ID: 912401640

View in Genome Browser
Species Human (GRCh38)
Location 1:109398046-109398068
Sequence CGAGCCAATGAGGAGTGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 138}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401640_912401646 -4 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401640_912401652 10 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401640_912401647 -3 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401640_912401655 25 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401655 1:109398094-109398116 GGATTCGGATGCTAAGATGCGGG 0: 1
1: 0
2: 1
3: 2
4: 43
912401640_912401645 -5 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34
912401640_912401648 -2 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39
912401640_912401654 24 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401654 1:109398093-109398115 TGGATTCGGATGCTAAGATGCGG 0: 1
1: 0
2: 0
3: 4
4: 70
912401640_912401649 4 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401640 Original CRISPR CGAGCCAATGAGGAGTGGGC CGG (reversed) Intergenic
900357285 1:2271007-2271029 AGGCCCAGTGAGGAGTGGGCTGG + Intronic
900545800 1:3228587-3228609 CGAGGCAGTGGGGAGAGGGCAGG - Intronic
900555829 1:3279838-3279860 TGAGCCAGTGTGGAGTGGACAGG + Intronic
900898951 1:5503935-5503957 AGATCCCATGAGGAGGGGGCAGG - Intergenic
901216049 1:7555984-7556006 AGATCCCATGAGGAGGGGGCAGG + Intronic
902183528 1:14708066-14708088 CGAGCCAGTGAGGAGAAGGCCGG - Intronic
902824482 1:18963562-18963584 CCAGCCAGTGAGGAGGGGGATGG - Intergenic
903676880 1:25069971-25069993 AGAGACAATGAAGAGAGGGCTGG - Intergenic
903851118 1:26306661-26306683 CTAGCCAATGAGAAGTGCACGGG - Exonic
904008189 1:27374680-27374702 CGAGGGAATGAGGAGTGGGTTGG + Intronic
904418394 1:30376273-30376295 CAAGGCCATGAGGACTGGGCTGG + Intergenic
904705602 1:32388220-32388242 CAAGCTAATGAAAAGTGGGCAGG - Intronic
905489619 1:38333443-38333465 CCAGCCAATGAGGCGTGGGAAGG - Intergenic
906324475 1:44836263-44836285 AGAGCAAATGAGAAGTTGGCTGG + Intronic
907303502 1:53502086-53502108 AGAGCCAGAGAGGAGTGGGTAGG + Intergenic
910481205 1:87660308-87660330 AGAGAGAATGAGGAGTGGGGAGG + Intergenic
912189337 1:107319255-107319277 TGAGGCAAGGAGGAGTGGCCGGG + Intronic
912401640 1:109398046-109398068 CGAGCCAATGAGGAGTGGGCCGG - Intergenic
917734478 1:177907832-177907854 CCAGTCAATGGGGTGTGGGCAGG + Intergenic
918904920 1:190478901-190478923 CGAACCCATGGGGAGGGGGCGGG - Intergenic
919811625 1:201412421-201412443 CCAGGCAGTGAGGAGGGGGCAGG - Intronic
920079350 1:203361012-203361034 GGAGGCAGTGAGGAGTGGGAGGG + Intergenic
922796835 1:228343630-228343652 GAAGCCAACGGGGAGTGGGCAGG + Intronic
923048704 1:230374909-230374931 GGAGCCCATGAGGAGAGAGCAGG + Intronic
1069631321 10:69898539-69898561 CGTGCACATGAGGAGTGGGAGGG - Intronic
