ID: 912401638

View in Genome Browser
Species Human (GRCh38)
Location 1:109398044-109398066
Sequence AGCCAATGAGGAGTGGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401638_912401652 12 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401638_912401655 27 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401655 1:109398094-109398116 GGATTCGGATGCTAAGATGCGGG 0: 1
1: 0
2: 1
3: 2
4: 43
912401638_912401654 26 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401654 1:109398093-109398115 TGGATTCGGATGCTAAGATGCGG 0: 1
1: 0
2: 0
3: 4
4: 70
912401638_912401648 0 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39
912401638_912401647 -1 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401638_912401644 -9 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401644 1:109398058-109398080 TCATTGGCTCGCGTCGCCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 25
912401638_912401645 -3 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34
912401638_912401649 6 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401638_912401646 -2 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401638 Original CRISPR AGCCAATGAGGAGTGGGCCG GGG (reversed) Intergenic
900357287 1:2271009-2271031 GCCCAGTGAGGAGTGGGCTGGGG + Intronic
900596553 1:3482725-3482747 TGCCAGTGAGGTGTGGGCCCAGG + Intergenic
900807495 1:4776945-4776967 AGGCCACCAGGAGTGGGCCGTGG - Intronic
900824624 1:4916508-4916530 GGCCAACGAGGAGTGGGGCTTGG - Intergenic
902605239 1:17565482-17565504 AGGCAATGAGGAGTTGGAGGGGG - Intronic
904062171 1:27720283-27720305 AGACAATGAGGAGAAGGCAGGGG - Intergenic
904285755 1:29452348-29452370 AGCCAATGATGGGTGGGTGGAGG + Intergenic
905518317 1:38578407-38578429 AGCCAGAGAGGAGGGGGCGGCGG + Intergenic
907289895 1:53407058-53407080 AGAGAATTAGGAGAGGGCCGAGG + Intergenic
907535996 1:55157882-55157904 AGCCAATTAGCAGTGGTCCAGGG - Intronic
911357139 1:96836269-96836291 AGCCAATGAGGAGGAGGAGGAGG + Intergenic
912401638 1:109398044-109398066 AGCCAATGAGGAGTGGGCCGGGG - Intergenic
915540050 1:156559969-156559991 AGCCAGTCAGGAGTGGCCCGGGG + Intronic
916028864 1:160859291-160859313 AGACAAAGAGGAGTGGGTCTTGG + Intronic
921207131 1:212858464-212858486 AGACGATGAGGAGGGGGCGGCGG + Exonic
922796837 1:228343632-228343654 AGCCAACGGGGAGTGGGCAGGGG + Intronic
1062970274 10:1642936-1642958 TGCTAATTAGGAGGGGGCCGCGG - Intronic
1063041753 10:2347524-2347546 AGCCAAATAGGAGTGGCCAGTGG + Intergenic
1063620715 10:7645849-7645871 AGGCAATGAGGATTAGGCTGGGG + Intronic
1069138638 10:64796790-64796812 AGCCAAAGAGGAGGGGCCAGAGG + Intergenic
1072053598 10:91730788-91730810 AGCCAAGGGGGAGTGGGTGGTGG + Intergenic
1072468967 10:95693998-95694020 AGCCAATGAGAAGAGGCACGCGG - Exonic
1074562740 10:114548425-114548447 AGCCAACGAGGAGTTAGCTGGGG - Intronic
1074781597 10:116806314-116806336 AGCCACTGAGGAGGAGGCTGAGG - Intergenic
