTGGGCCGTGGAAGGGGG - Intronic
1163804485 19:19387194-19387216 GAGGGGTCCCCCGGGGAAGAAGG - Intronic
1164844996 19:31424535-31424557 CAGGAGAGGGGTGGGGAAGAAGG - Intergenic
1164995925 19:32720350-32720372 GAGGAGTGGGCGTGGGGAGTAGG - Intronic
1165031087 19:32998791-32998813 GAGGAGAGGGGAGGGGAGGAGGG + Intronic
1165347685 19:35259064-35259086 GGTGAGTGGGCCTGGGAAGGGGG + Exonic
1165376797 19:35448754-35448776 GAGGAGGGTGGAGGGGAAGAAGG - Intronic
1165420848 19:35721223-35721245 GGGGAGGGGGCCGGGGGAGGTGG - Exonic
1165577934 19:36837742-36837764 GGGTAGAGGGCTGGGGAAGACGG - Intronic
1165997299 19:39853293-39853315 GAGGAGAGGGCCGGGCATGGTGG + Intergenic
1166304298 19:41928802-41928824 GAGGAGCGGGGCGGAGGAGAAGG - Intronic
1166356851 19:42232451-42232473 GGGGAGTGGGGCGGGGTAGGGGG - Intronic
1166658394 19:44628811-44628833 GAGGAGTGAGGCTGGGAAGCAGG + Intronic
1166698481 19:44867899-44867921 GAGGAGTGGACGGAGGTAGAAGG + Intronic
1166790493 19:45396104-45396126 GAGGAGTGGGGTGGGGGAGCGGG - Intronic
1166979292 19:46623414-46623436 GAGGAGTGGGGAGAGGAGGAGGG - Intronic
1167027807 19:46934357-46934379 GAGGGGCGGGGTGGGGAAGAGGG - Intronic
1167035674 19:46993856-46993878 GGGGCGTGGGCCGGGAGAGAAGG - Intronic
1167253942 19:48415963-48415985 GAGGAGTGGGCGGGGGAACCCGG - Intronic
1167298085 19:48663594-48663616 GAGGGATGGGCAGGGGCAGAAGG - Intronic
1167334039 19:48873711-48873733 GAGGAGAAAGCCGAGGAAGAGGG + Exonic
1167353762 19:48991544-48991566 GTGGGGTGGGCCGGGGATGTAGG + Intronic
1167400396 19:49263724-49263746 GAGGGGAGGGGCGGGGGAGATGG + Intergenic
1167488842 19:49780383-49780405 GAGGGGTGGCCCCAGGAAGAGGG + Intronic
1167517417 19:49931057-49931079 GAGTGGAGGGCAGGGGAAGATGG + Intronic
1167748221 19:51365354-51365376 AGGGAGTGGGCTGGGGAAGAGGG - Intronic
1168002898 19:53463408-53463430 TGGGAGTGGGCGGGGCAAGAGGG + Intergenic
1168137431 19:54360759-54360781 GAGGTGTGTGCAGAGGAAGAAGG + Intronic
1168160646 19:54508323-54508345 GAGGTGTGTGCAGAGGAAGAAGG - Intronic
1168230778 19:55029891-55029913 GGGGAGTGAGGCAGGGAAGAGGG + Intronic
1168248039 19:55124175-55124197 GAGGAGCAGCCTGGGGAAGAGGG - Intergenic
1168315259 19:55482213-55482235 GAGGAGGGGGCTGCGGCAGAGGG - Exonic
1168357712 19:55712847-55712869 GAGGAGTGGGAGGGGAAGGAGGG + Intronic
1168521378 19:57053521-57053543 ATGGCGTGGGACGGGGAAGAGGG - Intergenic
1168680761 19:58313825-58313847 GATGAGTGAGCTGGGTAAGAAGG - Intronic
925052080 2:823450-823472 GAGCTGTGGGCGGGGGAAGGAGG + Intergenic
925556301 2:5134663-5134685 GAGGAGTGGAGCAGGGAAGGAGG - Intergenic
925754909 2:7123991-7124013 GATGAGCGGGCAGAGGAAGATGG + Intergenic
926725437 2:15993912-15993934 GCTGAGTGAGCCGGGGAAGAGGG - Intergenic
926871166 2:17419211-17419233 AAGGAGTGGGTTGGGGGAGAAGG + Intergenic
927513319 2:23658088-23658110 GAGGAGTGGGCAGGAGAGGGAGG - Intronic
927846674 2:26475894-26475916 GAGGTGAGGGCCTGGGAGGAGGG - Exonic
927847393 2:26478590-26478612 GAGGGGTGGGCAGAGGAGGAGGG + Intronic
927969951 2:27299217-27299239 GAGGAGTGGGCAGGGGGAGGTGG - Intronic
928105819 2:28470034-28470056 GAGGAGGGGGAAGGGGAGGAGGG + Intronic
928280013 2:29937725-29937747 GAGGGGTGGGATGGGGATGATGG + Intergenic
930364647 2:50424167-50424189 GAGGAGGGGGAGGAGGAAGAGGG + Intronic
931205370 2:60140918-60140940 GAGGAGGGGGAAGAGGAAGAGGG - Intergenic
931214165 2:60226015-60226037 GAGCAATGGGGCCGGGAAGATGG + Intergenic
931321530 2:61177905-61177927 GAGGGGTGGGCGGGAGGAGAAGG - Exonic
931362015 2:61585795-61585817 GGGGAGTGGGACGGGGTGGAGGG + Intergenic
931621702 2:64217003-64217025 GAAGAGTGGGCCGGGCATGGTGG - Intergenic
931634280 2:64327807-64327829 GAGGAGTGGGGAAGGGAAGGAGG + Intergenic
932322542 2:70832838-70832860 GAGCACTGGGCCAGGGAGGATGG - Intronic
932402994 2:71495021-71495043 GGTGAGTGGGGAGGGGAAGAAGG + Intronic
932414426 2:71565051-71565073 GAGGAGTGGCCCTGAGAAGCAGG + Intronic
932421275 2:71602828-71602850 GATGGGTGGGCCGAGGTAGAGGG + Intronic
932657155 2:73620073-73620095 GGGGAGTGGGCATGGGAAAAAGG + Intergenic
932770857 2:74500051-74500073 CAGGGGTGGGGTGGGGAAGAGGG - Intronic
933159150 2:79005337-79005359 GAGGATTGTGCCAGGGAAAATGG + Intergenic
933453132 2:82482984-82483006 GAGGAGAGAGGAGGGGAAGAGGG - Intergenic
933741775 2:85539399-85539421 GAAGCGTGGGGCGGGGCAGAAGG + Intronic
933775213 2:85767557-85767579 GAGGGGAGGGGAGGGGAAGAGGG - Intronic
934968340 2:98742815-98742837 GAACAGTGGGCAGGGGAGGAAGG + Intergenic
934977791 2:98817187-98817209 GAGGAGCTGGGCGGGGGAGAGGG + Intronic
935232409 2:101110399-101110421 TGGGAGTGGGGCGGGGAAGAGGG - Intronic
935631618 2:105216925-105216947 GACAAGGGGGCCGGGGAGGAGGG - Intergenic
935695745 2:105769259-105769281 GAGGGGTGGGGCGGGGCAGCAGG - Intronic
935830187 2:106994138-106994160 GTGGGCTGGGCCAGGGAAGAGGG + Intergenic
936080497 2:109429580-109429602 GAGGTGTGGCCCGGGGAGGCTGG - Intronic
936246553 2:110833411-110833433 AAGGAGTGGGCTGGGGAGGCAGG + Intronic