1071523427 10:86344925-86344947 CTGACCAGTGAGGAGTGGGCTGG + Intronic
1074562742 10:114548427-114548449 CTAGCCAACGAGGAGTTAGCTGG - Intronic
1074770283 10:116729187-116729209 AGAGCCAATGAGGAGCACGCCGG + Intronic
1076392120 10:130110855-130110877 GGAGCCAATAAGGAGAGGGAGGG + Intergenic
1076864136 10:133159179-133159201 CAAGCCAAGGTGGAGTGGGCTGG - Intergenic
1076907554 10:133370879-133370901 GGAGCCACTGAGGACTCGGCAGG - Intronic
1078646259 11:13143439-13143461 TGAGGCAAAGAGGAGTGAGCGGG - Intergenic
1078848145 11:15140297-15140319 CGAGGAAATAAAGAGTGGGCAGG - Intronic
1083791569 11:64989417-64989439 CGAGGCAAACAGGAGAGGGCTGG + Exonic
1083858101 11:65403928-65403950 CCAGCCAAAGGGCAGTGGGCTGG - Intronic
1088879914 11:113965041-113965063 TGAGACAATGAGGAGAGGGCAGG - Intergenic
1088927809 11:114320046-114320068 ACAGCCCAAGAGGAGTGGGCTGG - Intergenic
1089426443 11:118380180-118380202 TGAGTCATTGAGGGGTGGGCAGG + Intronic
1093316480 12:17657382-17657404 CTGGCCAAAGAGGAGTGGGGAGG + Intergenic
1096590960 12:52659045-52659067 TGGGCCAAGGAGGAGTTGGCAGG + Intergenic
1100665432 12:96746843-96746865 GGAGCCAGTGAGTAGTGGGGAGG - Intronic
1104523226 12:129494963-129494985 TGAGCAAATGAGCAGTGAGCAGG + Intronic
1105930419 13:25047238-25047260 CGAGCAAATGAGGAGGGCGCAGG - Intergenic
1106563285 13:30864565-30864587 GGAGTCAGTGAGGAGGGGGCTGG + Intergenic
1114736996 14:25051772-25051794 AGTGCCAATGAGTAGTGTGCCGG + Intergenic
1117255466 14:53972770-53972792 CGAGAGAATGAGGAGCGTGCAGG + Intergenic
1118442595 14:65825845-65825867 CTAGACAATGAGGAGTGTGGAGG - Intergenic
1121903901 14:97722242-97722264 CGAGCCAATTAGGATGGGGAGGG + Intergenic
1129116033 15:73365938-73365960 CGAGCTAGAGAGGAGTGAGCAGG - Intronic
1130012370 15:80161657-80161679 CAAGAAAATGAGGACTGGGCTGG + Intronic
1130909874 15:88263554-88263576 GGAGCCGAGCAGGAGTGGGCTGG - Intergenic
1133528662 16:6631890-6631912 GTAGCCAAAGAGGAGTGAGCAGG + Intronic
1136101561 16:28000451-28000473 AGAGCTAATCAGGAGTTGGCTGG + Intronic
1137860776 16:51844421-51844443 AGAGCCAATGAGAAGTGGTAGGG + Intergenic
1138201712 16:55093431-55093453 CCAGCCACAGAGGGGTGGGCAGG + Intergenic
1141398746 16:83727874-83727896 CGAGCCCATTAGCAGCGGGCGGG - Intronic
1141750264 16:85953669-85953691 GGACCCAGTGAGGAGCGGGCAGG - Intergenic
1149681935 17:58513406-58513428 GGAGACAAAGAGGAGTGGGTGGG + Intronic
1152310926 17:79549319-79549341 TGAGCCCCAGAGGAGTGGGCTGG - Intergenic
1161818669 19:6516068-6516090 TGAGGGACTGAGGAGTGGGCAGG + Intergenic
1162905060 19:13818305-13818327 GGGGCCAATGAGGAGCAGGCCGG - Intronic
1163314493 19:16532760-16532782 CGAGCCAATGACGAGTGAGCAGG + Intronic
1167105403 19:47427487-47427509 AGGGCTACTGAGGAGTGGGCAGG - Intergenic
1167253945 19:48415972-48415994 GGGGGCGATGAGGAGTGGGCGGG - Intronic
