ID: 912401639

View in Genome Browser
Species Human (GRCh38)
Location 1:109398045-109398067
Sequence GAGCCAATGAGGAGTGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 252}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401639_912401649 5 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401639_912401646 -3 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401639_912401654 25 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401654 1:109398093-109398115 TGGATTCGGATGCTAAGATGCGG 0: 1
1: 0
2: 0
3: 4
4: 70
912401639_912401652 11 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401639_912401647 -2 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401639_912401648 -1 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39
912401639_912401655 26 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401655 1:109398094-109398116 GGATTCGGATGCTAAGATGCGGG 0: 1
1: 0
2: 1
3: 2
4: 43
912401639_912401644 -10 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401644 1:109398058-109398080 TCATTGGCTCGCGTCGCCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 25
912401639_912401645 -4 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401639 Original CRISPR GAGCCAATGAGGAGTGGGCC GGG (reversed) Intergenic
900357286 1:2271008-2271030 GGCCCAGTGAGGAGTGGGCTGGG + Intronic
901930869 1:12595587-12595609 GAGCGGGTGAGGAGGGGGCCAGG + Intronic
902545801 1:17189713-17189735 GCACCAATAAGGAATGGGCCAGG + Intergenic
904372229 1:30057087-30057109 GAGCGAGTTGGGAGTGGGCCTGG + Intergenic
904463416 1:30693734-30693756 GAGCCTCTGATGAGTGGGGCTGG - Intergenic
906210509 1:44010198-44010220 GACCCAGGGAGGAGTGTGCCAGG + Intronic
906263198 1:44408084-44408106 GGGCCAAAGAGTAGTGGGCTCGG + Intronic
906324476 1:44836264-44836286 GAGCAAATGAGAAGTTGGCTGGG + Intronic
906480346 1:46195365-46195387 GAGGAATTGAGGAGTGAGCCAGG - Intronic
906654474 1:47537640-47537662 GAGACAGGGAGGAGGGGGCCAGG - Intergenic
907241522 1:53083849-53083871 GAGCTGGTGAGGAGTGAGCCAGG + Intronic
907303503 1:53502087-53502109 GAGCCAGAGAGGAGTGGGTAGGG + Intergenic
907535997 1:55157883-55157905 GAGCCAATTAGCAGTGGTCCAGG - Intronic
908475547 1:64484210-64484232 GAGCCAATCAGGGGAGGGGCTGG + Intronic
908629335 1:66085066-66085088 GAGCCAATGAGAACAGAGCCTGG - Intronic
911188111 1:94923997-94924019 GAGACAGTGTGGAGTGGACCTGG - Intronic
911612342 1:99970482-99970504 GAGCTAGTGACGGGTGGGCCCGG + Exonic
912401639 1:109398045-109398067 GAGCCAATGAGGAGTGGGCCGGG - Intergenic
912749513 1:112274401-112274423 GAGACAATGAGGAGTAGAGCAGG - Intergenic
912810639 1:112791558-112791580 GATCCAATCAGGAGTGTGTCTGG + Intergenic
915540049 1:156559968-156559990 CAGCCAGTCAGGAGTGGCCCGGG + Intronic
917646648 1:177035192-177035214 CAGCAAATGAGGAGTGGGACTGG + Intronic
919130928 1:193449449-193449471 GAGCCAGTGGGGAGTGGGGGTGG + Intergenic
919444292 1:197682676-197682698 GAGCGAATAAGAAGTTGGCCAGG + Intronic