937118169 2:119424349-119424371 GAGGAGGGGGCCTGGGACCAGGG + Intergenic
937303460 2:120857204-120857226 GAGGAGTGAGGTGGGGAGGAGGG + Intronic
937438581 2:121898404-121898426 GAGGGATGGGCAGGGGATGATGG + Intergenic
938100335 2:128493662-128493684 GGCGAGCGGGCCTGGGAAGAAGG - Intergenic
938183409 2:129206015-129206037 GAGGAGAGGGAAGGGGAGGAAGG + Intergenic
939480585 2:142742805-142742827 AAGGAGAGGGTGGGGGAAGAAGG - Intergenic
939825629 2:147012059-147012081 GAGGAGAGGGCCAGGAGAGAAGG + Intergenic
940802846 2:158152860-158152882 GAGGAGGGGGCAGAGCAAGATGG + Intergenic
942051619 2:172146127-172146149 AAGGCGTGGGCAGTGGAAGAGGG - Intergenic
942321619 2:174741357-174741379 GAGGAGTGGGAGGGGGAAAGAGG - Intergenic
942940081 2:181606341-181606363 GAGGAGGGGGAGGGAGAAGAGGG + Intronic
943460273 2:188164926-188164948 GAGGAGTAGCCTGGGGAGGAGGG + Intergenic
944021604 2:195112622-195112644 GAAGAGTGGGTGGGGGATGAGGG - Intergenic
944060060 2:195563131-195563153 GTGGAGAGGGCGGGGGAAGTGGG - Intergenic
944148571 2:196532685-196532707 GAGGAATGTGCCCTGGAAGATGG - Intronic
944217329 2:197269545-197269567 AAAGAGGGGGCAGGGGAAGAAGG + Intronic
944547335 2:200811560-200811582 GAGGAGGGGGCCGGCGGCGAGGG + Intronic
946157370 2:217815809-217815831 GAGGAGAGGCCTGGGGAAAAGGG - Intronic
946238639 2:218340798-218340820 CAAGGGTGGGCCAGGGAAGACGG - Intronic
946492227 2:220159960-220159982 GAGGAGTAGGAGGGGGAGGAGGG - Intergenic
946714545 2:222539505-222539527 GAGAAGTGGGAGGTGGAAGACGG - Intronic
947084652 2:226437442-226437464 GAGGACTGTACCAGGGAAGATGG + Intergenic
947935779 2:234002217-234002239 GAGGAGTGGGCAGAGGGAGGAGG + Intronic
948007533 2:234622655-234622677 TGGGAGTGGGCCTGAGAAGAGGG - Intergenic
948097407 2:235347334-235347356 GAGGAGTGGGCCAGAGACGCTGG - Intergenic
948601165 2:239108179-239108201 GAGGCCTGGGGCGGGGCAGAGGG + Exonic
948605862 2:239134360-239134382 GAGGTGGGTGCCGGGGAAAAGGG + Exonic
948720119 2:239894131-239894153 GAGGAGTGAGGCTGGGATGATGG - Intronic
948762533 2:240201070-240201092 GTGGTGTGGGAAGGGGAAGATGG - Intergenic
948803126 2:240441778-240441800 GAGGCTTGGGCCAGGGAAGCGGG + Intronic
949007531 2:241658230-241658252 TGGGAGTGGGGCGGGGAAGCAGG + Intronic
949045851 2:241872358-241872380 GAGGCCGGGGCCGTGGAAGAGGG - Exonic
1168765841 20:381219-381241 GAGGGGGCGGCCGGGGAAGGGGG + Intronic
1168799337 20:634304-634326 GAGGGGTTGGTCAGGGAAGAGGG + Intergenic
1169049149 20:2561765-2561787 GAGGAGGGGCCCATGGAAGATGG - Intronic
1169371345 20:5030600-5030622 GAGGGGTGGGCAGGGGAGCAGGG - Intergenic
1169521904 20:6382991-6383013 GAGGAGTGAGCGGGAGTAGAGGG + Intergenic
1170202638 20:13760845-13760867 GGGGTGGTGGCCGGGGAAGAGGG - Intronic
1170487738 20:16836612-16836634 GAGTAGGGGGCTGGGGGAGAAGG + Intergenic
1170562492 20:17569650-17569672 GAGGGGAGAGCCGGGGGAGAGGG - Intergenic
1170635568 20:18101261-18101283 GAGCTGGGGGCCTGGGAAGAGGG + Intergenic
1171459493 20:25290901-25290923 GAGGAGAGGGCAGGGGAGGGAGG - Intronic
1171459524 20:25290994-25291016 GAGGAGAGGGCAGGGGAGGGAGG - Intronic
1171795061 20:29560158-29560180 GAGGAGAAGGCAGGGGAAGTGGG - Intergenic
1172031555 20:31985442-31985464 GAGGAGCAGGCAGGGGAGGATGG + Intronic
1172097730 20:32468419-32468441 GAGGAGGTGGCCTGGGAAGCTGG - Intronic
1172100970 20:32483745-32483767 GAGGAGTGGGCACGGGGGGAAGG + Intronic
1172281359 20:33710374-33710396 GAGGAGGGGGTTGGGGAAGAGGG - Intronic
1172798040 20:37556806-37556828 GAGGAGAAGGACAGGGAAGATGG - Intergenic
1173058022 20:39635321-39635343 GAGTAGTGGGCCGGGCACGGTGG - Intergenic
1173212699 20:41048881-41048903 AAGGAGTGGGATGGGAAAGAAGG + Intronic
1173284157 20:41655340-41655362 GAGGATTGGGGTGGGGATGAGGG - Intergenic
1173609331 20:44355449-44355471 GAGGACAGGGCCGGAGCAGAAGG - Intergenic
1173681466 20:44885495-44885517 GAGGAGGTGGGCGGAGAAGAAGG - Intergenic
1173782963 20:45771780-45771802 GAGGAGCAGGGCGGGGGAGAAGG + Intronic
1173868656 20:46328686-46328708 GGGGAGTGGGAAGGGGAAGCGGG - Intergenic
1174049680 20:47759010-47759032 GAGGATGGGGGCAGGGAAGAGGG - Intronic
1174471837 20:50767354-50767376 GAGGGGAGGGGCGGGGGAGAGGG - Intergenic
1175013387 20:55763169-55763191 GAGGTGTGGGCTGGAGAAGACGG + Intergenic
1175066106 20:56290352-56290374 CAGGAGTGGGAATGGGAAGATGG + Intergenic
1175120114 20:56710680-56710702 GGGGAGTGGGAAGAGGAAGAGGG - Intergenic
1175496050 20:59415094-59415116 GATGGGAGGGCCGGGGAAGGAGG + Intergenic
1175553446 20:59831618-59831640 GAGGGGTGGGGCGGGGTAGGTGG - Intronic
1175692802 20:61077667-61077689 GGGAAGTGGCCCGGGGAAGAAGG - Intergenic
1175867984 20:62191577-62191599 GAGGAGTGAGGCTGGGGAGAGGG + Intronic
1175894096 20:62328474-62328496 GAGGGGCGGGACTGGGAAGAGGG - Intronic
1175941187 20:62538175-62538197 GAGGAGTGGTGCAGGGCAGAGGG + Intergenic
1175947189 20:62564400-62564422 GAGGAGTTTGCAGGGGAATAAGG + Intronic
1176336125 21:5601648-5601670 GAAGAGTGGGGCGGGGAGGGTGG + Intergenic