1075407918 10:122206867-122206889 AGCCACTGGGGGGTGTGCCGAGG - Intronic
1076377402 10:130000954-130000976 AGCCAGTGGGGAGTGGGTGGAGG - Intergenic
1076814856 10:132909650-132909672 TCCCAAGGAGGAGTGGGCCCAGG - Intronic
1077442862 11:2576819-2576841 AGCCAAGGCGCCGTGGGCCGAGG + Intronic
1077533015 11:3106073-3106095 GGCCTATGGGGAGTGGACCGAGG - Intronic
1078748857 11:14141028-14141050 AGCCAGTGAGAAGTGGGGCATGG - Intronic
1081566702 11:44264952-44264974 AGCCATTGAGGCCTGGGCTGAGG + Exonic
1083033679 11:59616379-59616401 ACCTAATGAGGAGCAGGCCGGGG + Intergenic
1083610334 11:64001218-64001240 AGCCGATGAGGGGTGAGCCCGGG - Intronic
1084087568 11:66861613-66861635 CGCCATGGAGGAGTGGGCGGGGG + Intronic
1084428391 11:69097885-69097907 AGCCATGCAGGGGTGGGCCGGGG - Intergenic
1085301363 11:75460760-75460782 AGACTATCAGGACTGGGCCGGGG + Intronic
1088927807 11:114320044-114320066 AGCCCAAGAGGAGTGGGCTGGGG - Intergenic
1089525778 11:119095512-119095534 AGCCAATCAGGAGGGCGCAGAGG - Intergenic
1096590962 12:52659047-52659069 GGCCAAGGAGGAGTTGGCAGGGG + Intergenic
1096784492 12:54009245-54009267 AGCCAGAGGGGAGGGGGCCGCGG + Exonic
1097270626 12:57771956-57771978 CGCTAGTGAGGAGTGGGCAGAGG - Exonic
1097380961 12:58895284-58895306 AGGAAAGGAGGAGTGGGCAGTGG + Intronic
1098979201 12:76936803-76936825 AGCAAATGAGGACGGGGCAGGGG - Intergenic
1102441177 12:112964973-112964995 AGCCCATGAGGACTAGGCGGGGG - Intronic
1102714539 12:114958833-114958855 AGCCAATGAGGGGAGGCCCCTGG + Intergenic
1102792416 12:115658344-115658366 AACCAATGAGGAATGGGGTGTGG - Intergenic
1103919167 12:124390550-124390572 TGCCGATGAGCAGTGGGACGAGG - Intronic
1112398154 13:99052281-99052303 AGGCAGTGAGTAGTGGGCCAGGG - Intronic
1112440520 13:99421534-99421556 AGACAGTGAGGACTGGGCTGAGG - Intergenic
1114736998 14:25051774-25051796 TGCCAATGAGTAGTGTGCCGGGG + Intergenic
1114901837 14:27070972-27070994 AGACAATGAAGAGTGGGGAGAGG + Intergenic
1117376307 14:55121304-55121326 AGCCAATGAGGATTAGGGTGCGG - Intergenic
1121245559 14:92458921-92458943 AGCTTATGAGGGGTGGGGCGAGG + Intronic
1124785054 15:32671867-32671889 AGGCAAAGCGGAGTGGGGCGAGG - Intronic
1128384085 15:67134926-67134948 AGCCACTGAGGGGTGGGGCTGGG + Intronic
1128882383 15:71255710-71255732 AGCCAGTGAGGTGTGGGGCCTGG - Intronic
1129116521 15:73368156-73368178 CGCCGAGGAGGAGGGGGCCGGGG - Exonic
1129740132 15:77986067-77986089 AGCCAAGGAGGAGGGGGCACCGG + Intronic
1129758526 15:78113095-78113117 AGCCAATGAGCAGTGGGAACAGG + Intronic
1130012372 15:80161659-80161681 AGAAAATGAGGACTGGGCTGGGG + Intronic
1132196736 15:99919267-99919289 AGCTCAAGTGGAGTGGGCCGAGG - Intergenic
1132550486 16:551994-552016 AGCCACGGAGGTGTGGGCCGTGG + Intronic
1133326498 16:4945245-4945267 AGCCACTGAGGGGTTAGCCGTGG + Intronic
1136220341 16:28823922-28823944 AGCCAATGGGGAGTCTGCTGCGG + Intronic
1137763906 16:50962919-50962941 AGGCAGTGAGCAGTGGGCCTGGG + Intergenic
1141764053 16:86047062-86047084 AGCCGCTGAGGGGTGGGCGGTGG + Intergenic
