ID: 912401636

View in Genome Browser
Species Human (GRCh38)
Location 1:109398038-109398060
Sequence TGAGGAGTGGGCCGGGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 827
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 759}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401636_912401644 -3 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401644 1:109398058-109398080 TCATTGGCTCGCGTCGCCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 25
912401636_912401649 12 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401636_912401646 4 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401636_912401647 5 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401636_912401652 18 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401636_912401645 3 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34
912401636_912401648 6 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401636 Original CRISPR TGAGGAGTGGGCCGGGGAAG AGG (reversed) Intergenic
900166033 1:1244744-1244766 TGAGGAGTGGGGGGAGGAGGGGG - Intronic
900166140 1:1245029-1245051 TGAGGAGTGGGGGGAGGAGGGGG - Intronic
900166317 1:1245534-1245556 GGAGGAGTGGCCCTGGGCAGTGG + Intronic
900389953 1:2429464-2429486 TGAGGAGTTGGCGGGTGATGTGG + Intronic
900596557 1:3482731-3482753 TGAGGTGTGGGCCCAGGCAGGGG + Intergenic
900631656 1:3639622-3639644 TCATCAGTGGGCCGGGGATGTGG - Intronic
900673250 1:3868822-3868844 AGAGGAGTGGGCCGAGGGCGTGG - Intronic
900921929 1:5678220-5678242 TGAGAAGTGGGGTGAGGAAGGGG + Intergenic
900936449 1:5769163-5769185 TGTGGGGAGGGCCGGGGAGGTGG - Intergenic
901056430 1:6450561-6450583 TGAGGAAAGGGCAGGGGCAGGGG + Intronic
901730041 1:11273000-11273022 TGAGGGGTGGGGCGGGGCTGAGG - Intergenic
902414770 1:16232192-16232214 TGAAGAGTGTGCCGGGGCGGCGG - Exonic
902477916 1:16697924-16697946 TGAGGAAAGGGCAGGGGCAGGGG - Intergenic
902653831 1:17854012-17854034 TGAGGAGTAAGACAGGGAAGAGG + Intergenic
902689723 1:18103059-18103081 CGAGCTGTGGGCTGGGGAAGGGG - Intergenic
902851620 1:19162443-19162465 GGAGGAGTTGGCGGTGGAAGAGG - Exonic
903227442 1:21901858-21901880 TTGGCAGTGGGCAGGGGAAGGGG - Intronic
903349669 1:22710430-22710452 GGAGGGGAGGGCGGGGGAAGGGG - Intergenic
904008191 1:27374688-27374710 TGAGGAGTGGGTTGGTGAGGAGG + Intronic
904028281 1:27518637-27518659 GGAGGAGTAGGCCAGGGCAGAGG + Intergenic
904034065 1:27549799-27549821 TGCTGAGTGGGCCGGGGATAAGG - Exonic
904094281 1:27965561-27965583 GGAGGAGTAGGCCGGGGAAGTGG + Intronic
904334376 1:29787360-29787382 TGAGGAGGGGCCCTGGGGAGGGG + Intergenic
904347052 1:29879391-29879413 TGAGGAGTGAGTGGGGGGAGGGG - Intergenic
904351538 1:29910187-29910209 CCAGGAGTGGGTCGGGGAGGGGG + Intergenic
904411658 1:30328559-30328581 TGAGAAGTGGCCCAGGGAACTGG - Intergenic
904433420 1:30479476-30479498 GGAGGGGTGGGCTGGGGGAGGGG - Intergenic
904433443 1:30479530-30479552 GGAAGAGTGGGCTGGGGGAGGGG - Intergenic
904433479 1:30479614-30479636 GGAAGGGTGGGCTGGGGAAGGGG - Intergenic
904447748 1:30588553-30588575 TGAGGAGTGAGTTGGGGGAGGGG + Intergenic
904499868 1:30907830-30907852 AGGGCAGTGGGCCCGGGAAGGGG - Intronic
904532966 1:31181472-31181494 GGAGGAGTGGGGCGGGGCGGGGG - Exonic
904533045 1:31181773-31181795 GGAGGAGTGGGCAGGGCAACCGG - Intronic
904534120 1:31188012-31188034 AGAGGAGTTGGCTTGGGAAGGGG + Intronic
904686799 1:32266641-32266663 TGAGGAGGGGGAGGAGGAAGAGG - Intronic
905030741 1:34882849-34882871 TGTGGAGTGGGGCAGGGGAGTGG - Intronic
905171322 1:36111378-36111400 TGGAGAGTGGGCAGAGGAAGTGG - Intronic
905209298 1:36362380-36362402 ACAGGAGTGGGCCAGGCAAGGGG + Intronic
905298576 1:36970684-36970706 AGTGGAGTGGGCTGGGGAAGAGG - Intronic
906316824 1:44791787-44791809 TGAGGAGGGGACAGGGGAATGGG - Intergenic
906438893 1:45822916-45822938 TGAGCAGTGAGACGGGGAACAGG - Intronic
907268317 1:53276025-53276047 TGAGGAGTGGCCCTGGAGAGAGG - Intronic
907319698 1:53594666-53594688 TGAGGAGGAGGCTGGGGAGGTGG + Exonic
907580856 1:55571480-55571502 TGGGGAGAGGGACGGGGATGGGG - Intergenic
907805882 1:57819457-57819479 TAAGGAGTGGGTGGAGGAAGTGG + Intronic
908738930 1:67307748-67307770 TGAGGATCGGGCCGGGGCGGGGG - Exonic
912401636 1:109398038-109398060 TGAGGAGTGGGCCGGGGAAGAGG - Intergenic
913056016 1:115160080-115160102 GGAGGGGAGGGCAGGGGAAGGGG + Intergenic
913196169 1:116458011-116458033 GGAGGGGTGGGCTGGGGAGGGGG - Intergenic
913198242 1:116475600-116475622 TGAGGAGTGGCCAGGGGCAAAGG + Intergenic
913465314 1:119135299-119135321 TGTGGAGTGGGGCGGGTAATGGG + Intronic
913667293 1:121060036-121060058 TGTTGATTGGGCAGGGGAAGGGG + Intergenic
913720983 1:121594325-121594347 TGAGGGGGGGGGCAGGGAAGTGG + Intergenic
914018983 1:143847179-143847201 TGTTGATTGGGCAGGGGAAGGGG + Intergenic
914657534 1:149755386-149755408 TGTTGATTGGGCAGGGGAAGGGG + Intergenic
914681672 1:149943400-149943422 TGAGAAGTGTGGAGGGGAAGTGG - Exonic
914753940 1:150552708-150552730 TGGGGAGTTGGCAGGGGAGGTGG - Intronic
915032878 1:152899207-152899229 TGAGGAGTGGGGAGGTGAGGTGG + Intergenic
915143221 1:153779482-153779504 TGAGGGGCCGGCGGGGGAAGTGG - Intronic
915166598 1:153951491-153951513 TGAGGGGTGGCCCAGGGAGGTGG + Exonic
915229113 1:154432786-154432808 TGAGGAAAGAGCAGGGGAAGTGG + Intronic
915555844 1:156660236-156660258 TGAGGAGGCGGGAGGGGAAGGGG + Intergenic
915572430 1:156751748-156751770 GGAGGAGTGGGTCCGGGAGGAGG - Intronic
915584142 1:156834796-156834818 TCAGGAATGGGCCGGGGAGACGG + Intronic
915722180 1:157993597-157993619 AGAGGAGCGGGCTGGGGAGGAGG - Exonic
915935422 1:160087721-160087743 GGAGGAGGGGGCGGGGGAGGGGG + Exonic
916144532 1:161727114-161727136 TGAGGAGGAGGGCGGCGAAGGGG - Intronic
916412480 1:164559613-164559635 TGAGGAGGGGGAGGGGGAGGGGG - Exonic
916951956 1:169789675-169789697 TGAGGAGTAGGGAGGGGAATGGG + Intronic
917212152 1:172642232-172642254 TGAGGAGGGGTCTGGGGAGGGGG - Intergenic
918082462 1:181218086-181218108 TGAGGTGTGAGCTGGGAAAGAGG + Intergenic
919169127 1:193931433-193931455 TGAGCAGTCGGCCGGGCATGTGG - Intergenic
919920268 1:202163110-202163132 GGAGGAGCTGGCTGGGGAAGTGG + Intergenic
920060650 1:203224931-203224953 TGAGGTGTGGTCAGGGGAAAGGG - Intronic
920070074 1:203296464-203296486 TGAGGTGGGAGCTGGGGAAGGGG - Intergenic
920166356 1:204038993-204039015 TGAGGCATGGGGCAGGGAAGTGG - Intergenic
920657448 1:207887411-207887433 AGAGGAGGGGGTAGGGGAAGGGG + Exonic
920737321 1:208544676-208544698 GGAGGAGTGGGGTGGGGAGGTGG + Intergenic
921260071 1:213378506-213378528 TGAGCAGAGGGCAGGGAAAGTGG + Intergenic
921695455 1:218204053-218204075 TGAGGATTGGGCAGGGGCAGGGG - Intergenic
921949775 1:220917420-220917442 TCAGGGGTGGGGCGGGGAGGGGG - Intergenic
922028419 1:221775198-221775220 TGAGGAGTGGGCAGGTTCAGAGG - Intergenic
922046296 1:221949222-221949244 TGAGGAGTGGCCTTGGGAGGGGG - Intergenic
922238949 1:223742964-223742986 AGGGGAGGGGGCCTGGGAAGAGG - Intronic
922402785 1:225277113-225277135 GGGGGAGGGGGACGGGGAAGGGG + Intronic
922471595 1:225880428-225880450 TGAGGAGAAGGCAGGGGGAGGGG + Intronic
922813255 1:228430214-228430236 TGCAGAGTGGGCCAGAGAAGTGG - Intergenic
923211977 1:231811663-231811685 TGAGGATTGGGCAGGTGAAAGGG + Intronic
923402583 1:233629359-233629381 GGTAGAGTGGGCCGGGGAAGAGG + Intronic
923979142 1:239301418-239301440 TGAGGAGTGGAGCTGGGAACAGG - Intergenic
924052667 1:240093198-240093220 GGAGGAGTGGGCCCCGGAGGTGG + Exonic
924281222 1:242439236-242439258 TGGGGAAGGAGCCGGGGAAGGGG + Intronic