920115275 1:203616378-203616400 GAGGCAAGGAGGAGTGGGGGAGG - Intergenic
922796836 1:228343631-228343653 AAGCCAACGGGGAGTGGGCAGGG + Intronic
924671275 1:246128623-246128645 CAGCCAGTGAGCAGTGGGGCTGG + Intronic
1064854323 10:19748348-19748370 GAGTGATTGAGGAGTAGGCCAGG - Intronic
1065001359 10:21340618-21340640 ATGCCAATGAGAATTGGGCCAGG + Intergenic
1066281566 10:33923193-33923215 GCACCAATGAAGAGTGGGACAGG + Intergenic
1067797690 10:49332628-49332650 GAGGCAAAGAGGTGTGGGACAGG + Intergenic
1069617728 10:69816844-69816866 GAGCCAGGTAGGAGTGGTCCAGG + Intronic
1069961541 10:72082025-72082047 GATCCCCTGAGGAGTGGGTCTGG - Intronic
1070313961 10:75293958-75293980 GGGACAGTGGGGAGTGGGCCTGG + Intergenic
1070377228 10:75844517-75844539 GAGCCAAGATGGAGTGAGCCCGG - Intronic
1070714138 10:78706514-78706536 AGGCTAATGAGGGGTGGGCCTGG - Intergenic
1071536764 10:86439703-86439725 GAGCCAAGGAAGACTGGGCAAGG + Intronic
1072986051 10:100141664-100141686 GGGCCCATGAGGATGGGGCCAGG + Intergenic
1073139835 10:101239789-101239811 AAGACACTGAGCAGTGGGCCTGG - Intergenic
1074048324 10:109859916-109859938 GAGCCAAAGAGGAGCAGGACAGG - Intergenic
1074770284 10:116729188-116729210 GAGCCAATGAGGAGCACGCCGGG + Intronic
1075728201 10:124621297-124621319 GAGCAAATGTGGAGGCGGCCAGG - Exonic
1075733456 10:124649967-124649989 GAGCCTGCGAGGAGAGGGCCTGG - Intronic
1076344827 10:129773163-129773185 CTGCCAATGAGGAATGGCCCTGG + Intergenic
1076392121 10:130110856-130110878 GAGCCAATAAGGAGAGGGAGGGG + Intergenic
1076872619 10:133201193-133201215 GAGCCAGCGAGGACAGGGCCCGG + Intronic
1076907553 10:133370878-133370900 GAGCCACTGAGGACTCGGCAGGG - Intronic
1077118978 11:898132-898154 GAGCCCATGAGGGGTAGGGCAGG - Intronic
1077216273 11:1396435-1396457 GAGGCCATGATGAGAGGGCCCGG - Intronic
1078335804 11:10462413-10462435 GAGCCAAGGTGGAGTCGCCCTGG + Intronic
1078891930 11:15565488-15565510 GAGCCACTGAGATGTGGGCAAGG - Intergenic
1080423807 11:32138071-32138093 GAGCCATTGAGAAGTGAGACAGG - Intergenic
1080669094 11:34359233-34359255 GAGCCATTCAGGAGTGGGGGAGG - Intergenic
1081957630 11:47107277-47107299 GAGCCCAGGAGGAGTGTTCCAGG - Intronic
1083033678 11:59616378-59616400 GACCTAATGAGGAGCAGGCCGGG + Intergenic
1083189050 11:61036408-61036430 GAGGCCATGAGCAGTGGGGCAGG - Intergenic
1083299528 11:61732987-61733009 GAGTCAGTGATGTGTGGGCCAGG - Intronic
1083610335 11:64001219-64001241 CAGCCGATGAGGGGTGAGCCCGG - Intronic
1083945214 11:65919558-65919580 GAGCCCGGCAGGAGTGGGCCCGG + Intronic
1084050397 11:66595702-66595724 GAGCCAACCAAGGGTGGGCCTGG + Intronic
1084621075 11:70270709-70270731 GAGCGGAGGAGGAGCGGGCCCGG - Exonic
1084937537 11:72595169-72595191 GAGGCTATGAGGACTGGGTCAGG - Intronic
1084972234 11:72778190-72778212 GAGCCCATGTGGAGAGGGGCAGG + Intronic
1085301362 11:75460759-75460781 GAGACTATCAGGACTGGGCCGGG + Intronic
1085836164 11:79958956-79958978 GAGGCAGGGAGTAGTGGGCCAGG + Intergenic