1176391632 21:6219300-6219322 GAAGAGTGGGGCGGGGAGGGTGG - Intergenic
1176469787 21:7096874-7096896 GAAGAGTGGGGCGGGGAGGGTGG + Intergenic
1176493348 21:7478652-7478674 GAAGAGTGGGGCGGGGAGGGTGG + Intergenic
1176507294 21:7659731-7659753 GAAGAGTGGGGCGGGGAGGGTGG - Intergenic
1176867671 21:14063032-14063054 GTGGAGTGGGGCGGGAAAGGGGG + Intergenic
1177908884 21:27005958-27005980 GAGGAGTGGGAGGGGGGTGAGGG - Intergenic
1178257309 21:31065970-31065992 CAGGAATGGGCAGAGGAAGAAGG + Intergenic
1178291678 21:31373873-31373895 GAGGAGTGGGGAGAGGAAGAGGG - Intronic
1178876068 21:36414898-36414920 GAGCGTTGGGCCGGGCAAGATGG - Intronic
1179509829 21:41865141-41865163 GAGGAGTGAGCCGGGGAGTGGGG - Intronic
1179574557 21:42299725-42299747 GAGGAGTGGGCAGGGGACAGGGG - Intergenic
1179646932 21:42781958-42781980 GAGGGGAGGGACGGGAAAGAGGG - Intergenic
1179884823 21:44309381-44309403 GAGGAGGGGGCGGGGCTAGAGGG + Intronic
1179955257 21:44734893-44734915 GAGGACGGGGCCGGGGCAGGCGG - Intergenic
1180060224 21:45381249-45381271 TGGGAGTGCGCTGGGGAAGAGGG + Intergenic
1180235623 21:46458031-46458053 CAGGACTGGGCGGAGGAAGAAGG + Intergenic
1180968734 22:19803863-19803885 GAGGAAAGTGCCGGGGAGGAGGG - Intronic
1181467572 22:23118461-23118483 GTGGGGCGGGGCGGGGAAGAGGG - Intronic
1181542209 22:23579600-23579622 GAGGAGTGGGAGGAGGAGGAGGG + Intronic
1181854234 22:25770814-25770836 GAGGAGATGGGAGGGGAAGAGGG - Intronic
1181883381 22:25999537-25999559 GAAGAGGGGGAGGGGGAAGAGGG - Intronic
1182113857 22:27743652-27743674 GAGGAGCAGGCTGGGGAGGAAGG - Intergenic
1182349367 22:29690465-29690487 GACAAGTGGGCAGGGGAAAAGGG + Intronic
1182571589 22:31243282-31243304 GAGGAGTGGGGCACGAAAGATGG + Intronic
1183105131 22:35610149-35610171 GAGGAGGGAGCTGGGGATGAAGG - Intronic
1183261243 22:36797312-36797334 GAGGACTGAGCCAGGGAAAAGGG + Intergenic
1183351218 22:37335676-37335698 GGGGAATGAGCCGGGGGAGATGG + Intergenic
1183362518 22:37390010-37390032 GGGGAGGGGGCCTGGGAAGCTGG + Intronic
1183464351 22:37972139-37972161 GAGGAGGGGGGAGGGGAAGGGGG + Intronic
1183522576 22:38303929-38303951 CAGGAGTGGACTGGGGGAGACGG - Intronic
1183621359 22:38974754-38974776 GAGGATGGGGCCAGGGCAGAAGG - Intronic
1184663843 22:45977367-45977389 GGGGACTGGGCGGGGGAAGAGGG + Intergenic
1184765260 22:46569019-46569041 GACAAGTGGGCCGGGCAGGAGGG + Intergenic
1184801981 22:46766821-46766843 GAGGTGTGGGCCGGGCACGGTGG - Intronic
1184822125 22:46917374-46917396 GAGGACTGGGCCTGAGAGGAGGG + Intronic
1185355557 22:50367467-50367489 GAGCAGTGGGCAGAGGATGAGGG + Intronic
949895011 3:8762198-8762220 GAGGGGTGAGGAGGGGAAGAGGG - Intronic
949961092 3:9313095-9313117 GAGGAGTGTGGCTGGGAACATGG - Intronic
949985596 3:9538178-9538200 GAGGAGGGAGCCCGGGAAGAAGG - Intronic
950468804 3:13172181-13172203 GAGGACTTGGCTGGGGAAGGAGG - Intergenic
950482684 3:13254399-13254421 GAGGTGTGGAGCAGGGAAGAGGG - Intergenic
950657969 3:14449083-14449105 CAGGAATGGGCCAGAGAAGAGGG + Intronic
952107535 3:30087587-30087609 GAGGAGGGGGAGGGGGAGGAGGG - Intergenic
953507392 3:43499468-43499490 GAGCATTGAGCAGGGGAAGAGGG + Intronic
953855655 3:46497592-46497614 GAGGAGAGGCACAGGGAAGAAGG - Exonic
953962053 3:47273811-47273833 GATGGGTGGGCAGGGGAACAGGG + Intronic
954117145 3:48473237-48473259 GGGGCGGGGGCCGGGGAGGAGGG + Intronic
954367367 3:50153831-50153853 GAGAAGTGGGAGGAGGAAGAAGG + Intergenic
954414093 3:50384545-50384567 GTGGGGTGGGCAGGGGGAGATGG - Intronic
954418315 3:50405160-50405182 AAGGAGTGGGACAGTGAAGAGGG + Intronic
954967670 3:54625576-54625598 GTGGAGCGGGCCAGGGAAGAGGG + Intronic
955161458 3:56468390-56468412 GAGAAGCGGGGCGGGGAACAGGG + Intergenic
955631376 3:60979189-60979211 GAGGAGAGAGACTGGGAAGAGGG - Intronic
955751607 3:62189678-62189700 GAGGAGGGGGCCTGTGAGGAGGG - Intronic
956657689 3:71568044-71568066 GAGGGGAGGGGAGGGGAAGAGGG + Intronic
956701622 3:71964244-71964266 GAGGAGCAGGCTGGGGAAAAAGG + Intergenic
957315938 3:78576810-78576832 GAGGAGTAGGCTGTGGCAGAAGG - Intergenic
957734955 3:84191887-84191909 GAGGAGTAGCCTGGGGAGGAGGG + Intergenic
958194814 3:90231065-90231087 CAGGAGTGGGCCGGGCATGGCGG + Intergenic
958688308 3:97427543-97427565 GAAGAGTGGGAGGAGGAAGAGGG + Intronic
959972352 3:112421606-112421628 GAGGAGCAGGCTGGGGAGGAAGG + Intergenic
960153664 3:114276046-114276068 GAGGAGGGGGCAGAGCAAGATGG - Intergenic
960374977 3:116889566-116889588 GAGAAGTGGGTCGGGGAAAGAGG + Intronic
960446345 3:117753581-117753603 GAGGAGTGGGTGGGGGAAAGAGG + Intergenic
960633132 3:119753800-119753822 GAAGAGTGGGAAGGGGATGAGGG - Intronic
960706912 3:120490848-120490870 GAGGAGTAGGCAGGGGAAGATGG - Intergenic
960943133 3:122947468-122947490 CAGGAGTGGGTGGGGTAAGATGG - Intronic
961080316 3:124021338-124021360 GAGGAGGGGGCAGGACAAGATGG + Intergenic
961171684 3:124801840-124801862 GAGGAGTGGGCTGGGGAGGGAGG - Intronic