924359604 1:243223688-243223710 TGAGGAGTGGGCCTGTTATGTGG + Intronic
924414942 1:243849746-243849768 TGCGCAGCGGGCCGGGGGAGGGG - Intronic
924672993 1:246147950-246147972 AGAGGAGAGGGGCTGGGAAGCGG - Intronic
1062763877 10:47065-47087 TGAGGAGTATGCCGAGGAGGAGG - Exonic
1063707028 10:8440540-8440562 TGAGGAGTGGGGTGGGAAGGAGG - Intergenic
1064245009 10:13661337-13661359 TGAGCAGTGGGCAGGCAAAGAGG + Intronic
1064420541 10:15186941-15186963 TGTGGAGTGGGCTGGTGAGGAGG + Intergenic
1064432760 10:15285436-15285458 TGAAGAATGGGCTGAGGAAGAGG + Intronic
1066346422 10:34591145-34591167 TGTGGAGTGGGATGGGGAGGGGG - Intronic
1067031929 10:42884164-42884186 AGAGCAGTGGCCTGGGGAAGGGG + Intergenic
1067084386 10:43230120-43230142 TGAGGCCGGGGCCGGGTAAGAGG - Intronic
1067352023 10:45485033-45485055 GGAGGCCTGGGCCTGGGAAGTGG + Intronic
1067804461 10:49383366-49383388 GCAGGAGTGGGCCATGGAAGGGG + Intronic
1067844573 10:49709697-49709719 TGGGCAGTGGGCCAGGGAACAGG - Exonic
1068655821 10:59575536-59575558 GGAGGAGTGGGCAGGTGAAGGGG + Intergenic
1069970816 10:72167445-72167467 TGAGGAGTGGGGCGGCAAACAGG + Intronic
1070329954 10:75409587-75409609 TGAAGAGTGGGCCGAGGGAGGGG + Intergenic
1070626294 10:78053660-78053682 GCAGGAGCGGGCCGGGGATGGGG + Intronic
1070628462 10:78067771-78067793 TGGGGACTGGGCCAGGGCAGGGG + Intergenic
1070829398 10:79409449-79409471 TGAGGAGAGGGCAGGGAAGGAGG - Intronic
1070839674 10:79475411-79475433 TGAGGGGTGGGCAGAGGGAGAGG + Intergenic
1072102307 10:92240225-92240247 TGAGGAGAGGGGCGTGGACGGGG + Exonic
1073184715 10:101608984-101609006 TGGGAAGTGGGCAGGGAAAGAGG - Intronic
1073627819 10:105117990-105118012 TAAAGAGTGGGCAGAGGAAGAGG - Intronic
1074369289 10:112886634-112886656 TGAGGAGGGGGCAGAGGAGGAGG - Intergenic
1074377119 10:112950038-112950060 GGAGGAGTGTGCAGGGGGAGCGG - Intergenic
1074542231 10:114374487-114374509 TGAGGCCAGGGCTGGGGAAGGGG - Intronic
1074711737 10:116183614-116183636 AGAGGAGAGGGCTGGGGAAAGGG - Intronic
1075123633 10:119682311-119682333 TGAAGAGAGGGCAAGGGAAGAGG - Intergenic
1075294182 10:121258973-121258995 TGGAGAGTCGGCCTGGGAAGAGG + Intergenic
1075698065 10:124450070-124450092 TGGGGAGGGGGGCGGGGAGGCGG + Exonic
1076672873 10:132132785-132132807 TGGGGAGTGGGCCTGGGCTGGGG + Intronic
1077058710 11:608422-608444 TGTGGAGCGGGACCGGGAAGGGG - Exonic
1077321885 11:1946494-1946516 TGAGGACTGGGCCTTGGACGGGG + Intergenic
1077374075 11:2197460-2197482 GGAGGAGAGGGGCTGGGAAGGGG + Intergenic
1077590698 11:3488827-3488849 CGAGGAGTGGGGCTGGGAAGTGG + Intergenic
1077839752 11:5961218-5961240 TGGGGTGGCGGCCGGGGAAGAGG - Intergenic
1077987192 11:7365049-7365071 TGCGGGGTGGGCCTGGGAGGAGG - Intronic
1078121422 11:8513943-8513965 TGTGGGGTGGGGTGGGGAAGTGG - Intronic
1078168541 11:8911209-8911231 TGACGAGTGAGCCGGGTGAGGGG + Exonic
1078442851 11:11381681-11381703 TAATGACTGGGCTGGGGAAGAGG - Intronic
1078470381 11:11581529-11581551 TGGGGAGGGGGCAGGGGAGGAGG - Intronic
1078594524 11:12674759-12674781 CGAGCAGAGGGCGGGGGAAGCGG + Exonic
1078679819 11:13464971-13464993 GGAGGAGTGGGGCGGGGGTGGGG - Intergenic
1078811708 11:14774565-14774587 AGAGGAGTGGGAGGGAGAAGAGG - Intronic
1078913788 11:15758664-15758686 TGGGGAGGGGGCGGGGGGAGGGG - Intergenic
1079119799 11:17673743-17673765 AGCTGAGTGGGCTGGGGAAGGGG - Intergenic
1079129410 11:17738606-17738628 GGAGGAGAGGGCCAGGGGAGGGG - Intronic
1079503888 11:21132766-21132788 TGAGCAGTGGGGTGGGGGAGGGG + Intronic
1079645874 11:22863492-22863514 TGATGACAGGGCTGGGGAAGAGG + Intergenic
1080809559 11:35689795-35689817 TGAGGACTGGGCAGGGGGAAGGG - Intronic
1081268955 11:41060980-41061002 TGTGGAGGGGGGAGGGGAAGGGG - Intronic
1081534093 11:43984910-43984932 AGAGGAGTGGCCCTGGGCAGGGG + Intergenic
1081674942 11:44963254-44963276 TCAGGCCTGGGCTGGGGAAGGGG + Intergenic
1081990581 11:47335262-47335284 AGAGGAGTGGGCAGTGGGAGTGG - Intronic
1082759655 11:57115077-57115099 TGAGGAAGGGACCAGGGAAGAGG + Intergenic
1082933831 11:58636460-58636482 TGAGGAGTGGGCCTAGAAGGTGG + Intergenic
1083275625 11:61595492-61595514 TGAGGGGGGGGTTGGGGAAGAGG - Intergenic
1083621027 11:64049500-64049522 GGAGGTGTGGCCTGGGGAAGGGG - Intronic
1083741686 11:64714595-64714617 TGAGGCTGGGGCCTGGGAAGGGG - Intronic
1084006272 11:66325151-66325173 TGGGGAGTGGGCCGGGTGGGAGG + Intergenic
1084246419 11:67860612-67860634 CGGGGAGTGGGGCTGGGAAGTGG + Intergenic
1084551240 11:69843384-69843406 AAAGGAGTGGGCAGGGGAAGGGG + Intergenic
1084560018 11:69899358-69899380 CGAGGAGAGAGCAGGGGAAGTGG + Intergenic
1084826262 11:71733889-71733911 CGTGGAGTGGGGCTGGGAAGTGG - Intergenic
1084964785 11:72738922-72738944 TGGTGACTGGGCCGGGGAGGGGG - Intronic
1085527742 11:77173939-77173961 TGAGGACTGGGCCGAGGGAAGGG - Intronic
1085621907 11:78044131-78044153 TGGGGTGTGGGCTGGGGAACAGG - Intronic
1085753967 11:79188661-79188683 TGAGGATGGGGATGGGGAAGAGG + Intronic
1086863239 11:91949737-91949759 TGGGGAGTGGGCCGAGGAGGAGG - Intergenic
1087672712 11:101127415-101127437 TGAGGTGAGGGCCCGGGACGGGG - Exonic
1088087380 11:105997187-105997209 GGAGGAGGGGGAAGGGGAAGAGG + Intronic
1088089560 11:106022155-106022177 GGAGGAGGCGGCCAGGGAAGCGG - Exonic
1088305570 11:108404038-108404060 TGACAAGTGGTCTGGGGAAGAGG - Intronic
1088308341 11:108433983-108434005 TGACAAGTGGTCTGGGGAAGAGG + Intronic
1088551432 11:111017232-111017254 TGGTGAGTGGGCTGAGGAAGTGG + Intergenic
1088782507 11:113149434-113149456 TGAGGACAGGGCAGAGGAAGTGG + Intronic
1088888303 11:114024872-114024894 TTTGGAGTTGGCCTGGGAAGAGG + Intergenic
1089096284 11:115922701-115922723 TGAGGAGAGGGCAGGGCAAGAGG - Intergenic
1089216637 11:116838049-116838071 GGAGGACAGGGCGGGGGAAGGGG - Intergenic
1089602983 11:119626554-119626576 TGGGGAGAGTGCAGGGGAAGGGG + Intronic
1089619330 11:119713515-119713537 TGGGGAGGGGGCAGGGGAAGGGG - Intronic
1090060521 11:123460708-123460730 ACAGGAGTGGGGCAGGGAAGGGG + Intergenic
1090190879 11:124767100-124767122 TGAGGGGTGGTCCGGGTAATGGG + Exonic
1090393591 11:126405326-126405348 TGAGGACTGTGCATGGGAAGGGG - Intronic
1091135883 11:133189014-133189036 TGAGGAGTGGGGAGTGGCAGGGG - Intronic
1091225732 11:133955884-133955906 GGAGGGGAGGGGCGGGGAAGGGG - Intronic
1091275394 11:134346202-134346224 TGAGAAGTGGCCCTGGGTAGTGG - Intronic
1202804901 11_KI270721v1_random:1807-1829 TGAGGACTGGGCCTTGGACGGGG + Intergenic
1091396571 12:157154-157176 TGGGGAGTGGAGCTGGGAAGCGG - Intronic
1091408521 12:223973-223995 AGAGGTGAGGGCCTGGGAAGCGG - Exonic
1091435640 12:470569-470591 TGAGTAGAGGGCCTGGGAAAGGG + Intronic
1091456244 12:610267-610289 TGGGGACTGGGCAGGTGAAGAGG - Intronic
1091796379 12:3299631-3299653 TGAGGTGGGGACAGGGGAAGAGG - Intergenic
1091801078 12:3324838-3324860 TGAGGATGGGGCCGGGCAGGAGG + Intergenic
1091823571 12:3493215-3493237 TCAGGTGGGGGCTGGGGAAGAGG - Intronic
1091875762 12:3931695-3931717 TGAGGGGTGGGCTGGGGGTGGGG - Intergenic
1092416981 12:8297734-8297756 CGGGGAGTGGGGCTGGGAAGTGG + Intergenic
1092754789 12:11753224-11753246 TGAGGACTGAGACGGGGAAGTGG - Intronic
1093234070 12:16584578-16584600 GGAGGAGTGGGGGGGGTAAGAGG + Intronic
1093370202 12:18356024-18356046 TGAGGAGTGGCCTTGGCAAGAGG + Intronic
1095469990 12:42526369-42526391 TGAGGAGTTGGCGGGGGCAGAGG + Intronic
1095662719 12:44756500-44756522 TGGGGAGTGGGTGGGAGAAGGGG - Intronic
1095723441 12:45426552-45426574 TGAGGGGAGGGTTGGGGAAGTGG - Intronic