1142105151 16:88298707-88298729 AGCCAGTGAGGAGTGGGGAGAGG - Intergenic
1143525104 17:7467267-7467289 AGCCAACATGGAGTGGGGCGGGG + Exonic
1143548554 17:7614685-7614707 AGCCAACGAGCAGGGGGCCGGGG + Exonic
1144835900 17:18156636-18156658 TGCCAGTCAGGAGTGGGCAGAGG - Intronic
1144851603 17:18246764-18246786 AGACAAGGAGGAGAAGGCCGAGG - Exonic
1149681937 17:58513408-58513430 AGACAAAGAGGAGTGGGTGGGGG + Intronic
1150905025 17:69327534-69327556 GGCAGATGAGGAGAGGGCCGTGG - Intergenic
1151443334 17:74147830-74147852 AGACAGTGAGGAGTGGGGCTGGG - Intergenic
1152360073 17:79828741-79828763 TGACAATGAGTAGTGGGCGGGGG + Intergenic
1160453411 18:78979999-78980021 CGCCGACGAGGAGGGGGCCGCGG - Intergenic
1162046869 19:8005706-8005728 GGCCAATGAGCAGCGCGCCGTGG - Intronic
1162371121 19:10280027-10280049 AGCCAATGAGCAGTTGGCTATGG + Intronic
1163737585 19:18990740-18990762 AGCCAGTGAGGAGGGGCCCGAGG + Intergenic
1163758630 19:19121164-19121186 AGCCTGTGCGGAGAGGGCCGGGG + Exonic
1163844527 19:19630731-19630753 GACCAAAGAGGAGTGGGCCCAGG + Intronic
1163844851 19:19632765-19632787 TACCAAAGAGGAGTGGGCCCAGG - Intronic
1166998707 19:46732397-46732419 AGGCAGTGAGGCGTGGGCTGCGG - Intronic
1167253943 19:48415970-48415992 GGGCGATGAGGAGTGGGCGGGGG - Intronic
1167426597 19:49432784-49432806 AGCCCAGGAGGAGAGGGCAGGGG - Intronic
1167520455 19:49951618-49951640 AGGAAATGAGGAGTGGGAGGTGG + Intronic
1168333891 19:55586011-55586033 AGCCAATGAGGAGGGGGAGACGG - Intergenic
925274165 2:2637150-2637172 AGCCACTGAGGTGTGGGTCAGGG - Intergenic
926088025 2:10032337-10032359 AGTCTCTGAGGAGTGGGCAGCGG - Intergenic
929217173 2:39427254-39427276 AGACAATGAGGAGGGGGAGGAGG + Intronic
931200421 2:60092391-60092413 GGCCAGTGAGAAGTGGGCCATGG - Intergenic
931643891 2:64404456-64404478 AGCCAATGAGTTGGGGGCAGGGG + Intergenic
932774048 2:74516463-74516485 AGCCAATGAGGTGCGGGGAGGGG + Exonic
934979715 2:98829774-98829796 AGCCGCTGAGGAGTGGGCTGGGG + Intronic
937256782 2:120561297-120561319 AGTCAATGAGGGCTGGGCAGAGG - Intergenic
942163524 2:173217340-173217362 AGGAAATGAGGAGGGGGCGGCGG - Intronic
944913583 2:204334303-204334325 TGGCAAGGAGGAGTGGGCCAGGG - Intergenic
946433843 2:219639533-219639555 AGCCAATGAGGAGCAGGTCCAGG - Exonic
947118792 2:226797101-226797123 AGCCACTGAGGACTGGGACGGGG + Exonic
947650332 2:231781087-231781109 AGCCAAGGACGAGCGGGCCAGGG - Exonic
1169198761 20:3697485-3697507 AGCCTAGGAGAAGTGGGCCCTGG + Intronic
1171335859 20:24384825-24384847 GGCCATTGAGGAATGGGCTGAGG + Intergenic
1173570553 20:44073030-44073052 AGCCAGTGGTGAGTGAGCCGGGG + Intergenic
1173850147 20:46212679-46212701 AGGCAATGAGGAGTGTGAAGAGG + Intronic
1174346804 20:49936361-49936383 GGCCGATGAGGAGGAGGCCGAGG - Intergenic
1176167369 20:63681180-63681202 GGCCAATGAGAAGGGGGCCAGGG - Intronic
1180085238 21:45505282-45505304 AGTCAGTGGGGAGTGGGCCCCGG + Intronic
1180109576 21:45641905-45641927 AGGGAATGTGGAGTGGGGCGGGG - Intergenic