961416590 3:126763320-126763342 GAGGAGGGGGAGGGAGAAGAGGG - Intronic
961522603 3:127475633-127475655 GTGGAGTGGGTGAGGGAAGAAGG - Intergenic
961812622 3:129530703-129530725 GAGGAGGGGGAAGGGGCAGAGGG - Intronic
962065713 3:131977821-131977843 GAAGAGTGGGAGGGGGATGAGGG - Intronic
962364916 3:134772498-134772520 GAGAAGAGGGGAGGGGAAGAGGG - Intronic
962406425 3:135104313-135104335 AATGAGTGGGCTGGGAAAGATGG + Intronic
962508358 3:136071994-136072016 GGGGAGGGGGCAGAGGAAGAAGG - Intronic
963505488 3:146179795-146179817 GAAGAGTGGGAGGGGGACGAGGG - Intergenic
964545634 3:157830432-157830454 GGGGAGAAGGCCGGGGGAGAAGG - Intergenic
964871608 3:161319262-161319284 GTGGACTGGGCGGGGGAAGTGGG + Intergenic
965105317 3:164346198-164346220 GAGGAGTGGCCTGGGGAGGAGGG + Intergenic
966594184 3:181711752-181711774 GAGGAGGGGGCAGGCGAGGAGGG - Intergenic
966877676 3:184332608-184332630 GAGCAATGAGCCTGGGAAGACGG + Intronic
967694355 3:192514593-192514615 GCGGAGAGGGCCCCGGAAGAAGG + Intronic
968138683 3:196238311-196238333 GAGGAGTGGGCAGAAGAAGGAGG - Exonic
968505974 4:971716-971738 GAGGGTGGGGCCGGGGCAGAAGG + Intronic
968740849 4:2331039-2331061 AAGGAGGGGGCTGGGGAGGAAGG + Intronic
968762237 4:2448728-2448750 GTGGAGTGAGGCAGGGAAGAGGG + Intronic
968763789 4:2457740-2457762 GAGGAATGAGCAGGGGAAGAAGG - Intronic
968890026 4:3363881-3363903 GAGGAGTGGGCGGGGGAAGCTGG + Intronic
968952017 4:3700245-3700267 GAGGAGTGGGGAGGGTAAGGAGG + Intergenic
968985629 4:3872876-3872898 GAGCAGGGGTCGGGGGAAGAGGG + Intergenic
969099005 4:4755068-4755090 GAGGACTTGGCGGGGGAGGAGGG + Intergenic
969149868 4:5160460-5160482 GAGGTGTGGGGAGGGGGAGAAGG - Intronic
969339175 4:6529636-6529658 GAGGACTGTGCCAGGGAAGAGGG - Intronic
969370307 4:6727617-6727639 GAGGAGGGGGAAGGGGAGGAGGG - Intergenic
969399190 4:6942671-6942693 GAGGAGTGAGGCGGGGAAGGCGG + Intronic
969454760 4:7294815-7294837 GAGGAGGGGGAGGGGGAGGAGGG - Intronic
969588831 4:8109724-8109746 GAGGGGTTGGCCTGGGAAGCAGG + Intronic
969600149 4:8171390-8171412 CAGGAGTGGGGCTGGGGAGAGGG - Intergenic
970243205 4:14030831-14030853 TAGGAGTTGGCCCAGGAAGATGG - Intergenic
970456298 4:16226809-16226831 CAGGAGCGGGCCGGGGATGGCGG + Intronic
970857603 4:20666985-20667007 GAGGAGTGGGCTGGGAAAAAAGG + Intergenic
971123275 4:23726066-23726088 GAGGAGCAGGCTGGGGAGGAAGG + Intergenic
971405858 4:26320605-26320627 GAGGAGGGGTCCTGGGAAAATGG - Intronic
971916157 4:32872364-32872386 AAGTAGTGGGCAGGGGAGGAGGG + Intergenic
972040865 4:34596265-34596287 GGGGAGTGGGGCGGGGGACAGGG + Intergenic
972127744 4:35790205-35790227 GAGGAGAGGGAAGGGGAGGATGG + Intergenic
972901084 4:43684251-43684273 GAGGAGTAGGAGGTGGAAGATGG + Intergenic
974173517 4:58295394-58295416 GAGGAGCAGTCTGGGGAAGAGGG + Intergenic
975950309 4:79762395-79762417 GAAGAGTGGGAGGGGGACGAGGG + Intergenic
976630964 4:87235900-87235922 GAGGAGGGTGCGGGGGAAGGGGG + Intronic
976704695 4:88008034-88008056 GAGGAGGTGGAAGGGGAAGAAGG + Exonic
978462908 4:108977232-108977254 GAGGAGTGAGGAGGGGCAGAGGG + Intronic
978605679 4:110476595-110476617 GAGGGGCTGGCCGTGGAAGAAGG - Exonic
978677141 4:111332553-111332575 GATGAGTGGGGATGGGAAGAGGG + Intergenic
979703927 4:123698159-123698181 GAGAGGAGGGCAGGGGAAGAGGG - Intergenic
980438779 4:132814689-132814711 GGGGTGGGGGCGGGGGAAGAGGG + Intergenic
980469680 4:133234545-133234567 CAGGAGTGGGCCAGGTAAGAGGG + Intergenic
980982773 4:139668613-139668635 GAGGAGGGGGAGGGGGTAGAGGG + Intronic
982564490 4:156971397-156971419 GGGGGGTGGGGCGGGGGAGAGGG - Intergenic
984222454 4:176994699-176994721 GGGGAGGGGGAAGGGGAAGAGGG - Intergenic
984290685 4:177789975-177789997 GAGGACTGGACTGGGCAAGATGG + Intronic
984340636 4:178452022-178452044 GAGGCGTGGTCAGGGGAATAAGG + Intergenic
984356694 4:178669289-178669311 GAGGTGTGGGAGGGGGATGATGG - Intergenic
984915436 4:184719014-184719036 GAAGAGAGGGCCGGAGAAGAGGG + Intronic
985141005 4:186840600-186840622 GAGGAGCGGGAGGGGGAAGAAGG - Intergenic
985652190 5:1112339-1112361 GGGGAGGGGGCCGGGGAGGGCGG - Intergenic
985825563 5:2188315-2188337 GAGGGGTGGGGTGGGGAGGAGGG - Intergenic
986330023 5:6711164-6711186 GAGGTGAGGGCAGGGGAAGAGGG + Intergenic
986773505 5:10994348-10994370 GAGGAGGGGGGCGGGGAAGGAGG + Intronic
986773512 5:10994367-10994389 GAGGAAGGGGCCGGGGAAAGAGG + Intronic
986773522 5:10994386-10994408 GAGGAGGGGGGCGGGGAACGAGG + Intronic
986773530 5:10994405-10994427 GAGGAACGGGGCGGGGAAGGAGG + Intronic
987269158 5:16287402-16287424 GAAGAGTGGTTTGGGGAAGATGG + Intergenic
987615098 5:20263009-20263031 GAGGGGAGGGAAGGGGAAGAAGG + Intronic
989688995 5:44118782-44118804 GAGGAGCAGCCTGGGGAAGAGGG + Intergenic
990589747 5:57249965-57249987 GAGGAGGGGGAGGGGGAAGGGGG - Intronic
990904731 5:60791943-60791965 GAGGACTGGGGAGGGGAAAATGG - Intronic
991216979 5:64166267-64166289 GCGGAGGAGGCCGGGGAAGGTGG + Intronic
991668743 5:69025943-69025965 GAGGAGTGGGTGGGAGAAGGTGG + Intergenic