1095862727 12:46936383-46936405 TGAGGAGTAGGAAAGGGAAGAGG + Intergenic
1096059247 12:48682427-48682449 AGGAGAGTGAGCCGGGGAAGGGG + Intergenic
1096155510 12:49339363-49339385 TGAGGAGTGTGGCTGGGCAGAGG - Intergenic
1096465862 12:51847644-51847666 AGAGGAGGAGGCCTGGGAAGGGG - Intergenic
1096478854 12:51924721-51924743 TGAGGCCTTGGCAGGGGAAGGGG - Intergenic
1096801639 12:54114307-54114329 TGAGGAGAAGGCAGGGGAGGTGG + Intergenic
1096803706 12:54127617-54127639 TGCGGGGTGGCCTGGGGAAGTGG + Intergenic
1097019202 12:56007828-56007850 GGAGACGTGGGCGGGGGAAGGGG + Intronic
1097196156 12:57243411-57243433 TGAGGAGAGGGCCTGCGGAGGGG - Intergenic
1097232942 12:57523092-57523114 TGGGGATGGGGCCGGGGAAAGGG - Intronic
1097270250 12:57769639-57769661 TGAAATGTGGGTCGGGGAAGAGG + Exonic
1099439941 12:82687205-82687227 TGAGGAGTGGGACTCGGAGGAGG - Exonic
1100306285 12:93352795-93352817 TGGGGAGTGGGCCGGTGCAGTGG + Intergenic
1101244991 12:102876769-102876791 TGAGTAGAGGGCCGGGGTGGGGG - Intronic
1101334754 12:103786468-103786490 TCAGAGGTGGGCTGGGGAAGGGG + Intronic
1102005311 12:109585965-109585987 TGAGGAGTGGGGCTGGGGAGGGG - Intronic
1102033753 12:109759426-109759448 TGAGGAGGGGGCAGGGCAGGCGG - Intronic
1103120117 12:118372975-118372997 TGGGGCGTGGTCCGGGGCAGGGG - Intergenic
1103979351 12:124726540-124726562 AGAGCAGTGGGCTGTGGAAGTGG - Intergenic
1104030941 12:125065508-125065530 TGAGGCGAGGGCCGGGGACCTGG - Exonic
1104399798 12:128465911-128465933 TGAGGAGAGGCCCGGGGATAAGG + Intronic
1104508550 12:129355425-129355447 GGAGGGGTGGGTGGGGGAAGCGG + Intronic
1104560638 12:129840681-129840703 TCTGGAGTTGGCCTGGGAAGCGG - Intronic
1105241127 13:18610264-18610286 GGAAGAGTGGGGGGGGGAAGGGG + Intergenic
1105389080 13:19958786-19958808 AGGGGGGTGGGCCGGGGGAGGGG + Exonic
1105501696 13:20978665-20978687 TGTGGAGTGGGCTGAGGAAGGGG - Intronic
1105890310 13:24677890-24677912 TGGGGAGCGGGGAGGGGAAGTGG - Intergenic
1106407413 13:29485923-29485945 TGGGGTGGGGGCGGGGGAAGCGG + Intronic
1110775656 13:79405837-79405859 GGAGGAGGGGGCGGGGGCAGCGG - Exonic
1111827038 13:93280766-93280788 TGTGGACAGGGCCGGGGATGCGG + Intronic
1111876377 13:93902213-93902235 TGAGGAGGGGAGAGGGGAAGGGG - Intronic
1112354321 13:98661391-98661413 TGGGGAGTGGGCCAGGGAGAAGG + Intergenic
1112398152 13:99052275-99052297 TGAGTAGTGGGCCAGGGGTGAGG - Intronic
1113554034 13:111216722-111216744 AGAGGGGTGGGCCGGGGCTGAGG + Intronic
1114539379 14:23443376-23443398 TGAGGAATGGTCCAGGGGAGGGG + Intergenic
1114741306 14:25100525-25100547 TGAGGGGTGGGATGGGGGAGAGG + Intergenic
1115500696 14:34046933-34046955 AGAGGAATGGGCCTGGGAGGAGG - Intronic
1116307416 14:43275672-43275694 TGAGGAGTGTGCTGAGGAGGAGG + Intergenic
1116785068 14:49279152-49279174 TGAGGGGTGGGGCAGGAAAGAGG - Intergenic
1117406812 14:55411886-55411908 GGAGGAGGGGCCTGGGGAAGGGG + Intergenic
1117822932 14:59669875-59669897 TGATGAAGGGGCCAGGGAAGAGG - Intronic
1117922767 14:60742631-60742653 TGAGGAGTGTGACGGCTAAGTGG - Intronic
1118197130 14:63637790-63637812 TGGGGACTTGGCCGGGGGAGGGG + Intronic
1118994291 14:70822545-70822567 AGAGGAGAGGGACGGGGCAGGGG - Intergenic
1119319708 14:73722715-73722737 TGAGAAGTCGGCCCAGGAAGAGG - Exonic
1119622024 14:76138580-76138602 TGGGGAGGGGGCAGGGGAGGGGG - Intergenic
1119769428 14:77211170-77211192 TGAGCAGGGGGCAGAGGAAGGGG - Intronic
1121193402 14:92048790-92048812 TGAGGAGCAGCCTGGGGAAGAGG + Exonic
1121289266 14:92761152-92761174 CGAGGAGTGGCCTGGGGAGGGGG - Intergenic
1121475340 14:94195698-94195720 TGAGTAGAGGGGAGGGGAAGGGG + Intronic
1121775900 14:96590669-96590691 CCAGGAGTGGGCCAGGGGAGGGG + Intergenic
1122118262 14:99538241-99538263 TGTGGCGTGGGCCTGGGTAGTGG - Intronic
1122276630 14:100594082-100594104 TGAGAAGTGGACCGGGGCTGGGG - Intergenic
1122293952 14:100694482-100694504 GGAGGGATGGGGCGGGGAAGCGG + Intergenic
1122384784 14:101336965-101336987 TGAGCAGTGGCCAGGGGAAGAGG + Intergenic
1122742601 14:103880876-103880898 TCAGGAGAGGGCAGGGGAATGGG - Intergenic
1122814944 14:104307661-104307683 GCAGGAGAGGGCCGGGGAGGGGG + Intergenic
1122816832 14:104318213-104318235 TGAGGAGGAGGCCTGGGATGGGG - Intergenic
1122945288 14:105005878-105005900 GGGGGTGAGGGCCGGGGAAGTGG - Intronic
1123002171 14:105301365-105301387 GGAGCTGTGGGCGGGGGAAGGGG + Exonic
1123630270 15:22256282-22256304 TGTGGAGGGGGCTGGGGGAGTGG + Intergenic
1124072605 15:26409937-26409959 GGAGGAGTGTGCCGAGGAGGAGG - Intergenic
1124086237 15:26552829-26552851 TGTGGAGAGGGCCTGGGAGGGGG + Intronic
1124785051 15:32671861-32671883 AGCGGAGTGGGGCGAGGAAGGGG - Intronic
1125060206 15:35410958-35410980 TGAGGAGGGGCCAAGGGAAGGGG - Intronic
1125276334 15:37996066-37996088 TGGGAAGTGGGGTGGGGAAGGGG - Intergenic
1125414447 15:39437892-39437914 GGAGGGGTGGGGCAGGGAAGAGG + Intergenic
1125719782 15:41839703-41839725 TGGGGTGTGGGCTGGGGATGTGG + Intronic
1125862623 15:43013864-43013886 TGGGGAGGGGGAGGGGGAAGGGG - Intronic
1127172881 15:56321910-56321932 TTAGGAGTGGGTGGGGGAAGGGG + Intronic
1127274503 15:57430569-57430591 AGAGAAGTGGGCAAGGGAAGTGG + Intronic
1127659986 15:61091504-61091526 TGAGGATTGCCCCTGGGAAGTGG - Intronic
1127747835 15:61998829-61998851 TGAGGAGTGGGAGGAGAAAGAGG - Intronic
1128317652 15:66671210-66671232 AGAGGAGAGGGGCGGGGCAGAGG - Intronic
1128380692 15:67109874-67109896 TGGGAAGTGGGCCGTGGAGGAGG - Intronic
1129342066 15:74892637-74892659 TGTGGGGTGGCCAGGGGAAGAGG - Intronic
1129666335 15:77581653-77581675 TTAGGTGTGGGCCGGGGCAGGGG - Intergenic
1129677753 15:77641639-77641661 TGAGGAGTGGGCGTGGTAGGAGG + Intronic
1129846022 15:78768030-78768052 TGGGGAGTTGGCGGGGGATGGGG + Intronic
1129846033 15:78768053-78768075 TGGGGAGTTGGCGGGGGATGGGG + Intronic
1129846045 15:78768077-78768099 TGGGGAGTTGGCGGGGGATGGGG + Intronic
1129846056 15:78768100-78768122 TGGGGAGTTGGCGGGGGATGGGG + Intronic
1130302175 15:82688661-82688683 GGAGGAGTAGGCCTGGGGAGAGG - Intronic
1130872139 15:87979812-87979834 TGAGGGGTGTGTCGGAGAAGGGG + Intronic
1131020700 15:89095502-89095524 TGAGGAGTGGGAGGGGGCTGAGG + Intronic
1131112879 15:89776446-89776468 GGAGGAGGAGGCCGGGGACGTGG - Exonic
1131145587 15:90009550-90009572 TGGGGAATGGACCAGGGAAGTGG - Intronic
1131996386 15:98136711-98136733 TGAGGGGTGGGGCCTGGAAGAGG + Intergenic
1132419274 15:101652002-101652024 TGGGGGCTGGGCCGGGGAGGCGG - Intronic
1202955059 15_KI270727v1_random:71185-71207 GGGGGAGTGGGGGGGGGAAGGGG - Intergenic
1132577762 16:671817-671839 TGATGTGTGTGCCGGGGAGGGGG - Intronic
1132663667 16:1072403-1072425 TGAGGGGTGGGCTGGGGTTGTGG - Intergenic
1132674547 16:1116303-1116325 TGACGCGGGGGCGGGGGAAGAGG + Intergenic
1132717895 16:1301258-1301280 TGAGGAGGCGGCCCGGGAGGGGG - Intergenic
1132829010 16:1918495-1918517 GGCGGAGTGGGCGGGGGAGGGGG - Intergenic
1132885895 16:2181749-2181771 TGAGGGTTGGGCTGGGGACGAGG + Intronic
1132931873 16:2462765-2462787 TGAGGTCTGGGCCGGGGACAGGG + Intronic
1132933145 16:2468809-2468831 TGAGGGGTGGGGTGGGGAGGGGG + Intergenic
1133050645 16:3115569-3115591 GTAGGAGAGGGACGGGGAAGAGG + Intronic
1133271720 16:4613787-4613809 TTAGGAGAGGCCCGGGGGAGTGG + Intronic
1134070568 16:11257136-11257158 TGAGGAAGGGGTCGGGGGAGAGG - Intronic
1134235053 16:12459067-12459089 GGGGGAGTGGACCGGGGAGGAGG - Intronic
1134670115 16:16048355-16048377 TGGGCAGTGGGCCGAGGGAGTGG + Intronic
1135533782 16:23276961-23276983 TAAGGAGTGAGCAGAGGAAGTGG + Intergenic
1136060195 16:27721227-27721249 TGAGGAGAGCGCTGGGGGAGGGG - Intronic