1167426599 19:49432786-49432808 AGAGCCCAGGAGGAGAGGGCAGG - Intronic
1167455899 19:49596657-49596679 GGAGGCCATGGGGAGTGGGCTGG - Exonic
929804483 2:45132707-45132729 TGAGCCAGTGAGGGGTGGGGAGG + Intergenic
929958876 2:46480923-46480945 TGAGCCAAGGCGGAGAGGGCTGG - Intronic
932695345 2:73951682-73951704 CCAGCCAACGAGGAGAGGACTGG + Intronic
934979713 2:98829772-98829794 TCAGCCGCTGAGGAGTGGGCTGG + Intronic
937282736 2:120731431-120731453 CGGTGCACTGAGGAGTGGGCTGG - Intergenic
942047497 2:172108316-172108338 CGAGCCTCTGCGGAGAGGGCGGG + Intergenic
944964678 2:204917172-204917194 GGAGCTAATGAGGAGTTGGTGGG + Intronic
945894433 2:215466383-215466405 CAAGCCAATGTGGAGAAGGCAGG - Intergenic
947623843 2:231607159-231607181 CCAGCCTGTGTGGAGTGGGCGGG - Intergenic
1170140851 20:13123852-13123874 GAAGCCAATGAGGAGTGGGTGGG - Intronic
1171228297 20:23459835-23459857 GGAGTCAGTGAAGAGTGGGCTGG - Intergenic
1172722554 20:37011311-37011333 ACAGCCCATGAGGAGTGAGCTGG + Intronic
1172975639 20:38903793-38903815 AGAGCCTATGAGGAGTGGCCAGG - Intronic
1173975504 20:47183800-47183822 CGGGCCCGTGAGGAGAGGGCAGG + Intronic
1175134213 20:56810692-56810714 CCAGCCAATGAGAAGTGAGGGGG + Intergenic
1175996737 20:62815347-62815369 AGAGCCACTGAGGAGGGGGCTGG + Intergenic
1179971420 21:44838200-44838222 TGAGCCTAGGAGGGGTGGGCGGG - Intergenic
1180707629 22:17818875-17818897 GGAGCAGATGGGGAGTGGGCTGG + Exonic
1183393048 22:37556734-37556756 GGAGCCAGGGAGGAGGGGGCAGG - Intergenic
1183732282 22:39625310-39625332 CAAAGCCATGAGGAGTGGGCTGG + Intronic
1183929440 22:41227657-41227679 CTGGGCAATGAGGAGAGGGCGGG - Intronic
950502731 3:13374716-13374738 GCAGACAATGAGGAATGGGCAGG - Intronic
952979747 3:38725113-38725135 CCAGACACTGAGCAGTGGGCTGG - Intronic
953496577 3:43392831-43392853 GGAGCCAATGTGGAGTGGTTTGG - Intronic
953678398 3:45021185-45021207 CGAGCCAATGAGGACAGGGTGGG - Intronic
955103345 3:55873184-55873206 GGAGCCAATGCAGAGTGGGCAGG + Intronic
955856429 3:63278301-63278323 CGAGTCAGCGAGGGGTGGGCAGG - Exonic
961182680 3:124888388-124888410 CTAGCCAATAAAGAGTGGGGTGG + Intronic
963924817 3:150939939-150939961 TGAGCCAGTGAGGAGAGGGATGG - Intronic
964394746 3:156233713-156233735 GGAGACAGTGAGGAGTGGTCAGG + Intronic
964763733 3:160158456-160158478 AGAGCAAATGTGGGGTGGGCTGG - Intergenic
966876928 3:184327722-184327744 CGTGTGATTGAGGAGTGGGCAGG + Intronic
967305113 3:188052144-188052166 CAAGGCAATGGGGAGTGGGAGGG + Intergenic
968911259 4:3477938-3477960 GGAGCCACTGGGGAGTGGGTTGG + Intronic
969027824 4:4188735-4188757 GGAGCCAACTAGGAGTGGCCAGG - Intergenic
971273104 4:25170196-25170218 CGACTCAGTGAGGAGTGGACTGG - Intronic
971906691 4:32735408-32735430 ATAGGGAATGAGGAGTGGGCAGG - Intergenic
972444985 4:39135417-39135439 CCAGCTAATCAGTAGTGGGCGGG + Intergenic
972983812 4:44739473-44739495 TGAGCCCATGAGGAGAGAGCTGG - Intergenic