992394570 5:76359014-76359036 GAGGAGCGGCCTGGGGAGGAAGG - Intergenic
992605116 5:78447972-78447994 GAGGAGAGGACGGGGGAGGAGGG - Intronic
993457362 5:88141724-88141746 GAGGCGGGGGCGGGGGAGGAGGG - Intergenic
993516240 5:88838707-88838729 GAGGAGTGGCAAGGGGAGGAGGG - Intronic
994216358 5:97142742-97142764 GATAAGTGAGCCTGGGAAGAGGG - Exonic
994330225 5:98496255-98496277 GAAGAGTGGGAGGGGGATGAGGG + Intergenic
994556835 5:101316568-101316590 GAGGAGCAGCCCGGGGAGGAGGG - Intergenic
994581830 5:101652489-101652511 GAGGAGTGTGCTGCAGAAGAAGG - Intergenic
994878377 5:105453443-105453465 GAGGAATGGGCAGTGGAAAAAGG + Intergenic
996325908 5:122273069-122273091 GAAGAGTGGGACGGGGGTGAGGG + Intergenic
996892188 5:128434613-128434635 AAGGAGAGGGACAGGGAAGAAGG - Intronic
996929782 5:128871927-128871949 GAGGAGAGGGCAGGGGAGGGAGG - Intronic
997257148 5:132437829-132437851 GAGGAGTGGGGTGGGGCAGAGGG + Intronic
997404935 5:133638265-133638287 GGGGAGTGAGGAGGGGAAGAAGG - Intergenic
997448309 5:133959829-133959851 GAGGAGTAGGCGAGGGATGAGGG + Exonic
997769766 5:136543662-136543684 GAGGAGCAGCCTGGGGAAGAAGG + Intergenic
997772730 5:136569382-136569404 GAGGAGCAGCCTGGGGAAGAAGG + Intergenic
997833714 5:137175204-137175226 TAGGAGTGGGCCTTGGAAAATGG + Intronic
997854208 5:137358522-137358544 GAGGAGTGGGGGAAGGAAGAGGG + Intronic
998228915 5:140346754-140346776 GAGGACTGGGCGGGAGGAGAGGG + Intergenic
998399858 5:141843028-141843050 GAGGAGAGGGCCAAGGAACAAGG + Intergenic
998623556 5:143820914-143820936 CAGGAGTGTGCCAGGGAAAAGGG - Intergenic
999216696 5:149941354-149941376 TAGGAGTTGGCCTGGGCAGAGGG + Intronic
999256251 5:150211402-150211424 GAGGAGTGGGAGAGGGAAGGAGG - Intronic
999467778 5:151823462-151823484 GGGGAATGGGATGGGGAAGAGGG - Intronic
999824977 5:155265229-155265251 GAGGAGTGTGGGTGGGAAGAAGG - Intergenic
1000448332 5:161352551-161352573 CAGGAGTGGGACTGGGGAGATGG + Intronic
1000451915 5:161399970-161399992 GAGGTGTGAGCAGGGGTAGATGG + Intronic
1000519502 5:162279425-162279447 GAGGAGCAGCCCGGGGAGGAGGG + Intergenic
1000844339 5:166260636-166260658 GAGGAGTGTCCCTTGGAAGATGG - Intergenic
1001244947 5:170098925-170098947 GGGGAGAGGGAGGGGGAAGAGGG + Intergenic
1001855337 5:175005526-175005548 CAGGTGTGGTCTGGGGAAGAAGG + Intergenic
1002102332 5:176863728-176863750 GAGGAGAGGGAGGGGGAAAAGGG - Intronic
1002617364 5:180464200-180464222 CAGGAGGGGGACTGGGAAGATGG - Intergenic
1002795666 6:469416-469438 GAGGAGGGGGACGGAGAGGAGGG - Intergenic
1002847623 6:961954-961976 GAGGGATGGCCTGGGGAAGAAGG - Intergenic
1003117020 6:3289711-3289733 TGGGAGGGGGCCAGGGAAGAAGG - Intronic
1003179598 6:3780468-3780490 GGGGAGCAGGCCGGGGAAGGAGG + Intergenic
1003402749 6:5804340-5804362 GATGACTGGGCTGGGGAAGCAGG - Intergenic
1003443495 6:6164757-6164779 GAGGGGAGGGGAGGGGAAGATGG - Intronic
1005022633 6:21432442-21432464 GAGGAATTGGCAGGGGAAGAGGG + Intergenic
1005207925 6:23426365-23426387 GAGGTGAGGGCTGGGGAAGGAGG - Intergenic
1005255376 6:23997261-23997283 GAGGAGGGGGAAGGGGAAGCAGG - Intergenic
1005871972 6:29981172-29981194 GCGGAGGGGGCGGGGCAAGAAGG - Intergenic
1005883028 6:30074760-30074782 GAGGAGGGGTCCTGGGAGGATGG - Intronic
1005929074 6:30467411-30467433 GAGGAGAAGGCCAAGGAAGAGGG + Intergenic
1006069863 6:31490549-31490571 GTGGAGGGGGCAGGGCAAGAAGG + Intergenic
1006254770 6:32821954-32821976 GGGGAAGGGGCTGGGGAAGAGGG + Intronic
1006387053 6:33737123-33737145 GAGGAGTGGGAGGGGGAGGAGGG - Intronic
1006402517 6:33826070-33826092 GAGGAGGGGGCAGAGAAAGAAGG - Intergenic
1007077262 6:39075633-39075655 GAGGATTGGGGTGGGGGAGACGG + Intronic
1007094556 6:39205297-39205319 GAGAAGTGGGCCTGGGGAGCAGG + Intronic
1007267889 6:40611018-40611040 TAGGAGGGGGCCGGGGCAGGGGG - Intergenic
1007754091 6:44087577-44087599 AAGGACAGGGCTGGGGAAGAAGG + Intergenic
1009383949 6:63066990-63067012 GAAGAGTGGGAGGGGGTAGAGGG - Intergenic
1009457046 6:63869795-63869817 GAGAAGTGGGTTGGGAAAGAAGG + Intronic
1009814661 6:68716684-68716706 AAGAAGTGGGCAAGGGAAGAAGG - Intronic
1010791532 6:80070502-80070524 CAGGAGTGGCACTGGGAAGAAGG - Intergenic
1010970817 6:82261376-82261398 GAGGAGTGGGTGGGGGTGGAGGG - Intergenic
1011185472 6:84670907-84670929 GAGGAGTGAGGTTGGGAAGAAGG + Intergenic
1011284052 6:85705426-85705448 GAGGTGTGGGCCGGTGAGCATGG + Intergenic
1011413584 6:87092568-87092590 GAGGAGAGGAGAGGGGAAGAGGG + Intronic
1011632350 6:89339569-89339591 GAGGGGTGGGGAGGGGAAGGGGG + Intronic
1012383280 6:98646425-98646447 GAGAAGTGGGGGAGGGAAGAAGG + Intergenic
1013721193 6:113030192-113030214 GAAGAGTGGGAGGGGGATGAGGG + Intergenic
1014129428 6:117813665-117813687 GAGGAGAGGGACATGGAAGAGGG + Intergenic
1014283322 6:119465964-119465986 GAGGAGTGGGCCTGAAGAGACGG + Intergenic
1014305590 6:119737165-119737187 GAGGAGTAGGCTGGGTAATAGGG + Intergenic
1014604387 6:123454130-123454152 GAAGAGTGGGAGGGGGACGAGGG + Intronic