1136227193 16:28866890-28866912 GCCGGAGTGGGCCGGGGAGGAGG + Exonic
1136569746 16:31089474-31089496 TTAGGAGTGGGAAGAGGAAGAGG - Intronic
1136626424 16:31464845-31464867 TGGAGAGTGGGCCGGGCACGTGG - Exonic
1136632433 16:31496801-31496823 CGTGGAGTGGGGAGGGGAAGGGG - Intronic
1137666345 16:50251850-50251872 GGGGGAGCAGGCCGGGGAAGGGG - Intronic
1137683181 16:50368702-50368724 TGAGGAGGGGGCCGGGGTGCGGG - Intronic
1139246816 16:65452601-65452623 TGAGGAATGGGCAGTGGAAGGGG - Intergenic
1139784958 16:69385569-69385591 TGAGGGCCGGGCCGGGGGAGGGG - Intronic
1139946276 16:70644716-70644738 GGAGGAGGGGGAGGGGGAAGAGG + Intronic
1141627133 16:85267214-85267236 TGGGGAGGGGGCCGAGGATGTGG - Intergenic
1141638503 16:85328341-85328363 TGAGGAGGTGGCTGGGGAAGGGG - Intergenic
1141678016 16:85527684-85527706 CCAGCAGCGGGCCGGGGAAGTGG + Intergenic
1141801025 16:86309441-86309463 TGAGGAGAGGGCCGTGTAAAAGG - Intergenic
1141946110 16:87311089-87311111 TGAGGTGGGGGCCGGGGGAAGGG - Intronic
1141972816 16:87494361-87494383 TGTGGAGGGGGCTGGGGGAGTGG - Intergenic
1141992441 16:87618282-87618304 CGAGAAGTGGGCAGAGGAAGAGG + Intronic
1142244996 16:88966322-88966344 TGAGGCCTGTGCCGGGGTAGGGG + Intronic
1142440767 16:90096159-90096181 TGAGGAGTATGCCGAGGAGGAGG + Intergenic
1142483926 17:234793-234815 TGGGGAGTGGGCTGGGGGTGAGG + Intronic
1142608777 17:1096699-1096721 GGAGGAGAGAGCTGGGGAAGGGG + Intronic
1142608793 17:1096736-1096758 GGAGGAGAGAGCTGGGGAAGGGG + Intronic
1142608823 17:1096810-1096832 GGAGGAGAGAGCTGGGGAAGGGG + Intronic
1142608878 17:1096950-1096972 GGAGGAGAGAGCCGGGGAAGGGG + Intronic
1142805494 17:2369136-2369158 TGGGGAGAGGGCTGGGGAATGGG + Intronic
1143058175 17:4177978-4178000 TGACGTGTGGGCCTGTGAAGCGG - Intronic
1143146804 17:4781922-4781944 TGAGGGGTAGGCGGGTGAAGGGG - Intronic
1143183578 17:4998153-4998175 CGAGGTGAGGGCTGGGGAAGGGG + Exonic
1143341601 17:6215532-6215554 TGATGAGTGGGCCTCGCAAGTGG - Intergenic
1143348386 17:6267346-6267368 TGAGGAGTGGGGTAGGGATGTGG + Intergenic
1144484215 17:15651557-15651579 TGAGCAGTGGCCCTGGGCAGTGG + Exonic
1144798782 17:17911344-17911366 CAAGGACTGGGCTGGGGAAGAGG - Intronic
1145249170 17:21288057-21288079 TGAGGAGAAGGCCGGGGCAGCGG + Intronic
1145824250 17:27865155-27865177 TGATGAGTGGGCTGAGGAAGAGG + Intronic
1145883081 17:28365625-28365647 TGGGGACTGGGCTGGTGAAGTGG + Intronic
1145902568 17:28498092-28498114 TGAGGAATTGGCAGGGGCAGAGG - Intronic
1145964585 17:28907571-28907593 TGAGGTGAGGGCCGGAGATGCGG - Exonic
1146271122 17:31486702-31486724 CGAGGAGAGGGCTGGGGCAGTGG + Intronic
1146697984 17:34926089-34926111 TGGGGAGTGGGTGGGGGAAGTGG + Intergenic
1147166480 17:38596203-38596225 AGAGGAGGGGGCCGGGGCAGGGG + Intronic
1147307459 17:39573829-39573851 GGGGGCGAGGGCCGGGGAAGGGG - Intergenic
1147317661 17:39628434-39628456 TGAGGGGCGGGGCGGGGAGGGGG + Intronic
1147660978 17:42116987-42117009 TCAGGAGTGGGCCGTGGACTGGG + Intronic
1147678408 17:42223328-42223350 TGAGGATTGGGCCTGGGGACTGG - Intronic
1147915462 17:43882879-43882901 TGAGGACTGGGCAGGGCCAGAGG - Intronic
1148479452 17:47950467-47950489 TGTGTAGTGGGACGGGGTAGGGG + Intergenic
1148856999 17:50584343-50584365 TGAGCACTGGGAAGGGGAAGAGG + Intronic
1149429342 17:56584848-56584870 TGAGGATGGGGTCGGGGGAGTGG + Intergenic
1149459218 17:56813394-56813416 TCAGAGGTGGGCAGGGGAAGAGG - Intronic
1149591792 17:57835412-57835434 GGAGGAGTGGGCAGGGAAGGAGG - Exonic
1149993041 17:61393381-61393403 GGAAGTGTGGGCCAGGGAAGGGG - Intergenic
1150024561 17:61659179-61659201 TGAGGGGTGGGACGGAGCAGGGG - Intergenic
1150675587 17:67244571-67244593 CGAGGAGGGGGCGGGGAAAGGGG + Intronic
1150956152 17:69862639-69862661 TGGGGAGTGGGCGGGGGGCGTGG - Intergenic
1151145156 17:72033650-72033672 TGAGGTGGGGGGCGGGGTAGGGG + Intergenic
1151365506 17:73613784-73613806 TGAGGAGGGGGACAGGGAAGGGG + Intronic
1151395885 17:73822704-73822726 CGAGGAGTGTGCCTGAGAAGAGG - Intergenic
1151462487 17:74262793-74262815 AAAGGAGTGGGGTGGGGAAGTGG + Intergenic
1151540793 17:74763667-74763689 AGAGGTGTGGGCTGGGGGAGCGG + Intronic
1151842362 17:76627362-76627384 TGCGCAGTAGGCCGGGGCAGAGG - Intronic
1151919180 17:77140970-77140992 CGGGGAGGGGGCCGGGGAGGCGG - Intronic
1152007529 17:77691845-77691867 TGAGGAGGGGGCTGGTTAAGTGG + Intergenic
1152327526 17:79650326-79650348 TGTGGGGTGGGCCAGGGACGGGG + Intergenic
1152360077 17:79828747-79828769 TGAGTAGTGGGCGGGGGTGGGGG + Intergenic
1152810529 17:82379803-82379825 TGAGGACGGGGCCGGGGCTGGGG - Intergenic
1152956785 18:47398-47420 TGAGGAGTATGCCGAGGAGGAGG - Exonic
1153468845 18:5419770-5419792 GGAGGAGCGGGACGAGGAAGAGG - Exonic
1153907459 18:9675127-9675149 TGAGGAGTGGGCAGTGGATTTGG + Intergenic
1154341348 18:13504994-13505016 TGAGGATGGGGACGGGGATGGGG + Intronic
1154375628 18:13807078-13807100 TGAGGATTGGGCCGGGCACCCGG - Intergenic
1155654399 18:28177294-28177316 TGGGGAGGGGGCGGGGGAACAGG + Exonic
1156484793 18:37457826-37457848 GGAGGAGTGGGCAGGGATAGAGG - Intronic
1157257696 18:46153249-46153271 TGAGGAAGGGGCTGGGGGAGGGG + Intergenic
1157422163 18:47556274-47556296 GGAGGAGTGGGCTGGTGAGGTGG - Intergenic
1157619289 18:49006798-49006820 TGAGGAGGGGGCTGGGGAGCAGG + Intergenic
1157668584 18:49509521-49509543 TGAAGAGGAGGACGGGGAAGCGG - Intergenic
1157840341 18:50951778-50951800 TGAGGAGTGAACCCGGGAGGTGG + Exonic
1158215321 18:55094955-55094977 TGAGTAGTGGGAAGGGAAAGGGG - Intergenic
1158543077 18:58374459-58374481 TGGGGAGGAGGCCGGGAAAGGGG - Intronic
1158646720 18:59254944-59254966 GGGGGAGTGGGACGGGGAGGGGG - Intergenic
1158976607 18:62716045-62716067 TGAGGAGAGGGCGGCTGAAGAGG + Exonic
1159768229 18:72516756-72516778 TGAGGAGAGGAGCGGGGAGGAGG - Intergenic
1160343635 18:78111339-78111361 GGAGGTGTGGGCCAGGTAAGGGG - Intergenic
1160443021 18:78906919-78906941 TTAGCAGTTGGCCGGGCAAGGGG + Intergenic
1160586983 18:79918407-79918429 TGAGGAGCGGGCCCGGGGGGGGG + Intronic
1160691271 19:461510-461532 TGAGGCGCGGGGAGGGGAAGGGG + Intergenic
1160724871 19:613596-613618 TGGGGATGGGGCCGGGGATGGGG + Intronic
1160724887 19:613626-613648 TGGGGATGGGGCCGGGGATGGGG + Intronic
1160724900 19:613650-613672 TGGGGATGGGGCCGGGGATGGGG + Intronic
1160724910 19:613668-613690 TGGGGATGGGGCCGGGGATGGGG + Intronic
1160811835 19:1016194-1016216 TGAGGGGTGGGCGGGGGGAGGGG + Intronic
1160819714 19:1052352-1052374 GGAGGAGGGGGAGGGGGAAGAGG + Intronic
1160900237 19:1424324-1424346 GGAGGAGGGGGAGGGGGAAGAGG - Intronic
1160975332 19:1790070-1790092 GGGGGAGTGGGCAGTGGAAGGGG - Intronic
1161009816 19:1954725-1954747 TGAGGCTAGGGCTGGGGAAGGGG + Intronic
1161101552 19:2424380-2424402 GGAGGAGTGGCCTGGGGCAGTGG - Intronic
1161313718 19:3608266-3608288 TGAGGAGAGGGCATGGGAAGTGG + Intergenic
1161370572 19:3908745-3908767 GGAGGAGAGGGAAGGGGAAGAGG - Intronic
1161403780 19:4080885-4080907 GGAGGGGTGGGGAGGGGAAGGGG + Intergenic
1161427332 19:4210722-4210744 TGGGAAGTGGGCATGGGAAGTGG - Intronic
1161446730 19:4322948-4322970 GGAGGGGTGGGCAGGGGAACTGG - Intronic
1161478616 19:4499646-4499668 GGAGGAGCTGGCCGGGGAGGAGG + Exonic
1161723254 19:5915074-5915096 TGGGGAGTGGACCGAGGACGAGG + Exonic
1161766541 19:6211791-6211813 GGAAGAGTGGGCCGGGAAGGAGG + Intergenic
1162310846 19:9906305-9906327 GGGGGAGAGGGCAGGGGAAGTGG + Intronic
1162384778 19:10354296-10354318 GGAGGAGTGGCCCGGGAAATCGG - Intronic
1162470690 19:10870941-10870963 TGGGGAATGGGCGGGGGAAAGGG - Intergenic