1183604462 22:38860414-38860436 AGGCAAGGAGGAGGGGGGCGGGG + Intergenic
1184924141 22:47625728-47625750 AGCAAAGCAGGAGTGGGCAGAGG - Intergenic
1185417385 22:50717718-50717740 AGGCAATGAGGAGTGCACAGAGG - Intergenic
950502729 3:13374714-13374736 AGACAATGAGGAATGGGCAGGGG - Intronic
951419247 3:22464408-22464430 AGCTAATGAATAGTGGGCCAAGG - Intergenic
952117162 3:30196443-30196465 GGCCAATGAGGAGTAAGCAGAGG + Intergenic
953496575 3:43392829-43392851 AGCCAATGTGGAGTGGTTTGGGG - Intronic
954877799 3:53814439-53814461 AGACAATGAGGAGCAGGCCTGGG + Exonic
955348543 3:58178182-58178204 AGCCAATGTGAAGTGCGCCTAGG + Intergenic
961182682 3:124888390-124888412 AGCCAATAAAGAGTGGGGTGGGG + Intronic
961463603 3:127068454-127068476 AGCCCAGAAGGATTGGGCCGTGG + Intergenic
961464288 3:127072027-127072049 AGCCAATGAAGAGTGGAGCCAGG - Intergenic
961506322 3:127372541-127372563 AGCCAAGGAGTATTGGGCCTGGG - Intergenic
961745812 3:129062826-129062848 AGCCAAGGTGGAGTGGTCAGAGG - Intergenic
961781317 3:129322072-129322094 AGATGATGAGGAGTGGGCAGGGG - Intergenic
961912117 3:130328654-130328676 AGCCAATGAATAGTGGCCAGGGG + Intergenic
962344599 3:134610055-134610077 AGCCGAGGAGGAGTGGGCATGGG + Intronic
962492965 3:135911433-135911455 AGCCAATGAGGTGTGAGAAGAGG - Intergenic
967305115 3:188052146-188052168 AGGCAATGGGGAGTGGGAGGGGG + Intergenic
968567055 4:1318555-1318577 AGCCCATGAGGACTGGGTTGCGG + Intronic
968610962 4:1556818-1556840 AGGGAATGAGGAGGGGGCCCGGG - Intergenic
972833169 4:42837155-42837177 AGCCAATGAGAAGTGGGGCTTGG + Intergenic
976111887 4:81684477-81684499 AGCCAATGAGCAGTGTGCCATGG + Intronic
985041452 4:185895437-185895459 AGCCAAGGAGGTGAGGGCAGTGG + Intronic
985673716 5:1219515-1219537 AGCCAATGAGGAATGTCCCCAGG - Exonic
988737897 5:34040772-34040794 AGCCTGTGAGGAGTTGGCTGTGG - Intronic
988847369 5:35141807-35141829 ATCCAATGAGGAGTTGGGGGTGG - Intronic
996424099 5:123294059-123294081 AGCTAAGGAGGAGAGGGCCGTGG + Intergenic
997645353 5:135477964-135477986 AGCCAGGGAGGAGTGGACAGAGG - Intergenic
997661372 5:135591679-135591701 AGCCAATGGGGAGTGGGAGCTGG + Intergenic
999115102 5:149155883-149155905 AGCCAATGAGGAGTCAGGAGAGG + Intronic
999637214 5:153635385-153635407 AGCCAAAGAGAAGTGGGTTGTGG - Intronic
1001147517 5:169197697-169197719 AGCAAATGAGATGTGGGCCAGGG + Intronic
1002129426 5:177071067-177071089 AGCCAATGAGGGGTGGCATGAGG + Intronic
1002457026 5:179351119-179351141 AGCCCAAGGGGACTGGGCCGAGG - Intergenic
1002564134 5:180100476-180100498 AGCCAGCAAGCAGTGGGCCGGGG - Intergenic
1005197721 6:23308913-23308935 ATCCAATGGGGATTGGGCCCGGG - Intergenic
1005334215 6:24776593-24776615 GGCCAATGGGTAGTGGGCAGTGG + Intronic
1006176861 6:32127815-32127837 AGCCAATGAGGGATGGGGCGGGG - Intronic
1006332783 6:33404292-33404314 AGACAGTCAGGAGTGGGCTGGGG - Intronic
1006639922 6:35484642-35484664 AGAAAATGAGGAGTGGGCAAAGG + Intronic