1015113473 6:129619554-129619576 GGGGAGTGGGCAAGGGGAGAGGG + Intronic
1015288125 6:131508328-131508350 GAGGAGTAGCCTGGGGAGGAAGG + Intergenic
1015652766 6:135480973-135480995 ATGGAGTGGGCCGGGGGGGATGG - Intronic
1015938310 6:138424451-138424473 GAGGAGTGGGCCAAGAACGAAGG - Exonic
1016391776 6:143581824-143581846 GAGGGGTGGGGAGGGGAACAGGG - Intronic
1016520873 6:144945153-144945175 GAGGAGTGTGCCAGGGAAAGAGG - Intergenic
1016561140 6:145396269-145396291 GAGGAAGGAGCCCGGGAAGAAGG - Intergenic
1016834381 6:148462809-148462831 GAGGAGGAGTCTGGGGAAGAGGG + Intronic
1017068308 6:150550071-150550093 GAGGAGTGGGCTGGGAAGGAGGG + Intergenic
1017324663 6:153131271-153131293 GAGGAGGGGGAGGGGGAGGAGGG + Intergenic
1017637450 6:156456368-156456390 GAGGAGGGGGAGGGGGTAGAGGG - Intergenic
1017906669 6:158761259-158761281 GAGGAGGAGGGCGGGGAAGGAGG + Intronic
1018301833 6:162410867-162410889 GAGGACTGTGACAGGGAAGAAGG + Intronic
1018553776 6:165029107-165029129 GAGGAGGGGGCCCATGAAGAGGG - Intergenic
1018839569 6:167508204-167508226 GAGGAGGGGGATGGGGAGGAGGG - Intergenic
1018839663 6:167508444-167508466 GAGGAGGTGACAGGGGAAGAGGG - Intergenic
1018942764 6:168319950-168319972 GAGGAGGAGCCCGGGGGAGAGGG + Intergenic
1019049042 6:169169392-169169414 GAGGAGAGAGCGGGGGAGGAAGG + Intergenic
1019179287 6:170176686-170176708 GAGGAGCGGGCCGGGAAGGAGGG + Intergenic
1020032038 7:4940214-4940236 GAGGAGCGAGCCGGGGGAGCTGG - Intronic
1020404744 7:7819135-7819157 GAGGAGAGGGCCGGGCAAGGTGG - Intronic
1020833228 7:13116601-13116623 GATGAGGGGTCCGGGGAAGCAGG + Intergenic
1021941880 7:25686348-25686370 GAGGAGTGAGACCTGGAAGAAGG + Intergenic
1021970639 7:25962511-25962533 GAGGACTGGGACTGGGAGGAAGG - Intergenic
1022029156 7:26476521-26476543 AAGGAGTGAGCCAGGGAAAAAGG - Intergenic
1022302330 7:29113320-29113342 GAGGAGTGGGCTGAGGCATATGG + Intronic
1022496922 7:30859191-30859213 GAGGTGTGGGGCTGGGAAGAGGG + Intronic
1023534087 7:41189822-41189844 GTGGGGTGGGCAGGGAAAGAAGG - Intergenic
1023698982 7:42874656-42874678 GAGGAGCAGGCTGGGGAGGAAGG + Intergenic
1023795207 7:43786778-43786800 GAGCAGTGGGCACAGGAAGAGGG + Intronic
1024708227 7:51985180-51985202 GAGAAGTGCTCTGGGGAAGATGG + Intergenic
1025943315 7:66088994-66089016 GAGGGGTGGGACGGGGAGGAAGG - Intronic
1026360487 7:69598187-69598209 GGGGAGGGGGCGGGGGAGGAGGG + Intergenic
1026553965 7:71390335-71390357 GAAGAGTGGGCCGGTTCAGAAGG - Intronic
1027374556 7:77537244-77537266 GAGGAGGAGGGCGGGGAAGGAGG + Intergenic
1027464941 7:78503608-78503630 GAGGAGTGGGAGGGGAAGGAGGG - Intronic
1027679722 7:81205162-81205184 GAGGACTGGGCCGGGCATGGTGG + Intergenic
1027814713 7:82953710-82953732 GAGGAGGGGGAGGGGGAGGAGGG + Exonic
1028517764 7:91697451-91697473 TAGGAGTGGGTCAGGGAATATGG - Intronic
1028983564 7:96992891-96992913 GCGGAGTGGGCCGAGGCTGAGGG + Intergenic
1029113495 7:98224885-98224907 GAGGAGTGGGTCAGTGAGGATGG + Intronic
1029135319 7:98366402-98366424 GAGGACTGGGCCGCAGAAGGTGG - Intronic
1029348900 7:99998751-99998773 CAGGATGGGGCCGGGGAAGGTGG - Intergenic
1029420009 7:100467480-100467502 GAGGACAGGGCTGGGGCAGAGGG + Intronic
1029438965 7:100577051-100577073 GAGGAGTGGGGAGGGGATGCTGG + Intronic
1029466463 7:100728417-100728439 AAGGAGTCGGTCGTGGAAGATGG - Intergenic
1029500119 7:100923799-100923821 GAGGAGCAGCCTGGGGAAGAGGG - Intergenic
1029537171 7:101163603-101163625 GAGGAGGAGGACGGGGAAGCCGG - Exonic
1029540456 7:101179596-101179618 GAGGCAGGGGCCGAGGAAGATGG + Intronic
1029704913 7:102271092-102271114 GAGGTGTGCGCCTGGCAAGAGGG - Intronic
1030033202 7:105388141-105388163 CAGGCGGGGGCCGGGGAGGAAGG + Intronic
1030321318 7:108171369-108171391 GAGCAGTGGGCGGGGCCAGATGG - Intronic
1030730823 7:112986339-112986361 GAGGAGAGGGCCGGGGTAGGGGG + Intergenic
1030785407 7:113654310-113654332 GAGGAATGGGACTGGGAAGGAGG + Intergenic
1031214807 7:118877126-118877148 GAGGAGGGGGAAGAGGAAGAAGG + Intergenic
1031531970 7:122886544-122886566 GAGGATTGGGAGGGGGGAGAGGG + Intronic
1032238131 7:130141701-130141723 GAGCAGTGGGCGGGGGAGCAGGG - Intergenic
1033046485 7:137967089-137967111 GAGGAGTGGGAAGGAGAGGAAGG - Intronic
1033449144 7:141447502-141447524 GAGGCGTGGGCAGGGGCTGATGG + Intronic
1033615742 7:143012547-143012569 GAGGAGTGTGCAGGGGAGCATGG - Intergenic
1033969801 7:147025386-147025408 GAGGAAGGGGAGGGGGAAGAAGG + Intronic
1034071282 7:148188263-148188285 TAGGAGTGGGTCTGGGAGGATGG + Intronic
1034304620 7:150038995-150039017 GAGCCGGGGGGCGGGGAAGAGGG + Intergenic
1034422119 7:150995775-150995797 CAGGGGTGGGTCGGGGCAGAGGG - Intronic
1034422133 7:150995808-150995830 CAGGGGTGGGACGGGGGAGAGGG - Intronic
1034422147 7:150995841-150995863 TAGGGGTGGGACGGGGCAGAGGG - Intronic
1034531898 7:151701082-151701104 GAGGAGTGGGAGGTGGAAGGGGG - Intronic
1034635633 7:152565271-152565293 GAGGGGTGGGCTGGAGAACAGGG + Intergenic