1162727041 19:12696100-12696122 TCAGGCTTGGGGCGGGGAAGAGG - Intronic
1162751127 19:12830106-12830128 TGAGGAGGAGGCTGGGGCAGTGG + Intronic
1162836816 19:13325109-13325131 GGAGGAATGGGAAGGGGAAGGGG - Intronic
1162905055 19:13818297-13818319 TGAGGAGCAGGCCGGGACAGGGG - Intronic
1162971427 19:14183405-14183427 TGAGGTCTGGGGCGGGGCAGGGG + Intronic
1162975334 19:14204991-14205013 TGAGGTGTTGGCCAGGGATGGGG + Intronic
1163004616 19:14389361-14389383 TGAGGAGGGAGACGGGGAAGGGG + Intronic
1163127452 19:15251874-15251896 TGGGGAGGGCGCCTGGGAAGAGG + Intronic
1163293697 19:16398206-16398228 TGAAGTGGGGGCCGAGGAAGCGG - Intronic
1163390483 19:17027194-17027216 TGAGGGGCGGGCCCGGGGAGGGG - Intergenic
1163407470 19:17131883-17131905 TGGGGGGTGGGGCGGGGAACAGG + Intronic
1163666804 19:18607190-18607212 AGAAGATTGGGCCGTGGAAGGGG - Intronic
1164565204 19:29321046-29321068 TGAGAAGTGGCCCCGGGATGAGG - Intergenic
1164802286 19:31087599-31087621 TGAGGTGAGGGCAGGGGAGGAGG + Intergenic
1164809888 19:31147486-31147508 TCAGGACTGGGCCTGGGGAGTGG + Intergenic
1165329555 19:35134094-35134116 TGACGAGTGAGCTGGGGATGTGG + Exonic
1165347684 19:35259063-35259085 TGGTGAGTGGGCCTGGGAAGGGG + Exonic
1165924914 19:39320851-39320873 TGGGGGGAGGGCCGGGGGAGGGG + Intergenic
1166356852 19:42232452-42232474 TGGGGAGTGGGGCGGGGTAGGGG - Intronic
1166410598 19:42553685-42553707 TGAGGAAGGGGCCTGGGAACAGG - Intronic
1166667349 19:44689023-44689045 GGAGGAGTGTGGGGGGGAAGAGG + Intergenic
1166698842 19:44870229-44870251 TGTGGAGTGGCCAGGGGAGGTGG + Intronic
1166790494 19:45396105-45396127 CGAGGAGTGGGGTGGGGGAGCGG - Intronic
1166913064 19:46174615-46174637 TGAGGAGTGGGTAGGGCAATAGG + Intergenic
1166925070 19:46261431-46261453 TGAGGAGGAGGCCGGGCATGGGG + Intergenic
1167083736 19:47294920-47294942 TGAGGAGTGGGCCGGCGTGGTGG - Intronic
1167599867 19:50448392-50448414 TGAGGAGTGGGCTGCAGAAGTGG + Intronic
1167605343 19:50478908-50478930 TGAAGGGTGGGCGGGGGAGGGGG + Intronic
1167748222 19:51365355-51365377 TAGGGAGTGGGCTGGGGAAGAGG - Intronic
1167900966 19:52622044-52622066 TGAGGAGTGGCCTGGGGAGGGGG - Intronic
1168416761 19:56174316-56174338 GGAGGAGTGGGCAGGGGAGGAGG - Intergenic
1202711936 1_KI270714v1_random:23751-23773 TGAGGAAAGGGCAGGGGCAGGGG - Intergenic
926725438 2:15993913-15993935 AGCTGAGTGAGCCGGGGAAGAGG - Intergenic
926926817 2:17995779-17995801 TGAGGCCTGGGCCTGGGCAGTGG - Intronic
927156776 2:20225230-20225252 TTAGGAGCGGGCCGGGGGTGGGG - Intronic
927457950 2:23273543-23273565 GGAGGAGGGGGCAGGAGAAGAGG + Intergenic
927594846 2:24387327-24387349 TGAGCAGGGGGCTAGGGAAGGGG + Intergenic
927681338 2:25141435-25141457 TGAGGAGAGGACGGGGGACGTGG + Intronic
928611078 2:32993103-32993125 TTAGGAGTGAGCCAGGGAGGTGG + Intronic
929356334 2:41029153-41029175 TGTGGAGGGGGCTGGGGATGGGG + Intergenic
929601977 2:43210244-43210266 TGTGGAGTGGGGCAGGGAGGAGG + Intergenic
929701943 2:44169467-44169489 GGAGGCGGCGGCCGGGGAAGGGG - Intronic
929777834 2:44939487-44939509 TGAAGGGTGGGAGGGGGAAGGGG - Intergenic
929787739 2:45004374-45004396 TGAGGGGTGGGAGAGGGAAGAGG - Intergenic
930124318 2:47783824-47783846 TGGGGAGGGGGCCTGGGAGGTGG + Intronic
930754406 2:54960355-54960377 TGGGGGCTGGGCCAGGGAAGGGG + Intronic
931786413 2:65622999-65623021 TGAGGAGTGGACGGGAGATGAGG + Intergenic
932224530 2:70029170-70029192 AGAGGATTGGGGCAGGGAAGTGG + Intergenic
932475320 2:72002432-72002454 TGGGGAGCGGGCCCGGGGAGGGG - Intergenic
932770858 2:74500052-74500074 TCAGGGGTGGGGTGGGGAAGAGG - Intronic
933666806 2:84971094-84971116 CGGGGGGTGGGCCGGGGGAGGGG + Exonic
933926392 2:87094100-87094122 TGAGGAGTGGGGGGGCGCAGGGG + Intergenic
934039802 2:88118401-88118423 TGATTGGTGGGCAGGGGAAGGGG - Intergenic
934753850 2:96811467-96811489 TGATCAATGGGCCAGGGAAGAGG - Exonic
934977790 2:98817186-98817208 TGAGGAGCTGGGCGGGGGAGAGG + Intronic
935232410 2:101110400-101110422 GTGGGAGTGGGGCGGGGAAGAGG - Intronic
935631619 2:105216926-105216948 TGACAAGGGGGCCGGGGAGGAGG - Intergenic
935829182 2:106982252-106982274 TTAGGAGAGGGAGGGGGAAGGGG - Intergenic
936695275 2:114939230-114939252 TGATGAGTGGGCTGAGGAGGAGG + Intronic
936972039 2:118185572-118185594 GGAGGAGGGGGCGGGGGGAGAGG + Intergenic
937192529 2:120117838-120117860 TGGGGAGGGGGCAGGGGGAGAGG - Intronic
938029737 2:127981773-127981795 GGAGGACTGGGTCGGGGTAGGGG - Intronic
938459809 2:131490204-131490226 TCAGGAGTGAGGCGGGCAAGGGG + Intronic
940315773 2:152326097-152326119 TGTGGAGTAGGCTGAGGAAGAGG - Intergenic
941640085 2:167977935-167977957 TGAGGAAGGGGCTTGGGAAGTGG + Intronic
941951196 2:171159844-171159866 GGAGGAGTGCGCGGGAGAAGGGG + Intronic
942051620 2:172146128-172146150 TAAGGCGTGGGCAGTGGAAGAGG - Intergenic
942358373 2:175144682-175144704 TGAGGGTTGGGCTGGGAAAGGGG + Intronic
942458792 2:176155599-176155621 ACAGGAGTGGGCCAGGGAAGGGG + Intronic
943645939 2:190408213-190408235 TGAGGCCGGGGCCGGGGAGGAGG + Intergenic
944060061 2:195563132-195563154 GGTGGAGAGGGCGGGGGAAGTGG - Intergenic
944171765 2:196787089-196787111 TGAGGGGTGGGTTGGGGAGGTGG - Intronic
945735845 2:213599439-213599461 TGTTGAGTAGGCCGAGGAAGAGG - Intronic
945881608 2:215330138-215330160 TGAGGAGTGGGAGGGAGATGGGG + Intronic
946157371 2:217815810-217815832 TGAGGAGAGGCCTGGGGAAAAGG - Intronic
946159484 2:217827500-217827522 TGGGGAGTGGAGCGGGGAAGGGG - Intronic
946201024 2:218070875-218070897 TGGGGAGAGGGATGGGGAAGGGG - Intronic
946375889 2:219308845-219308867 TGAGGAATGGGAAGGGGAGGTGG - Intronic
946410752 2:219514077-219514099 TGGGGTGTGGGCCAGGAAAGTGG + Intergenic
947563245 2:231176416-231176438 TGAGCAGTGGGGAAGGGAAGTGG - Intergenic
947849689 2:233275670-233275692 AGTGGAGTGGGACTGGGAAGGGG - Intronic
948140724 2:235670306-235670328 TGAGGAGGAGGCCGAGGAGGCGG + Intronic
948605861 2:239134359-239134381 TGAGGTGGGTGCCGGGGAAAAGG + Exonic
948803125 2:240441777-240441799 TGAGGCTTGGGCCAGGGAAGCGG + Intronic
1168765840 20:381218-381240 GGAGGGGGCGGCCGGGGAAGGGG + Intronic
1169073880 20:2749975-2749997 TAAGGAGTCGGGCGGGGGAGTGG + Intronic
1169253906 20:4083089-4083111 AGAGGAGGGGGGCGGGGGAGAGG + Intergenic
1169253916 20:4083107-4083129 AGAGGAGGGGGGCGGGGGAGAGG + Intergenic
1169253926 20:4083125-4083147 AGAGGAGGGGGGCGGGGGAGAGG + Intergenic
1170008710 20:11697260-11697282 GGGGGAGTGGGGGGGGGAAGGGG + Intergenic
1170578129 20:17680227-17680249 TGAGGAGGGAGGCGGGGCAGTGG + Intronic
1170742840 20:19073091-19073113 TGAGATGTGGGACAGGGAAGGGG + Intergenic
1171100147 20:22375113-22375135 TGAGCAGAGGGTGGGGGAAGGGG + Intergenic
1171489739 20:25508539-25508561 TGAGGTGTGGGCAGGGTCAGTGG - Intronic
1171795062 20:29560159-29560181 CGAGGAGAAGGCAGGGGAAGTGG - Intergenic
1171853392 20:30324106-30324128 TGAGGAGAAGGCAGGGGAGGTGG + Intergenic
1172057591 20:32165178-32165200 TGAGGCCTGGCCAGGGGAAGGGG - Intronic
1172174855 20:32966106-32966128 TGAGTTGTGGGCCCGGGCAGGGG + Intergenic
1172251427 20:33482068-33482090 TGAGGAATAGGCCAGGGAGGTGG - Intergenic
1172281360 20:33710375-33710397 AGAGGAGGGGGTTGGGGAAGAGG - Intronic
1173284158 20:41655341-41655363 TGAGGATTGGGGTGGGGATGAGG - Intergenic
1173288991 20:41697881-41697903 TGAGTAGTGGGCAAGGGAAGAGG - Intergenic
1173801093 20:45894930-45894952 TGAGGTGGGGGCAGGGGGAGGGG + Intronic
1173847419 20:46196943-46196965 TGAGGAGTGGGCAGGGGCTGGGG + Intronic
1173868657 20:46328687-46328709 AGGGGAGTGGGAAGGGGAAGCGG - Intergenic