1006932519 6:37696714-37696736 AGCCAAGGTGGAGCGGGACGCGG + Intronic
1007125643 6:39423451-39423473 GGAAAATGAGGAGTGGGCCTAGG - Intronic
1011681662 6:89789373-89789395 AGCTACAGAGGAGTGGGCTGAGG - Intronic
1013195422 6:107840817-107840839 AGGCAATGGAGAGTGGGACGGGG + Intergenic
1013507716 6:110815915-110815937 CGCCAATGAGCAGCGGGACGGGG - Intronic
1017631697 6:156402254-156402276 AGCCAATAAGGAGTGTGTTGTGG + Intergenic
1017748697 6:157469952-157469974 AGCCAGTGAGTGGTGGGCCTGGG - Intronic
1018926418 6:168209797-168209819 AGCCAGTGAGTGGTGAGCCGAGG - Intergenic
1019528584 7:1492804-1492826 GGCCCATGGGGAGTGGGGCGCGG + Intronic
1019702068 7:2478852-2478874 GGCCAGCGGGGAGTGGGCCGGGG - Intergenic
1022734481 7:33063018-33063040 TGCTAATGAGGATTAGGCCGTGG + Intergenic
1023839138 7:44086104-44086126 AGGCAGTGAGGAGTGGGTCTGGG + Intergenic
1023875070 7:44282438-44282460 GGACACTGAGGAGTGGGCTGGGG - Intronic
1024376062 7:48639378-48639400 AACCCATGAGGAGTGGGGTGTGG + Intronic
1026785698 7:73300469-73300491 AGCCAGTGAGCAGAGGGCGGAGG - Intergenic
1027108368 7:75419467-75419489 AGCCAGTGAGCAGAGGGCGGAGG + Intronic
1028999486 7:97138451-97138473 AGCCAATGAGGGCTGGGCAGTGG - Intronic
1030730819 7:112986332-112986354 GGGCAGTGAGGAGAGGGCCGGGG + Intergenic
1034346634 7:150389284-150389306 AGGCAATGAGGAAGGGGCCCTGG - Intronic
1034531905 7:151701089-151701111 AGCCCCTGAGGAGTGGGAGGTGG - Intronic
1035287836 7:157817399-157817421 AGACAATGAGGAGCAGGCTGTGG + Intronic
1040997429 8:53416204-53416226 AGCCCATGAGGAGTGTGGAGAGG + Intergenic
1041914336 8:63124993-63125015 ATCCAATGAGGACGGGGCTGGGG + Intergenic
1041952301 8:63517216-63517238 AGCGGCTGAGGAGTGGGCTGGGG + Intergenic
1042448299 8:68915481-68915503 ATCCAATGAGGAGTGAGGTGGGG + Intergenic
1042875583 8:73437786-73437808 GGCCCGTGAGGAGTGGGCAGAGG - Intronic
1052184020 9:25567585-25567607 AGCCAATGTGGAGAGGGCTGTGG - Intergenic
1055164943 9:73179864-73179886 AGCCAGTGAGGAGTCGGGCTGGG - Intergenic
1056230924 9:84542695-84542717 AGCTAATGAGGTGTGTGCAGGGG - Intergenic
1057423044 9:94927532-94927554 AGGGAAGGAGGAGTCGGCCGGGG - Intronic
1057832773 9:98419571-98419593 AGGCAAAGAGGAGTGGGAGGTGG + Intronic
1057911621 9:99024098-99024120 TGGCCATGAGGAGTGGGCAGAGG - Intronic
1059388942 9:113986760-113986782 AGCTAATGAGGAGAGGACAGAGG - Intronic
1060742181 9:126106399-126106421 AGCCAGTGAGTAGTGGAGCGGGG - Intergenic
1061105737 9:128528980-128529002 AGGCAATGAGAAGTGAGTCGGGG - Intronic
1061570758 9:131476236-131476258 CGCCAATGAGGAGTGGGAGACGG + Exonic
1061800080 9:133108963-133108985 AGCCAAGGGGGCTTGGGCCGGGG - Intronic
1062064366 9:134518232-134518254 AGCTAATGAGAAGGGGGCCGTGG + Intergenic
1062333433 9:136054559-136054581 ACCCAGAGAGGAGGGGGCCGAGG + Intronic
1062418090 9:136463738-136463760 GGCCTACGAGGAGAGGGCCGTGG + Exonic
1187173316 X:16871313-16871335 AGCCCCTGAGGAGTGTGTCGGGG + Intergenic
1199912886 X:152307107-152307129 AGCCAATAAGGAGTTGACCCAGG - Intronic