1034649007 7:152675083-152675105 GAGCAGTGGGCAGGGTATGAAGG - Intronic
1034720736 7:153290090-153290112 GAGGAGGGGGTCGGGGGAGGGGG + Intergenic
1035021784 7:155804773-155804795 GCGCAGGGGGCCGGGGAGGAGGG + Intronic
1035072683 7:156156878-156156900 GTGGAGGGGGCCTGGGAAGAAGG - Intergenic
1035331293 7:158098853-158098875 GCGGGGAGGGCCGGAGAAGATGG + Intronic
1035476150 7:159145194-159145216 GGGGCGTGGGCCAGGGAAGAGGG - Intergenic
1035783610 8:2247224-2247246 GAGGAGGAGCCAGGGGAAGATGG + Intergenic
1035784278 8:2249275-2249297 GAGGAGGAGCCAGGGGAAGATGG + Intergenic
1035808514 8:2472362-2472384 GAGGAGGAGCCAGGGGAAGATGG - Intergenic
1036448740 8:8846324-8846346 GAGGAGTAGGAGGGGGAGGAGGG + Intronic
1036592953 8:10185416-10185438 GATGAGTGGGTGGGGTAAGATGG + Intronic
1036681199 8:10875576-10875598 GAGGATTGGTTTGGGGAAGAGGG + Intergenic
1037568866 8:20141630-20141652 GAGGAGGGGGGAGGGGGAGAAGG + Intergenic
1037950720 8:23017413-23017435 GAGGAGGCTGCCGAGGAAGACGG - Exonic
1038311732 8:26450131-26450153 GAGGCTTGGGCCTGGAAAGATGG + Intronic
1038312307 8:26453954-26453976 GAGGTGTGGACCTGGGAAGCTGG - Intronic
1038478143 8:27883391-27883413 GAGTAGTGGGGCGGGCAGGATGG - Intronic
1038764410 8:30414098-30414120 GAGGAGGGGGTGGGGGAGGAGGG - Intronic
1038768152 8:30449656-30449678 GAGGTGTGGGCCGGGCACGGTGG - Intronic
1039630362 8:39106141-39106163 GAGGGGTGGGGTGGGGAACAAGG - Intergenic
1040883058 8:52229463-52229485 AAGGAGTGGGCTGTGGAAGCTGG - Intronic
1041890621 8:62864243-62864265 GAGGAGGCGGCCGAGGCAGACGG + Intronic
1042904074 8:73755545-73755567 GAGGAGGGGGCTAGGGGAGAAGG + Intronic
1043512721 8:80965689-80965711 AAGCAGTGGCACGGGGAAGAAGG - Intergenic
1044014175 8:87030878-87030900 GAGGAGAGGGGAGGGGAAGGAGG - Intronic
1044983249 8:97736384-97736406 GAGGAGGGGGAGGGGGAGGAGGG + Intergenic
1044983265 8:97736412-97736434 GAGGAGGGGGAGGGGGAGGAGGG + Intergenic
1045164286 8:99586037-99586059 GAGGAGTGGGGAGTGCAAGAAGG - Intronic
1045455991 8:102379529-102379551 GTGGAGTGGTCAGGGTAAGAAGG - Intronic
1045491278 8:102671269-102671291 GAGAAGTGGGCTGGGGACCAGGG - Intergenic
1045562969 8:103283584-103283606 GAGGAGAGGGGAGGGGAGGAGGG - Intergenic
1046145950 8:110158636-110158658 GAGGGGAGGGGAGGGGAAGAGGG - Intergenic
1046707488 8:117471361-117471383 GTGGAGTGGGGTGGGGGAGAGGG - Intergenic
1046901996 8:119533748-119533770 GAGGAGTGGGCAAAGGATGAGGG + Intergenic
1047330203 8:123880146-123880168 TGGGAGTTGGTCGGGGAAGAGGG - Intronic
1047741744 8:127812154-127812176 GAGGGGAGGGGAGGGGAAGAGGG + Intergenic
1048007656 8:130432069-130432091 GAGGAGGGGGAGGGGGAAGGGGG + Intronic
1048332342 8:133479326-133479348 GAGGAGTGGGTGGGGGGTGAGGG + Intronic
1048572715 8:135668778-135668800 GAGAAGTGGGCTGGGGACCAGGG + Intergenic
1048927218 8:139281873-139281895 CAGGAGTGGGGCAGGAAAGAGGG - Intergenic
1049261336 8:141640778-141640800 GAGGAGTGGGAGGGAGAGGATGG - Intergenic
1049605834 8:143528809-143528831 GAGGACTGGACCTGGGCAGAAGG - Intronic
1049701090 8:144012996-144013018 GAGGAGAGGGCCAGGTAAGGAGG - Intronic
1049798127 8:144505708-144505730 GAGGAGTGGGGCGGGGCGGCGGG - Intronic
1050230990 9:3525986-3526008 GAGGGGTGGGGGAGGGAAGAGGG + Intronic
1050406017 9:5309453-5309475 GAGGACTGGGTTGTGGAAGAGGG - Intergenic
1051050310 9:12924673-12924695 GAGGAGTGGGGTGGGTAAGGAGG - Intergenic
1051468408 9:17406850-17406872 GGGGGGTGGGCAGGGGCAGAAGG - Intronic
1051633615 9:19162289-19162311 GAGGAGTGGGCCAGGCACGATGG + Intergenic
1051678005 9:19578088-19578110 GAAGAGTGGGAGGGGGACGAGGG + Intronic
1052918151 9:33939830-33939852 GAGGAGGGGGAGGGGGAGGAGGG + Intronic
1053188799 9:36042192-36042214 GAAGAGTGAGCGGGGGATGAGGG - Intronic
1053221410 9:36316131-36316153 GAGGAGAAGGAGGGGGAAGAGGG + Intergenic
1053411243 9:37917435-37917457 GAGCAATGTGCCCGGGAAGATGG + Intronic
1054720502 9:68598734-68598756 GAGGAGGGGGTAGGGGAAGAAGG + Intergenic
1054969895 9:71073004-71073026 AAGGAAGGGGCCGGGGAAGATGG - Intronic
1055234708 9:74106645-74106667 GATGAGTGGTTTGGGGAAGAAGG + Intergenic
1055485001 9:76748081-76748103 GAGAAGTGGGCCGGGCACGTTGG - Intronic
1056309916 9:85330016-85330038 GAAGAGTGGGAGGGGGATGAGGG + Intergenic
1056379793 9:86046941-86046963 GATGAGTCGGCCAGGGATGAGGG - Intronic
1056773152 9:89494277-89494299 GAGGAGAGGGAAGAGGAAGAGGG - Intronic
1056805003 9:89721645-89721667 GTGGGGTGGGCTGGGGAAGGTGG + Intergenic
1057007933 9:91576989-91577011 CAGGACTGGGCTGGGCAAGATGG - Intronic
1057222896 9:93267394-93267416 GAGGACGGGGACTGGGAAGAGGG - Intronic
1057308398 9:93925826-93925848 GAAGAGGGGGACGGGGGAGAGGG + Intergenic
1057423041 9:94927525-94927547 GAGGAGTCGGCCGGGGAGGAGGG - Intronic
1057812675 9:98269894-98269916 GAGGAGCAGCCTGGGGAAGAGGG + Intergenic
1057817137 9:98304121-98304143 GAGGCGTGGGATGGGGATGAAGG + Intronic
1057850709 9:98564957-98564979 GAGGACTGAGCCGGGGAGGAGGG + Intronic
1059282876 9:113149740-113149762 GCTGTGTGGGCCGGGCAAGATGG + Intergenic