1174059533 20:47822773-47822795 TGAGGAGTAGGAGGAGGAAGAGG - Intergenic
1174067805 20:47878401-47878423 TGAGGTGTGGGCCAGGGAAGGGG - Intergenic
1175225537 20:57441875-57441897 AGAGGAATGGGCAGGGGGAGGGG + Intergenic
1175367373 20:58465328-58465350 GGAGGAGGGGGTGGGGGAAGGGG + Intronic
1175592434 20:60203807-60203829 TGATGAGTGGGCTGGGGCAGGGG - Intergenic
1175941186 20:62538174-62538196 TGAGGAGTGGTGCAGGGCAGAGG + Intergenic
1176028573 20:62999062-62999084 GGAGGAGTGGGGAGGGGAAGGGG + Intergenic
1176156945 20:63626822-63626844 GGAGGGGAGGGCCGGGGGAGGGG - Intronic
1176261366 20:64182565-64182587 TGGGGAGTGGGAGGGTGAAGTGG + Intronic
1176388668 21:6152245-6152267 TGCGGAGTGGGCCCAGGAGGTGG - Intergenic
1176867670 21:14063031-14063053 GGTGGAGTGGGGCGGGAAAGGGG + Intergenic
1177291583 21:19120084-19120106 TGAGCAGTGGGCCAGGGAGTTGG + Intergenic
1178291679 21:31373874-31373896 GGAGGAGTGGGGAGAGGAAGAGG - Intronic
1178481498 21:32983182-32983204 GGAGGAGAGGGCAGGGGAGGGGG - Intergenic
1179161324 21:38901955-38901977 TGTTGAGTGGGCTGAGGAAGAGG + Intergenic
1179407868 21:41140265-41140287 TGAGGACTGGGTGGGGTAAGGGG - Intergenic
1179509811 21:41865072-41865094 TGAGGAGTGAGCAGGGGAGTGGG - Intronic
1179509830 21:41865142-41865164 TGAGGAGTGAGCCGGGGAGTGGG - Intronic
1179549619 21:42135666-42135688 TTAGGAGTTGTCTGGGGAAGTGG + Intronic
1179574558 21:42299726-42299748 TGAGGAGTGGGCAGGGGACAGGG - Intergenic
1179596014 21:42443719-42443741 TGGGGGGCGGGCAGGGGAAGTGG - Intronic
1179734804 21:43386003-43386025 TGCGGAGTGGGCCCAGGAGGTGG + Intergenic
1180231753 21:46430557-46430579 TGGAGAGTGAGCAGGGGAAGGGG + Exonic
1180958223 22:19750681-19750703 TGGGGGGTGGGCGGGGGAGGTGG - Intergenic
1181035949 22:20169806-20169828 TGAGGAGGGGGCAGGGGCAAGGG - Intergenic
1182275642 22:29186875-29186897 TGAGGAGTGGGGTGGGGGAATGG + Intergenic
1183198724 22:36371228-36371250 TGAGGACAGGGCCTTGGAAGAGG + Intronic
1183278991 22:36922304-36922326 TGAGGACAGGGACAGGGAAGTGG - Intronic
1183393726 22:37560354-37560376 CGGGGAGGGGGCCGGGGAGGGGG + Intergenic
1183464350 22:37972138-37972160 AGAGGAGGGGGGAGGGGAAGGGG + Intronic
1183510586 22:38232463-38232485 TGTGGAGAAGGCGGGGGAAGGGG + Intronic
1183604464 22:38860420-38860442 GGAGGAGGGGGGCGGGGAGGTGG + Intergenic
1183645617 22:39124338-39124360 TGCGGAGGGGGTCGGGGAGGGGG + Intronic
1183788399 22:40045168-40045190 CGGGGAGCGGGCCGGGGAGGGGG + Intronic
1184248762 22:43248714-43248736 TGAGCACTGGGCCTGGGGAGCGG + Intronic
1184663842 22:45977366-45977388 CGGGGACTGGGCGGGGGAAGAGG + Intergenic
1185229809 22:49673555-49673577 TGGGGAGGGGGAAGGGGAAGGGG + Intergenic
1185388739 22:50548018-50548040 TGAGGTGGGGGCTGGGGCAGGGG - Exonic
1185409120 22:50673550-50673572 TGATGAGTGGGCGGAGGAGGGGG - Intergenic
949336096 3:2977597-2977619 TGAGCAGTGGGCATGGGAGGTGG + Intronic
950548540 3:13653126-13653148 TGCGGGGTGGGCCGGGGTTGGGG + Intergenic
950573535 3:13816904-13816926 GGAGGAGTGGGCATGTGAAGGGG - Exonic
951080166 3:18444139-18444161 GGAGGAGTGGGCTGCGGGAGTGG - Intronic
953261770 3:41346277-41346299 TGAGTGGTGGGTCGTGGAAGAGG - Intronic
953435282 3:42872877-42872899 GGAGGAGTGGTTCAGGGAAGAGG + Exonic
953680510 3:45035211-45035233 TGAGGTGGAGGCCTGGGAAGGGG + Intronic
953820851 3:46206324-46206346 GGAGGAGTGGGCCAGGGGATGGG - Intronic
954436445 3:50498811-50498833 TGGGCAGTGGGCCCAGGAAGTGG - Intronic
954453586 3:50585097-50585119 TGAGGAATGGGACTGGGATGTGG + Intergenic
954575040 3:51671285-51671307 TGAGGTGAGGGCCGGGCCAGAGG + Exonic
954967669 3:54625575-54625597 AGTGGAGCGGGCCAGGGAAGAGG + Intronic
955054779 3:55445593-55445615 AGCGGAGTGGGCCGCGGAAGTGG - Intergenic
956425266 3:69127965-69127987 TCTGGAGTGGGGAGGGGAAGTGG + Intergenic
956778431 3:72585952-72585974 TTAGGAGAGGGCCCTGGAAGAGG + Intergenic
956943226 3:74189021-74189043 AGAGGAGAGGGATGGGGAAGGGG - Intergenic
957155260 3:76537073-76537095 TGAGGAGTGGTCTGTGGAAGGGG + Intronic
957734954 3:84191886-84191908 TGAGGAGTAGCCTGGGGAGGAGG + Intergenic
958688307 3:97427542-97427564 TGAAGAGTGGGAGGAGGAAGAGG + Intronic
961469136 3:127100598-127100620 TCAGCAGTGGGCCAGGGATGGGG - Intergenic
961631421 3:128301734-128301756 TGAGGGGTGAGCCTGGGAATGGG + Intronic
961894532 3:130156336-130156358 CGGGGAGTGGGGCTGGGAAGTGG + Intergenic
962482636 3:135810900-135810922 GGAGGATTGGGCAGGGGGAGTGG + Intergenic
963328153 3:143884715-143884737 TGAAGAGGGGACGGGGGAAGGGG + Intergenic
963536615 3:146537431-146537453 ACTGGAGTGGGCCTGGGAAGGGG - Intronic
964301352 3:155288892-155288914 TGAGGTGGGGGCCGGCGCAGTGG - Intergenic
964871607 3:161319261-161319283 AGTGGACTGGGCGGGGGAAGTGG + Intergenic
965105316 3:164346197-164346219 TGAGGAGTGGCCTGGGGAGGAGG + Intergenic
966213495 3:177477285-177477307 TGGGTAGTGGGGCGGGGAGGTGG + Intergenic
966885725 3:184377174-184377196 TGGGGAGTGGGGCTGGGGAGGGG + Intronic
966917914 3:184594872-184594894 GGAGGAGTGGGAAGAGGAAGAGG + Intronic
968357526 3:198120748-198120770 TGAGGAGTATGCCGAGGAGGAGG + Intergenic
968424208 4:510824-510846 AGAAGACTGGGCTGGGGAAGAGG - Intronic
968610961 4:1556812-1556834 TGAGGAGGGGGCCCGGGAGCTGG - Intergenic
968652428 4:1765578-1765600 TGAGCAGAGGGCAGGGGACGAGG - Intergenic
968868535 4:3228665-3228687 GGAGGAATGGGACGAGGAAGAGG + Exonic
968950541 4:3689167-3689189 TGAGGGGTGGGGCCTGGAAGAGG + Intergenic
969339176 4:6529637-6529659 GGAGGACTGTGCCAGGGAAGAGG - Intronic
969349672 4:6591168-6591190 GGAGGAGTGGGAGAGGGAAGGGG + Intronic
969937303 4:10695036-10695058 GGAGGAGTGGACTGGGAAAGGGG + Intergenic
970565285 4:17326125-17326147 AGTGGGGTGGGGCGGGGAAGGGG - Intergenic
971470318 4:27018040-27018062 TGAGGAGGGGGCGGGAGGAGTGG + Intronic
974762830 4:66300675-66300697 GGAGGAGAGGGGAGGGGAAGTGG - Intergenic
974929939 4:68350135-68350157 TGCGGAGAGGGGCGGGGAGGCGG + Intergenic
975199605 4:71570908-71570930 TGAGGAGTGGGGCTGGGGAGAGG + Exonic
976449246 4:85167447-85167469 AGAGGAGTGGGTAGTGGAAGAGG + Intergenic
976534824 4:86199572-86199594 TGAGGAGTGCCACTGGGAAGGGG + Intronic
976630963 4:87235899-87235921 GGAGGAGGGTGCGGGGGAAGGGG + Intronic
977666411 4:99650739-99650761 TGAGGAGAGGGAAGGGGTAGTGG - Exonic
978043068 4:104093143-104093165 TGAGCAGTGGGTGGGGGAGGTGG - Intergenic
978696175 4:111583348-111583370 TGAGAAGTAGGCCTGGGAAGAGG - Intergenic
978735415 4:112078370-112078392 TGAGGAGTGGGCCCAGGAGGAGG + Intergenic
979863877 4:125728715-125728737 AGAGGAGTCAGCCAGGGAAGTGG - Intergenic
980469679 4:133234544-133234566 CCAGGAGTGGGCCAGGTAAGAGG + Intergenic
981782133 4:148442411-148442433 AGAGGAGGGGGCAGGGGCAGGGG + Exonic
982564491 4:156971398-156971420 TGGGGGGTGGGGCGGGGGAGAGG - Intergenic
982943904 4:161593568-161593590 TGAGGAGGGGGAGGGAGAAGGGG + Intronic
984908083 4:184648831-184648853 GGAGGAGTGGCCCCGGGAAGCGG - Intronic
984912819 4:184690064-184690086 TGAGGTGTGGGATGGGGAGGTGG - Intronic
984915435 4:184719013-184719035 AGAAGAGAGGGCCGGAGAAGAGG + Intronic
985271314 4:188197177-188197199 TGGGGAGTGGGAAGGGGATGGGG - Intergenic
985326978 4:188781957-188781979 AGAGGAGGGGGCTGGAGAAGGGG - Intergenic
985788293 5:1911371-1911393 TGGGGAGAGGGTCGGGGAATGGG - Intergenic
986330022 5:6711163-6711185 GGAGGTGAGGGCAGGGGAAGAGG + Intergenic
986502491 5:8415385-8415407 CGAGGAGTGGCCTGGGGAGGGGG - Intergenic
989578427 5:43010231-43010253 TGAGGAGAGGGCGGAGGAGGAGG - Intergenic
989600230 5:43193454-43193476 TGAGGAATGGGGTGGGGGAGGGG - Exonic