1086399185 11:86446898-86446920 GAGCTAATAAGGAGTGGAGCTGG - Intronic
1088927808 11:114320045-114320067 CAGCCCAAGAGGAGTGGGCTGGG - Intergenic
1090756099 11:129793195-129793217 GATCCAAGGATGAGAGGGCCTGG - Intergenic
1090915378 11:131158140-131158162 GAGCCAGTAAGGGGTGAGCCTGG + Intergenic
1091622262 12:2098063-2098085 GAGCAAATGAGTGATGGGCCTGG + Intronic
1093852264 12:24054942-24054964 GAGCAAATGAGGAATGGGAATGG + Intergenic
1094524307 12:31221594-31221616 GTGACAATCAGGTGTGGGCCAGG + Intergenic
1096295533 12:50380904-50380926 GAGCAAGTGAGCATTGGGCCCGG + Intronic
1096590961 12:52659046-52659068 GGGCCAAGGAGGAGTTGGCAGGG + Intergenic
1099093318 12:78340419-78340441 GAGCCAAAGAGGAGGGGCCCAGG - Intergenic
1102005316 12:109585972-109585994 GTGGCAGTGAGGAGTGGGGCTGG - Intronic
1105279967 13:18957756-18957778 AAGCCACAGAGCAGTGGGCCTGG - Intergenic
1105746052 13:23377772-23377794 AAGGCCAGGAGGAGTGGGCCAGG - Intronic
1105930418 13:25047237-25047259 GAGCAAATGAGGAGGGCGCAGGG - Intergenic
1106563286 13:30864566-30864588 GAGTCAGTGAGGAGGGGGCTGGG + Intergenic
1107627800 13:42307679-42307701 GAACATAGGAGGAGTGGGCCAGG + Intronic
1110499391 13:76209154-76209176 GAGGCAATGAAAAGTGGGGCAGG - Intergenic
1111232337 13:85360670-85360692 GAGCCAATCAGGAGTTGCCTAGG - Intergenic
1112220639 13:97486409-97486431 CAACTAATGAGGAGTTGGCCAGG + Intergenic
1112226233 13:97543398-97543420 GAGGAACTGATGAGTGGGCCAGG - Intergenic
1112398155 13:99052282-99052304 CAGGCAGTGAGTAGTGGGCCAGG - Intronic
1112557550 13:100482484-100482506 GAACCAAGGATGGGTGGGCCTGG + Intronic
1114522878 14:23349767-23349789 GAGCTAATGGTCAGTGGGCCTGG + Intronic
1114736997 14:25051773-25051795 GTGCCAATGAGTAGTGTGCCGGG + Intergenic
1115993774 14:39175085-39175107 GAGCCAATGAAAAGTCAGCCAGG - Intergenic
1119212798 14:72845472-72845494 GAGGCCAGCAGGAGTGGGCCAGG - Intronic
1121048427 14:90804465-90804487 GAGCAAATGAGATCTGGGCCGGG + Intronic
1122463901 14:101917548-101917570 GAGGCCATGGGGTGTGGGCCAGG + Intronic
1126101405 15:45120333-45120355 GACCCAGTGAGGACTGGCCCAGG + Intronic
1128384084 15:67134925-67134947 GAGCCACTGAGGGGTGGGGCTGG + Intronic
1128544099 15:68555806-68555828 GAGCCAGGGAGGAGGGGGACAGG + Intergenic
1129892026 15:79077870-79077892 GAGGCAATGAGCAGAGGCCCAGG - Intronic
1130909873 15:88263553-88263575 GAGCCGAGCAGGAGTGGGCTGGG - Intergenic
1132032598 15:98450733-98450755 GAAACAAAGAGGAGAGGGCCTGG + Intronic
1133317812 16:4895005-4895027 GAGCCAATGAGAACCTGGCCTGG + Intronic
1134436855 16:14267651-14267673 GAGCCCAAGAGGAGTGAGCAAGG + Intergenic
1134628119 16:15737382-15737404 GAGCGAATGAGCAGGGGCCCAGG + Intronic
1134834221 16:17347724-17347746 GAGCCAGCGAGGCGGGGGCCCGG + Intronic
1135308637 16:21388273-21388295 GAGACATTGTGGAGGGGGCCTGG + Intergenic
1135526166 16:23215222-23215244 AAGCCAAGGAGTGGTGGGCCTGG + Exonic
1136046213 16:27617335-27617357 GTGCCAATGAGAAGCAGGCCTGG - Intronic