1059384167 9:113950984-113951006 GAGGAGTGGGAGGGGAAAGGAGG + Intronic
1059587921 9:115626368-115626390 GAGAAGTGGGCCGTAGAAGCTGG + Intergenic
1059947359 9:119424134-119424156 GAGGAGTTGGAAGGGGAAGCAGG + Intergenic
1060389608 9:123267668-123267690 GAGGAGGGGGTCGGGGCAGGGGG - Intronic
1060438748 9:123618550-123618572 AAGGAGGGGGCTGGGGAAGGTGG + Intronic
1060839820 9:126784577-126784599 GAAAAGTGGGCCGGGGACGGCGG - Intergenic
1061208433 9:129177361-129177383 GAGGCGGGGGCCGGGGAGGCGGG + Exonic
1061224452 9:129272669-129272691 GAGGAGTTGCCCAGGGAAGGGGG - Intergenic
1061280808 9:129596968-129596990 GAGGAGGGCACCCGGGAAGAGGG + Intergenic
1061282030 9:129602914-129602936 GAGGAGAGGGGAGAGGAAGAGGG + Intergenic
1061327702 9:129874254-129874276 GAGGAGAGGGCCCTGGCAGAGGG + Intronic
1061382883 9:130268803-130268825 GAGGAGTGGAGCGGGAAAGTGGG + Intergenic
1061577972 9:131519489-131519511 GAGGAGCGGCCAGGGGAAGCTGG + Intronic
1061951839 9:133940570-133940592 GAGGAGTGGCCTGAGGCAGAAGG - Intronic
1062074733 9:134579753-134579775 GAGGAGGGGGAGGGGGAAGGGGG + Intergenic
1062179574 9:135184051-135184073 GAGGAGGGGCCCAGGGCAGAGGG + Intergenic
1062182158 9:135196487-135196509 GAGAAATGGGAAGGGGAAGAGGG - Intergenic
1062294109 9:135814621-135814643 GAGTGGTGGGTTGGGGAAGATGG - Intronic
1062469749 9:136697092-136697114 GAGGAGGGGGAGGGGGAAGGAGG - Intergenic
1062513924 9:136922723-136922745 GAGGACGGGGACGGGGAGGATGG + Intronic
1062551546 9:137089769-137089791 CAGGAGTGGGCCTTGGGAGAAGG + Intronic
1062581658 9:137231608-137231630 GAGGACAGGGCCGGGGCAGGAGG + Intronic
1062671119 9:137709983-137710005 CAGCTGGGGGCCGGGGAAGAGGG - Intronic
1062697923 9:137884876-137884898 GAGGAGGGGGAGGGGGAAGAAGG - Intronic
1062697944 9:137884951-137884973 GAGGAGGGGGGGGGGGAAGAGGG - Intronic
1203425517 Un_GL000195v1:33254-33276 GAAGAGTGGGGCGGGGAGGGTGG - Intergenic
1185511499 X:667945-667967 AAGGAGAGGGGAGGGGAAGAGGG - Intergenic
1185511651 X:668279-668301 GAGGGGAGGGGAGGGGAAGATGG - Intergenic
1185608423 X:1380426-1380448 GGGGAGGGGGAAGGGGAAGAGGG + Intronic
1185640523 X:1587866-1587888 GAGGAGAGGGGAGGGGAAGGGGG - Intergenic
1185640535 X:1587889-1587911 GAGGAGAGGGGAGGGGAAGTGGG - Intergenic
1185640545 X:1587912-1587934 GAGGAGAGGGGAGGGGAAGGGGG - Intergenic
1185640557 X:1587935-1587957 GAGGAGAGGGCAGGGGAAGGGGG - Intergenic
1185640569 X:1587959-1587981 GAGGAGAGGGCAGGGGAAGAGGG - Intergenic
1185640579 X:1587983-1588005 GAGGAGAGGGGAGGGGAAGGGGG - Intergenic
1185661943 X:1735255-1735277 GAGGAGGGGGAGGGGGAGGAGGG - Intergenic
1186609530 X:11125547-11125569 GCGGAGTGGGGCGGGGAATAAGG - Intergenic
1187464353 X:19514799-19514821 GGGGAGGGGGACGGGGGAGAAGG + Intronic
1187464571 X:19515543-19515565 GGGGAGGGGGCCGGGGAGGGCGG + Intergenic
1189069260 X:37847183-37847205 GAGGAGTGGGCATGGGGTGACGG - Intronic
1189254642 X:39628529-39628551 GAGGAGGAGGTGGGGGAAGATGG - Intergenic
1189386399 X:40540272-40540294 TGGAAGTGGGCAGGGGAAGAAGG - Intergenic
1189605425 X:42672584-42672606 GAAGAGTGGGCAGAGGGAGAGGG - Intergenic
1190948683 X:55120819-55120841 GAGGAGGGGGCTTGTGAAGAGGG + Intronic
1191805909 X:65133715-65133737 GAGGAGCAGCCTGGGGAAGAGGG + Intergenic
1192181057 X:68916118-68916140 CAGGACTGGGTCGGGGAAAAGGG - Intergenic
1192313528 X:70035043-70035065 CAGGGGTGGGCGGGGGAACAGGG + Intronic
1195255056 X:103082127-103082149 GAGGAGTGGGGCGAGGGGGAAGG + Intronic
1195831651 X:109065996-109066018 GGGGACGGGGCAGGGGAAGATGG - Intergenic
1195875387 X:109535244-109535266 GAGGGGAGGGGAGGGGAAGAGGG + Intergenic
1195909161 X:109872067-109872089 GAGGAGGAGGCAGGGGAAAATGG - Intergenic
1196049931 X:111294022-111294044 GCGGAGGGGGTGGGGGAAGAGGG + Exonic
1196196254 X:112840930-112840952 GAGTAGAGGGCGGGGAAAGAAGG + Intergenic
1197312594 X:124924345-124924367 GAGGATTGGACCTAGGAAGAGGG + Intronic
1197457610 X:126697221-126697243 GAGGAGGGGGTAGGGGAAGGGGG + Intergenic
1198586518 X:138128341-138128363 CAGGAGTGGACCTGGTAAGAGGG - Intergenic
1199461741 X:148093303-148093325 CAGGAGTGGACCTGGTAAGAAGG - Intergenic
1199487332 X:148362464-148362486 GAGGCATCGGCGGGGGAAGAAGG + Intergenic
1199649622 X:149939253-149939275 GAGGGGTGGGGCGGGGCTGAGGG + Intergenic
1199649816 X:149939815-149939837 GAGGAGCAGGCCGGGGCAGTGGG + Intergenic
1199767658 X:150952809-150952831 GAGGAATGGGCCAAGGAAAAGGG - Intergenic
1199818869 X:151424638-151424660 GAGGAGTGGGGGGGAGGAGAAGG + Intergenic
1200045094 X:153396934-153396956 GAGGATGGGGCCGGGGACGAGGG - Intergenic
1200158909 X:153994377-153994399 GAGGAGGGGGACGGGGAAGTGGG + Intergenic
1200656862 Y:5912700-5912722 GGGGAGGGGGAGGGGGAAGAAGG + Intergenic
1201763266 Y:17560211-17560233 AAGGGGTGGGCAGGGGCAGAGGG + Intergenic
1201838287 Y:18345779-18345801 AAGGGGTGGGCAGGGGCAGAGGG - Intergenic
1202093407 Y:21217592-21217614 GGGGAGTGGGAGAGGGAAGAGGG + Intergenic