989688994 5:44118781-44118803 TGAGGAGCAGCCTGGGGAAGAGG + Intergenic
990589748 5:57249966-57249988 GGAGGAGGGGGAGGGGGAAGGGG - Intronic
994058303 5:95445427-95445449 TGAGGTATGGGACTGGGAAGAGG - Intronic
994541303 5:101101651-101101673 GGAGGAGGGGGAGGGGGAAGGGG + Intergenic
994901034 5:105769489-105769511 TGTGGGGTGGGGCGGGGGAGGGG + Intergenic
995005839 5:107194481-107194503 TGATGAGTTGGCGGGAGAAGAGG + Intergenic
995962773 5:117863775-117863797 TGAGGTTTGGGAAGGGGAAGTGG - Intergenic
996230833 5:121061393-121061415 TGTGGAGTGGGTTGCGGAAGAGG + Intergenic
996559338 5:124811728-124811750 TGAGGGGTGGGGTGGGGAGGTGG + Intergenic
996747621 5:126858634-126858656 AGAGGAGAAGGCTGGGGAAGAGG - Intergenic
996978086 5:129459517-129459539 TGAGGAGTGGGATGGGAAGGGGG + Intergenic
997257147 5:132437828-132437850 GGAGGAGTGGGGTGGGGCAGAGG + Intronic
997422978 5:133783864-133783886 TGGGGGGTGGGCGGGGGCAGTGG - Intergenic
997449130 5:133968022-133968044 TGAGGAGGTGGCCGGGGCTGGGG - Intronic
997643665 5:135466300-135466322 CGTGGAGGGGGCCGGGGAACGGG - Intergenic
997867889 5:137480883-137480905 TGAGGAGAGGGAAGAGGAAGAGG + Intronic
998857926 5:146412439-146412461 GGGGGAGTGGGGAGGGGAAGGGG + Intergenic
999467779 5:151823463-151823485 TGGGGAATGGGATGGGGAAGAGG - Intronic
1000041557 5:157488428-157488450 TCTGGAGGGGGCCGGGGAGGAGG + Exonic
1001327500 5:170739812-170739834 TGAGGAGTGGGGCGGAGGGGTGG - Intergenic
1001573706 5:172748194-172748216 TGAGGCTGGGGCCAGGGAAGAGG - Intergenic
1001959352 5:175871167-175871189 TGAGGAGTGGTGGGGGCAAGGGG - Intronic
1002604187 5:180372074-180372096 TGAGGAGTGGGGTTGGGCAGAGG + Intergenic
1002822739 6:742201-742223 TGAGGAGAGGGCAGGAGATGGGG + Intergenic
1003049410 6:2766026-2766048 GGAGGAAGGGGTCGGGGAAGAGG + Exonic
1003098671 6:3160618-3160640 TGTTGGGTGGGCCGGGGATGGGG + Intergenic
1004119667 6:12808820-12808842 GGAGGAGGGGGAGGGGGAAGGGG - Intronic
1005022632 6:21432441-21432463 AGAGGAATTGGCAGGGGAAGAGG + Intergenic
1005490352 6:26342043-26342065 TGAGGAGTGGGAGGAGGGAGAGG + Intergenic
1005764041 6:28993173-28993195 TGGGGAGTGGGAGGCGGAAGTGG - Intergenic
1005974984 6:30790972-30790994 TGAGGGGTGGAGCGGGGATGTGG + Intergenic
1006132758 6:31878806-31878828 TGAGGGGAGGGCCCGGGAACCGG - Intronic
1006387054 6:33737124-33737146 AGAGGAGTGGGAGGGGGAGGAGG - Intronic
1006503971 6:34476401-34476423 TGTGGGGAGGGCTGGGGAAGGGG - Intronic
1006600130 6:35219698-35219720 TGGGGGGAGGGCTGGGGAAGGGG + Intronic
1006676263 6:35765856-35765878 TGCGGCGTGTGCCGGGGAGGCGG - Intergenic
1006844714 6:37054304-37054326 TGAGAGGTGGGCCAGGGTAGTGG - Intergenic
1007072575 6:39048287-39048309 TGAGAAGAGGACCTGGGAAGGGG + Intergenic
1007267890 6:40611019-40611041 TTAGGAGGGGGCCGGGGCAGGGG - Intergenic
1007360272 6:41350584-41350606 CGAGTAGTGGGATGGGGAAGGGG + Intronic
1007589778 6:43014112-43014134 TGAGGAGTGGGCAGGGGCGTAGG - Intronic
1008006538 6:46415600-46415622 TGAGGGCTGGGCAGAGGAAGAGG + Intronic
1008753927 6:54770796-54770818 TGAGGACTGGGCGGGGGGGGGGG + Intergenic
1010021250 6:71162438-71162460 GGTGGTGTGGGCCTGGGAAGTGG - Intergenic
1011632349 6:89339568-89339590 AGAGGGGTGGGGAGGGGAAGGGG + Intronic
1012320470 6:97838529-97838551 GGAAGAGTGGGAGGGGGAAGAGG + Intergenic
1013047585 6:106502860-106502882 TAAGGAGAGGGCCTTGGAAGAGG - Intergenic
1013132112 6:107242909-107242931 TGAGGAGGTGGCAGGGAAAGAGG + Intronic
1013647690 6:112161718-112161740 TGAGGAGTGAGTGGGGTAAGGGG + Intronic
1013792725 6:113855257-113855279 GGAGCACTGGGCCGGGGAGGGGG - Intergenic
1013803133 6:113970257-113970279 GGAGGAGGGGTCCGGGGAAAGGG + Intronic
1014205490 6:118651487-118651509 TGAGGCCCGCGCCGGGGAAGCGG + Intronic
1014221209 6:118800515-118800537 TGAGGAGTGGGCCAGGAGAAGGG - Intergenic
1015134555 6:129852862-129852884 TGAGGAGGTGGCTGGGGGAGAGG - Intronic
1015872409 6:137790567-137790589 TGAGGGGTGGGGTGGGGAGGAGG - Intergenic
1016377412 6:143436680-143436702 TGAGGAGTGGACTGAGGAAATGG + Intronic
1016391777 6:143581825-143581847 TGAGGGGTGGGGAGGGGAACAGG - Intronic
1016658287 6:146544775-146544797 TGAGGAGTGGGGGGGGGGCGGGG - Intronic
1016834380 6:148462808-148462830 TGAGGAGGAGTCTGGGGAAGAGG + Intronic
1017068307 6:150550070-150550092 GGAGGAGTGGGCTGGGAAGGAGG + Intergenic
1017162699 6:151380787-151380809 TGAGGAGTAGGCTGGGGACCAGG - Intronic
1017180828 6:151550350-151550372 TGAGGAGGGGCCTGGGGAATTGG + Intronic
1017192205 6:151666682-151666704 GGAGGAGGGGGATGGGGAAGAGG - Intronic
1017959336 6:159208171-159208193 TGGGGATTGGGCTGGGGATGGGG + Intronic
1018355428 6:163010406-163010428 TGAGGAGTGGGTAGGAGAATGGG + Intronic
1018893439 6:167997598-167997620 TGAGGAAGGGGCAGGGGCAGGGG - Intronic
1019096525 6:169585752-169585774 TGTTGAGTGGGCTGGGGAGGAGG + Intronic
1019179286 6:170176685-170176707 AGAGGAGCGGGCCGGGAAGGAGG + Intergenic
1019377366 7:699970-699992 AGCGGCGTGGGCGGGGGAAGGGG + Intronic
1019915007 7:4127528-4127550 TAAAGAGTGGGCTGGGGAAATGG + Intronic
1019929790 7:4215842-4215864 TGAGGAGTGGAGCAGGGCAGGGG - Intronic
1022098106 7:27153173-27153195 TGAGCAGTGGGCTTGGAAAGGGG - Intergenic
1022496921 7:30859190-30859212 AGAGGTGTGGGGCTGGGAAGAGG + Intronic
1023332448 7:39132747-39132769 AGAGGTGTGGGGCGAGGAAGGGG + Intronic
1023908586 7:44538771-44538793 CGAGGAGTGGGCTGGGGCTGGGG - Intronic
1024109402 7:46130066-46130088 AGATAAGTGGGCCGAGGAAGAGG + Intergenic
1025944970 7:66098721-66098743 GGAGGAGTGGGGGGGGGAGGAGG + Intronic
1026042296 7:66878193-66878215 TAGGGGGTGGGCCAGGGAAGGGG + Intergenic
1026130990 7:67620865-67620887 TCAGGTGTGGGCTTGGGAAGTGG - Intergenic
1026360486 7:69598186-69598208 TGGGGAGGGGGCGGGGGAGGAGG + Intergenic
1026508926 7:71011209-71011231 AGAGGTGTTGGCTGGGGAAGGGG - Intergenic
1026800651 7:73397872-73397894 TGAGGAGGAGGCGGGGGGAGGGG + Intergenic
1026855274 7:73749407-73749429 TGAGGAATGGGATGGGGAGGGGG + Intergenic
1026964236 7:74429226-74429248 TGAGGTGTGGGCAGGGGCGGGGG - Intergenic
1028328623 7:89559710-89559732 GGAGGGGTGGGGAGGGGAAGGGG + Intergenic
1028536662 7:91895640-91895662 TTACAAGTGGGCCGGGGCAGTGG - Intergenic
1028780594 7:94731028-94731050 TGAGGAGTGGGGTGGGGAGTGGG + Intergenic
1028892721 7:96006384-96006406 TGAGGAGTGTGACTGGGGAGGGG - Intronic
1028993602 7:97076144-97076166 TGGGGAGCGGGGCAGGGAAGGGG - Intergenic
1029465420 7:100721710-100721732 TGTGGAATGTGCTGGGGAAGGGG - Intronic
1029537195 7:101163700-101163722 GGAGGAGAGGGTGGGGGAAGAGG - Exonic
1030290962 7:107872248-107872270 TAAGGAGAGGCCTGGGGAAGGGG + Intergenic
1030301342 7:107977293-107977315 TGTGGAGTGGGGAGGGGCAGTGG + Intronic
1030730822 7:112986338-112986360 TGAGGAGAGGGCCGGGGTAGGGG + Intergenic
1030808581 7:113946490-113946512 TCAGGAGTGGGACTGGGAGGTGG + Intronic
1031071559 7:117167470-117167492 TGAAGGGTTGGCCTGGGAAGGGG + Intronic
1031871301 7:127091860-127091882 TGATGAGTGGGCCGGCGGGGGGG - Intronic
1032197158 7:129796092-129796114 TGAGGGGTGGGCCAGGGGATAGG - Intergenic
1032655966 7:133929833-133929855 TGAGGAATGAGCAGGGGAGGGGG - Intronic
1033598171 7:142871046-142871068 TGAGGAGGGGGCTGGTGGAGAGG - Exonic
1034531899 7:151701083-151701105 TGAGGAGTGGGAGGTGGAAGGGG - Intronic
1034720735 7:153290089-153290111 GGAGGAGGGGGTCGGGGGAGGGG + Intergenic
1034964207 7:155381742-155381764 TCGGGAGCGGGCGGGGGAAGGGG - Intergenic
1035476151 7:159145195-159145217 GGGGGCGTGGGCCAGGGAAGAGG - Intergenic
1035722035 8:1799274-1799296 GGAGGAGGGGGACGGGGAGGGGG - Intergenic