1136101562 16:28000452-28000474 GAGCTAATCAGGAGTTGGCTGGG + Intronic
1136111704 16:28067587-28067609 GAGCCAGAGAGGAGGGAGCCAGG - Intergenic
1136148216 16:28328582-28328604 GAGACATTGTGGAGGGGGCCTGG + Intergenic
1136305379 16:29367404-29367426 GAGACATTGTGGAGGGGGCCTGG + Intergenic
1137763905 16:50962918-50962940 CAGGCAGTGAGCAGTGGGCCTGG + Intergenic
1137847867 16:51709710-51709732 GAGCCTATGAGGAGGGCTCCAGG + Intergenic
1141336343 16:83158751-83158773 GAGTCACTGAGCAGTGTGCCTGG + Intronic
1141839738 16:86567059-86567081 GAGCCAGCGAGGAGCGGGGCCGG + Intergenic
1141866242 16:86751989-86752011 GAGCCAGTGAAGAATGGGCTAGG + Intergenic
1141910722 16:87056838-87056860 GAGCCTGAGAGGTGTGGGCCGGG + Intergenic
1142136138 16:88452910-88452932 GGGCCAAAGAGGAGTGGGGGAGG + Intergenic
1143280694 17:5752084-5752106 GAGGCAATGAAGGCTGGGCCAGG + Intergenic
1143548553 17:7614684-7614706 CAGCCAACGAGCAGGGGGCCGGG + Exonic
1144779114 17:17799087-17799109 GAGCCAATGGTGAGAGGGTCTGG - Intronic
1147456841 17:40543162-40543184 CAGCCAATCAGGAGTTGGTCTGG + Intergenic
1148877552 17:50699627-50699649 GTGCCAAAGAGGTGTGGTCCCGG + Exonic
1149681936 17:58513407-58513429 GAGACAAAGAGGAGTGGGTGGGG + Intronic
1149891009 17:60391055-60391077 GAGCCAATAAGCAGCAGGCCGGG + Intronic
1150980560 17:70137078-70137100 AAGCAAAAGAGCAGTGGGCCTGG - Intergenic
1151443335 17:74147831-74147853 CAGACAGTGAGGAGTGGGGCTGG - Intergenic
1151462109 17:74260523-74260545 GTGGCAGTGAGGAGGGGGCCAGG + Exonic
1151732651 17:75920498-75920520 GGTCCAGTGAGCAGTGGGCCAGG - Intronic
1152310925 17:79549318-79549340 GAGCCCCAGAGGAGTGGGCTGGG - Intergenic
1152427349 17:80225473-80225495 GAGCCAATGGGGGTGGGGCCAGG + Intronic
1152606779 17:81295368-81295390 GAGCCAATGAGAGGCGGGCCCGG + Intronic
1153655479 18:7278288-7278310 GGGCCAATGAGAATTGGCCCTGG - Intergenic
1157431141 18:47627504-47627526 GAGCCAATGAGTTGTTGCCCAGG + Intergenic
1158050505 18:53212237-53212259 AAGCCAATGAGAGGTGGGGCTGG - Intronic
1158247756 18:55451333-55451355 GAGCCTGGGAGGGGTGGGCCAGG + Intronic
1160452726 18:78977079-78977101 GAGCCTTGGAGGAGAGGGCCCGG - Intergenic
1161818670 19:6516069-6516091 GAGGGACTGAGGAGTGGGCAGGG + Intergenic
1162849969 19:13423455-13423477 AAGCCAATGCTGTGTGGGCCAGG + Intronic
1162905059 19:13818304-13818326 GGGCCAATGAGGAGCAGGCCGGG - Intronic
1163248499 19:16111809-16111831 GAGCCAATAAGGGGCGGGCTCGG + Exonic
1163314494 19:16532761-16532783 GAGCCAATGACGAGTGAGCAGGG + Intronic
1165394903 19:35558741-35558763 GAGCCTAGGAGGAGGGGGCTCGG - Intronic
1166410600 19:42553692-42553714 GAGCAGATGAGGAAGGGGCCTGG - Intronic
1166728904 19:45046580-45046602 GAGCCCATGAGGGCAGGGCCAGG + Intronic
1166936979 19:46339847-46339869 GAGAGAAGGAGGAGGGGGCCAGG - Exonic
1167105402 19:47427486-47427508 GGGCTACTGAGGAGTGGGCAGGG - Intergenic
1167253944 19:48415971-48415993 GGGGCGATGAGGAGTGGGCGGGG - Intronic
1167426598 19:49432785-49432807 GAGCCCAGGAGGAGAGGGCAGGG - Intronic