1037760403 8:21738145-21738167 TGAGGAGGGGGAGGGGGATGAGG - Intronic
1038613459 8:29073092-29073114 TGAGGAGGGGGACGAGGAGGGGG + Intronic
1039011651 8:33100227-33100249 AGTGGGGTGGGCCGCGGAAGTGG - Intergenic
1039016111 8:33150733-33150755 TGAGGAGTGTGACTGGGAAATGG + Intergenic
1039590754 8:38744776-38744798 TGAGTAGTCGGCCGGGGGTGGGG + Intronic
1040971605 8:53141882-53141904 TGGGGAGTGGGGTGGGGTAGGGG - Intergenic
1043427075 8:80158249-80158271 AGAGGAGTGGGGTGGGGAGGAGG - Intronic
1044605650 8:94045151-94045173 TAAGGAGTGGGCCAGGGAGTGGG + Intergenic
1044750166 8:95408136-95408158 TGAGGCATGGGCTGAGGAAGCGG + Intergenic
1044932025 8:97260141-97260163 GGAGGAGGGGGAGGGGGAAGGGG + Intergenic
1046707489 8:117471362-117471384 TGTGGAGTGGGGTGGGGGAGAGG - Intergenic
1046901995 8:119533747-119533769 TGAGGAGTGGGCAAAGGATGAGG + Intergenic
1047042121 8:121007710-121007732 TGGGAAGTGGGCATGGGAAGTGG + Intergenic
1047765982 8:127990283-127990305 GGGGGAATGGGCAGGGGAAGGGG - Intergenic
1047767259 8:128000141-128000163 GGAGCAGTGTGCAGGGGAAGAGG - Intergenic
1048007655 8:130432068-130432090 GGAGGAGGGGGAGGGGGAAGGGG + Intronic
1048507876 8:135036790-135036812 TGAGGCGTGGTCAGAGGAAGGGG + Intergenic
1049196459 8:141318351-141318373 TCAGAGGTGGGCCTGGGAAGTGG - Intergenic
1049236413 8:141514573-141514595 TCAGGAGTGGGCTGGGGCTGTGG - Intergenic
1049373860 8:142279941-142279963 TGAGGAGGAGGCCGGGGGCGGGG + Intronic
1049798128 8:144505709-144505731 GGAGGAGTGGGGCGGGGCGGCGG - Intronic
1050159353 9:2701034-2701056 TGAGGAGTGGGCCCAGGAATTGG + Intergenic
1050406018 9:5309454-5309476 TGAGGACTGGGTTGTGGAAGAGG - Intergenic
1051468842 9:17411776-17411798 GGTGGAGTGGGTCGGGGAGGTGG - Intronic
1052937943 9:34109179-34109201 TGAGGAGTGGGCCTATGAGGAGG - Intronic
1053329311 9:37188812-37188834 GGAGGAGAGGGGAGGGGAAGGGG - Intronic
1053739838 9:41127011-41127033 TGCGGAGTTGGCCAGGGAACTGG + Exonic
1053791194 9:41687405-41687427 TGAGGAGAAGGCAGGGGAGGTGG + Intergenic
1054153959 9:61627367-61627389 TGAGGAGAAGGCAGGGGAGGTGG - Intergenic
1054179542 9:61899099-61899121 TGAGGAGAAGGCAGGGGAGGTGG + Intergenic
1054442806 9:65283008-65283030 TGCGGAGTTGGCCAGGGAACTGG + Exonic
1054487472 9:65738493-65738515 TGCGGAGTTGGCCAGGGAACTGG - Exonic
1054657996 9:67681722-67681744 TGAGGAGAAGGCAGGGGAGGTGG - Intergenic
1054688512 9:68304302-68304324 TGCGGAGTTGGCCAGGGAACTGG - Exonic
1055830995 9:80378661-80378683 TGAGGAGCAGGCAGGGGAAGAGG + Intergenic
1056210123 9:84357570-84357592 TTGGGAGTGGACTGGGGAAGTGG + Intergenic
1056275008 9:84985909-84985931 TGAGGAGAGGGTGTGGGAAGGGG + Intronic
1056275821 9:84993180-84993202 AGAGGAGTGAGACTGGGAAGGGG - Intronic
1056331056 9:85521783-85521805 TGTGGCGTGGGCCGTGCAAGTGG - Intergenic
1056803604 9:89711349-89711371 AGAGGTGTGGGGCAGGGAAGGGG - Intergenic
1057316101 9:93969371-93969393 TGAGGTGTGGGCTGGGGCTGGGG + Intergenic
1057423042 9:94927526-94927548 GGAGGAGTCGGCCGGGGAGGAGG - Intronic
1057700596 9:97360828-97360850 TGAGGTGTGGGCAGGGGTGGGGG - Intronic
1057850708 9:98564956-98564978 AGAGGACTGAGCCGGGGAGGAGG + Intronic
1058842249 9:108921255-108921277 TGTGGGGTGGGGTGGGGAAGGGG - Intronic
1059718068 9:116932014-116932036 TGAGGGGTGGTAGGGGGAAGGGG + Intronic
1059887644 9:118764315-118764337 TGAGGAGTGGGCCAAGGAAAAGG + Intergenic
1060389609 9:123267669-123267691 GGAGGAGGGGGTCGGGGCAGGGG - Intronic
1060990279 9:127845051-127845073 TGAGGAATGTGCCGGGGGAAGGG + Intronic
1061180778 9:129023853-129023875 TGGGGAGTGTGACGAGGAAGAGG - Intronic
1061208432 9:129177360-129177382 GGAGGCGGGGGCCGGGGAGGCGG + Exonic
1061224453 9:129272670-129272692 GGAGGAGTTGCCCAGGGAAGGGG - Intergenic
1061382882 9:130268802-130268824 GGAGGAGTGGAGCGGGAAAGTGG + Intergenic
1061486390 9:130922621-130922643 TGGGGAGAGGGACGGGGAGGAGG - Intronic
1061809699 9:133155154-133155176 TGAGTAGTGGGCTGGGGAAGGGG - Intronic
1062045352 9:134422303-134422325 TGGGGAGTGTCCCGGGAAAGGGG - Intronic
1062074732 9:134579752-134579774 GGAGGAGGGGGAGGGGGAAGGGG + Intergenic
1062126099 9:134863910-134863932 TCAGGTGGGGGCGGGGGAAGGGG - Intergenic
1062254686 9:135615335-135615357 AGGGGTGTGGGCCGGGGCAGAGG - Intergenic
1062327472 9:136019144-136019166 TGAGCTGGGGGCCGGGGAGGTGG - Intronic
1062523674 9:136969852-136969874 TGAGGATGGGGGTGGGGAAGGGG - Intronic
1062697945 9:137884952-137884974 GGAGGAGGGGGGGGGGGAAGAGG - Intronic
1185537349 X:872880-872902 GGAGGAGAGGGGAGGGGAAGGGG - Intergenic
1185640524 X:1587867-1587889 GGAGGAGAGGGGAGGGGAAGGGG - Intergenic
1185640536 X:1587890-1587912 GGAGGAGAGGGGAGGGGAAGTGG - Intergenic
1185640546 X:1587913-1587935 GGAGGAGAGGGGAGGGGAAGGGG - Intergenic
1185640558 X:1587936-1587958 GGAGGAGAGGGCAGGGGAAGGGG - Intergenic
1185640570 X:1587960-1587982 GGAGGAGAGGGCAGGGGAAGAGG - Intergenic
1185640580 X:1587984-1588006 GGAGGAGAGGGGAGGGGAAGGGG - Intergenic
1187074091 X:15916585-15916607 TGAGGAGTAGGGAGGAGAAGAGG - Intergenic
1187708952 X:22034934-22034956 TGAGGAGAGGGACGGGGAGAGGG - Intronic
1188024542 X:25194713-25194735 TGAAATGTGGGTCGGGGAAGAGG + Intergenic
1189160775 X:38805819-38805841 GGAGGAGAGGGCCCGAGAAGGGG + Exonic
1189928884 X:45986692-45986714 TGAGATGTGGGCAGGAGAAGGGG + Intergenic
1190935571 X:54996355-54996377 TGAGGTCTGGGGAGGGGAAGTGG + Intronic
1191669791 X:63738578-63738600 TAAGCAGTGGGGCAGGGAAGTGG - Intronic
1192467511 X:71367629-71367651 TGGGGAGTAGGCGGGGGAGGAGG + Intronic
1193396130 X:80985673-80985695 TGAGGAGAGGGAGGGAGAAGGGG + Intergenic
1193507165 X:82358975-82358997 AGGGGAGGGGGCGGGGGAAGGGG + Intergenic
1194969463 X:100326939-100326961 AGAGGAGTGGTGGGGGGAAGAGG - Intronic
1195177750 X:102327095-102327117 TGAGGAGTGTGCCGGGTAGATGG - Intergenic
1195181114 X:102359998-102360020 TGAGGAGTGTGCCGGGTAGATGG + Intergenic
1195252410 X:103062129-103062151 TGGAGAGTGGGAGGGGGAAGAGG - Intergenic
1195280808 X:103330779-103330801 TGAGGAGTGGGGAGTGGAAACGG + Intronic
1196049930 X:111294021-111294043 TGCGGAGGGGGTGGGGGAAGAGG + Exonic
1196465787 X:115970292-115970314 TGGGGAGTGGACCTGGGCAGCGG - Intergenic
1196769576 X:119280664-119280686 GGAGGAGTGGGTAGGGCAAGGGG - Intergenic
1197009846 X:121546930-121546952 TCAGGAGTGTGACTGGGAAGTGG + Intergenic
1197312593 X:124924344-124924366 TGAGGATTGGACCTAGGAAGAGG + Intronic
1197395921 X:125927510-125927532 TGTGGGGTGGGACGGGGGAGGGG - Intergenic
1197457609 X:126697220-126697242 AGAGGAGGGGGTAGGGGAAGGGG + Intergenic
1198221089 X:134603197-134603219 TGAGGAGTGGGACTGGGGATGGG + Intronic
1198237309 X:134747359-134747381 TGAGGAGGGGGTGGGGAAAGTGG + Intronic
1199649815 X:149939814-149939836 TGAGGAGCAGGCCGGGGCAGTGG + Intergenic
1199767659 X:150952810-150952832 TGAGGAATGGGCCAAGGAAAAGG - Intergenic
1200034479 X:153318967-153318989 TGAGGATGGGGCTGGGGAGGCGG - Intergenic
1200045095 X:153396935-153396957 TGAGGATGGGGCCGGGGACGAGG - Intergenic
1200069908 X:153523439-153523461 TGAGGAGAGGGCCCAGGCAGAGG + Intronic
1200158908 X:153994376-153994398 GGAGGAGGGGGACGGGGAAGTGG + Intergenic
1200160700 X:154007040-154007062 TGAGCAGGCTGCCGGGGAAGTGG + Intergenic
1200246908 X:154531333-154531355 TGGGGAGTGGGACAAGGAAGTGG + Intergenic
1200780360 Y:7210121-7210143 TGGGGAGTGGGCCTGGGTGGGGG - Intergenic
1201758811 Y:17516841-17516863 TGAGGAGTGTGCTGAGGAGGAGG - Intergenic
1201842744 Y:18389149-18389171 TGAGGAGTGTGCTGAGGAGGAGG + Intergenic