1167455898 19:49596656-49596678 GAGGCCATGGGGAGTGGGCTGGG - Exonic
1168210723 19:54888167-54888189 GACCCAAAGAGAAGTTGGCCGGG - Exonic
925090745 2:1154097-1154119 GAGCCAATGAGGAAGAGGGCAGG + Intronic
925274166 2:2637151-2637173 GAGCCACTGAGGTGTGGGTCAGG - Intergenic
927826144 2:26311484-26311506 GAGGCACTGAGCAGTGGGGCTGG + Exonic
929599938 2:43198646-43198668 GAGCCACAGGGAAGTGGGCCAGG - Intergenic
929693859 2:44097762-44097784 GAGGCGATGAGGAGAGGGACAGG + Intergenic
932212534 2:69944524-69944546 GAGCTAGTGAGGGGTGGGACTGG + Intergenic
932433200 2:71687569-71687591 GAGCCAAGGAGGACTGGGCCAGG - Intergenic
934979714 2:98829773-98829795 CAGCCGCTGAGGAGTGGGCTGGG + Intronic
937065253 2:119012558-119012580 GAGCCCCTGAAGAGTGGCCCCGG + Intergenic
941179379 2:162239824-162239846 AAGCCAAGGAGGAATGGTCCAGG + Intronic
942645696 2:178108389-178108411 GGGCCAATCAGCAGTGGGACCGG - Intergenic
944913584 2:204334304-204334326 ATGGCAAGGAGGAGTGGGCCAGG - Intergenic
945571228 2:211470333-211470355 GAGCCAAAGAGGAGTCAGTCTGG - Intronic
947118791 2:226797100-226797122 AAGCCACTGAGGACTGGGACGGG + Exonic
947650333 2:231781088-231781110 CAGCCAAGGACGAGCGGGCCAGG - Exonic
947750764 2:232530777-232530799 ATGCCAATAAGGAGGGGGCCAGG + Intronic
948981806 2:241498373-241498395 GGGCCAGTGGGGAGAGGGCCAGG + Intronic
1168830243 20:841639-841661 GAGCTAGTGGGGAGGGGGCCAGG + Intronic
1168959593 20:1859733-1859755 GAACCCATGAGGAGTGGGGGTGG + Intergenic
1172504659 20:35452715-35452737 AAGACTATGAGGAGTCGGCCGGG - Intronic
1172767004 20:37356303-37356325 GTGCCAATGGGTAGAGGGCCTGG + Intronic
1172975638 20:38903792-38903814 GAGCCTATGAGGAGTGGCCAGGG - Intronic
1174404632 20:50295322-50295344 CAGCAAATAAGCAGTGGGCCAGG - Intergenic
1176061267 20:63173947-63173969 GGGCCAGGGAGGAGGGGGCCAGG + Intergenic
1176167370 20:63681181-63681203 GGGCCAATGAGAAGGGGGCCAGG - Intronic
1177068497 21:16470433-16470455 GAGCGATTGAGGAGTAGGCTAGG + Intergenic
1179971419 21:44838199-44838221 GAGCCTAGGAGGGGTGGGCGGGG - Intergenic
1180573156 22:16748547-16748569 GAGCAAAGCAGGAGTCGGCCTGG - Intergenic
1180707630 22:17818876-17818898 GAGCAGATGGGGAGTGGGCTGGG + Exonic
1181117628 22:20642994-20643016 GAGCCAATGAGAATTAGGCTTGG + Intergenic
1181170938 22:21009517-21009539 GAGGCAAAGAGAAGTGGCCCCGG - Intergenic
1181180832 22:21067330-21067352 GAGGCAAAGAGAAGTGGCCCCGG + Intergenic
1181735600 22:24879127-24879149 GAGCCAATGAGAATTAGCCCTGG - Intronic
1181777553 22:25170518-25170540 GGGCCATTGAGGTGGGGGCCAGG + Intronic
1183087290 22:35494168-35494190 CAGCCAGAGAGGACTGGGCCAGG - Intergenic
1183393047 22:37556733-37556755 GAGCCAGGGAGGAGGGGGCAGGG - Intergenic
1183604461 22:38860413-38860435 GAGGCAAGGAGGAGGGGGGCGGG + Intergenic
1183714688 22:39526861-39526883 GGGCCAGGCAGGAGTGGGCCAGG - Intergenic
1183726517 22:39592929-39592951 GAGCCAGTGGGGAGTGTGTCAGG + Intronic
950502730 3:13374715-13374737 CAGACAATGAGGAATGGGCAGGG - Intronic
950534773 3:13572445-13572467 CAACCAGTGAGCAGTGGGCCTGG + Intronic
952429577 3:33209801-33209823 GAGCCAAAGAGGGCTGGGCATGG - Intronic
952481652 3:33768278-33768300 GAGGCAAGGAGGACAGGGCCTGG + Intergenic
952954135 3:38546105-38546127 GAGCCAATGGGGCTTGGACCAGG + Intergenic
953496576 3:43392830-43392852 GAGCCAATGTGGAGTGGTTTGGG - Intronic
953678397 3:45021184-45021206 GAGCCAATGAGGACAGGGTGGGG - Intronic
954317353 3:49808351-49808373 GTGGCAGTGAGGAGTGGGGCTGG - Intronic
954592284 3:51792960-51792982 CAGGCAATGAGATGTGGGCCAGG - Intergenic
954612880 3:51955524-51955546 CAGCCAATGAGGTGAGGGGCCGG + Exonic
954877798 3:53814438-53814460 GAGACAATGAGGAGCAGGCCTGG + Exonic
956484944 3:69712033-69712055 GAGACATTGGAGAGTGGGCCAGG + Intergenic
957459711 3:80500960-80500982 GAGGCAATGAGGAGGGGAGCTGG + Intergenic
961437048 3:126926499-126926521 GAGCCAAGGTGAAGTGGACCAGG + Intronic
961506323 3:127372542-127372564 GAGCCAAGGAGTATTGGGCCTGG - Intergenic
962344598 3:134610054-134610076 GAGCCGAGGAGGAGTGGGCATGG + Intronic
963128696 3:141838513-141838535 GAGAAAATGAAGAGTGGACCCGG + Intergenic
966942573 3:184756243-184756265 GAGCCACTCTGGAGTGGGGCTGG + Intergenic
968610963 4:1556819-1556841 GAGGGAATGAGGAGGGGGCCCGG - Intergenic
971906690 4:32735407-32735429 TAGGGAATGAGGAGTGGGCAGGG - Intergenic
972947393 4:44272745-44272767 GAGACAATGATGAGTGAGACAGG + Intronic
973975029 4:56254615-56254637 GTGCCAGTGGGAAGTGGGCCAGG - Intronic
973983702 4:56328650-56328672 GAGCCTGTGGGGACTGGGCCAGG + Intergenic
975820664 4:78267410-78267432 GTGCCAAAGTGGAGTGTGCCCGG + Exonic
977724844 4:100284202-100284224 GAACCATTGAGGAGTGGGACTGG + Intergenic
978834950 4:113137432-113137454 GAGCCAGAGAAGACTGGGCCAGG + Intronic
979231288 4:118352153-118352175 GAGCCAGTGAGGCTTGGGGCCGG - Intronic
984574439 4:181430854-181430876 GAGACAAAGAGGAGAGGGACAGG - Intergenic
984649604 4:182256057-182256079 GAGACAGTGAAGAGTGGGCAGGG - Intronic
985341294 4:188957310-188957332 GGGCCCATGTGGAGTGGGACTGG + Intergenic
986370630 5:7077192-7077214 GAGCCACTGAGGACAGAGCCGGG - Intergenic
991920320 5:71650241-71650263 GAGCCAAGGAGCAGCGTGCCTGG + Intronic
992311842 5:75510005-75510027 AAGCTAATGAGAAGGGGGCCAGG - Intronic
992430744 5:76709058-76709080 GGGGCAATGAGGGGTGGGCAGGG + Intergenic
993604102 5:89966383-89966405 GAGCAACTGAGGTGAGGGCCAGG + Intergenic
998228522 5:140344895-140344917 CAGCCTAGGAGGAGAGGGCCAGG + Intronic
1001147516 5:169197696-169197718 CAGCAAATGAGATGTGGGCCAGG + Intronic
1001638439 5:173229124-173229146 GAGCCAGTGCGGCGGGGGCCGGG + Intergenic
1001703255 5:173722572-173722594 TAGCCAATGGGCAGTGGGCTGGG - Intergenic
1002564135 5:180100477-180100499 GAGCCAGCAAGCAGTGGGCCGGG - Intergenic
1003056282 6:2823924-2823946 AGGCCAATGAGAAGTGGCCCAGG - Intergenic
1004459028 6:15818256-15818278 GATCAACTGGGGAGTGGGCCTGG - Intergenic
1005197722 6:23308914-23308936 AATCCAATGGGGATTGGGCCCGG - Intergenic
1005801365 6:29428450-29428472 GGGCCAATTAAGAGTTGGCCAGG + Intronic
1006176862 6:32127816-32127838 GAGCCAATGAGGGATGGGGCGGG - Intronic
1006620969 6:35363607-35363629 GATCCAGTGAGGCGGGGGCCAGG + Intronic
1007623896 6:43231566-43231588 AAGGAAATGAGGAGTGAGCCAGG - Intergenic
1008432422 6:51434814-51434836 AAGCCAATGTGCACTGGGCCTGG - Intergenic
1013195421 6:107840816-107840838 GAGGCAATGGAGAGTGGGACGGG + Intergenic
1016423788 6:143912966-143912988 GATCCAAGGAGGAGTGGATCAGG + Intronic
1017241257 6:152171593-152171615 GAACCAATCAGGAGCTGGCCAGG + Intronic
1017748698 6:157469953-157469975 CAGCCAGTGAGTGGTGGGCCTGG - Intronic
1018192825 6:161325563-161325585 GTGCCAATGAGGAGTCTGCATGG + Intergenic
1018992047 6:168681657-168681679 GAGCCAAATATGAGTGGCCCTGG - Intergenic
1023839137 7:44086103-44086125 AAGGCAGTGAGGAGTGGGTCTGG + Intergenic
1023875071 7:44282439-44282461 GGGACACTGAGGAGTGGGCTGGG - Intronic
1025803289 7:64808038-64808060 AAGCCAAGCAGGAGTGGGACAGG - Intronic
1025886701 7:65601455-65601477 GAGCCCACAAGGAGTGGGGCTGG - Intergenic
1028988702 7:97027158-97027180 AAGACAAAAAGGAGTGGGCCGGG + Intergenic
1030730818 7:112986331-112986353 GGGGCAGTGAGGAGAGGGCCGGG + Intergenic
1031855718 7:126920487-126920509 GAGCCCACAAGGAGTGGGGCTGG + Intronic
1032262425 7:130347875-130347897 GAGCCACTGAGGAGGGGGTGGGG - Intronic
1039944844 8:42120284-42120306 GATCCAGTGATGAGTGGCCCTGG + Intergenic
1039964283 8:42272242-42272264 GAGGCAGTGAGGAGGGGGCCTGG - Intronic
1046862310 8:119107164-119107186 GAGGCAAGGATGAGGGGGCCTGG - Intergenic
1047350285 8:124067078-124067100 GAGACAGTGGGGAGTAGGCCTGG + Intronic
1047491900 8:125382097-125382119 GAGCCAGTGAGTGATGGGCCAGG + Intergenic
1051714364 9:19965919-19965941 GAGCCAATGAGATGTAGGGCAGG - Intergenic
1053481292 9:38418354-38418376 CAGCCTTTGAGGAGTGGGCTGGG - Intronic
1055164944 9:73179865-73179887 CAGCCAGTGAGGAGTCGGGCTGG - Intergenic
1056662627 9:88555859-88555881 GAGCCAGTGAGCAGAGGGTCCGG + Intronic
1059917207 9:119117361-119117383 GAGACGATGAGGAGAAGGCCTGG + Intergenic
1061272348 9:129550456-129550478 GCGCCAGTGGGGAGAGGGCCGGG - Intergenic
1062189567 9:135240948-135240970 TAGCCAGGGAAGAGTGGGCCTGG - Intergenic
1186666208 X:11720137-11720159 GGGGCAATGGGGAGTGGGGCTGG + Intergenic
1189319830 X:40081163-40081185 GGGCCAATGAGCAATGGCCCTGG + Intronic
1192248148 X:69389705-69389727 GAGCCTTTGAGGAGCTGGCCTGG - Intergenic
1195162395 X:102183394-102183416 GAGAGAATGCAGAGTGGGCCTGG - Intergenic
1196426773 X:115577771-115577793 GAAGAAATCAGGAGTGGGCCAGG - Intronic
1197723719 X:129761841-129761863 GAGCCAATCTGGTGTGTGCCAGG + Intronic
1200228471 X:154432277-154432299 GCACCAGTGAGGAGGGGGCCAGG - Exonic
1200236278 X:154469308-154469330 TTTCCAAAGAGGAGTGGGCCAGG + Intronic
1200696409 Y:6364961-6364983 GAGCCAAATAGGAGTGGGATGGG - Intergenic
1201037705 Y:9799739-9799761 GAGCCAAATAGGAGTGGGATGGG + Intergenic