973757612 4:54091209-54091231 CGAGCCAGAAAGGAGTGGGCGGG - Intronic
977900241 4:102414122-102414144 CAAGCAAAAGAGGAGGGGGCAGG - Intronic
979832520 4:125318410-125318432 CGAGCCATTGATGACTGGGGAGG - Exonic
980920594 4:139083024-139083046 TGGGCCAATGAAGATTGGGCGGG - Intronic
981001704 4:139834648-139834670 CAACCTAATGAGGATTGGGCAGG - Intronic
984649605 4:182256058-182256080 AGAGACAGTGAAGAGTGGGCAGG - Intronic
985913214 5:2898683-2898705 GGAGCTAAAGAGAAGTGGGCAGG + Intergenic
985995151 5:3593579-3593601 CGGGGCACAGAGGAGTGGGCTGG + Intergenic
988432752 5:31138680-31138702 CTAGCTAATGAGGGGTGGGGTGG - Intergenic
989169994 5:38464477-38464499 CCAGCCAGTGAGGAGTGGAAGGG - Exonic
992074260 5:73176441-73176463 CTAGACAAAGAGGAGAGGGCAGG + Intergenic
992430743 5:76709057-76709079 AGGGGCAATGAGGGGTGGGCAGG + Intergenic
996227030 5:121012391-121012413 AGAGCCACAAAGGAGTGGGCTGG - Intergenic
998172750 5:139882109-139882131 CCAGCCTATGTGTAGTGGGCTGG + Intronic
1001034313 5:168286603-168286625 CAAGCCCATGAGCAGAGGGCGGG - Intergenic
1001679764 5:173547504-173547526 CCAGGGAATGAGGAGTGGTCTGG + Intergenic
1001703256 5:173722573-173722595 TTAGCCAATGGGCAGTGGGCTGG - Intergenic
1004021920 6:11783669-11783691 AGAGCCAGTGGGAAGTGGGCAGG - Intronic
1006154001 6:32004400-32004422 CATGCCAAAGAGGAGTGGCCGGG - Intergenic
1006160308 6:32037137-32037159 CATGCCAAAGAGGAGTGGCCGGG - Intergenic
1006176863 6:32127817-32127839 GGAGCCAATGAGGGATGGGGCGG - Intronic
1006332785 6:33404294-33404316 CAAGACAGTCAGGAGTGGGCTGG - Intronic
1011520277 6:88197014-88197036 AGAGCAAATGAGGGGTGGGGCGG + Intergenic
1011855393 6:91683435-91683457 CGTGCCATTGAAAAGTGGGCAGG - Intergenic
1017798275 6:157867529-157867551 CGAGCCTATCAGGAGTGGAGAGG - Exonic
1023875072 7:44282440-44282462 AGGGACACTGAGGAGTGGGCTGG - Intronic
1027420382 7:78012614-78012636 CGAGTGAATGAGGAGTGAGCAGG - Intergenic
1032262426 7:130347876-130347898 TGAGCCACTGAGGAGGGGGTGGG - Intronic
1032783723 7:135184596-135184618 CCAGCCAGGGAGGAGAGGGCAGG + Exonic
1034293356 7:149949577-149949599 CGAGAGAATGAGAACTGGGCAGG + Intergenic
1034719922 7:153282182-153282204 GGAGCCAGTGAGGAGTAGGAAGG - Intergenic
1034812710 7:154147276-154147298 CGAGAGAATGAGAACTGGGCAGG - Intronic
1039434020 8:37547297-37547319 CAAGCCAAGGAGGAGGGGGCTGG - Intergenic
1039476058 8:37839977-37839999 CGAGTGTATGGGGAGTGGGCTGG + Intronic
1041952299 8:63517214-63517236 CCAGCGGCTGAGGAGTGGGCTGG + Intergenic
1048345562 8:133572146-133572168 CGAGCCAAGTTGGGGTGGGCGGG - Intergenic
1049206733 8:141367086-141367108 CCAGCCAAGCAGGAGTGGGAAGG - Intronic
1049436640 8:142589206-142589228 CGAGGCAGTGAGGAGTGGTCTGG - Intergenic
1049543998 8:143221189-143221211 CGAGCCAGGGATGAGTGAGCAGG + Intergenic
1050021148 9:1285771-1285793 AGGGCCAAGGAGGAGAGGGCAGG - Intergenic
1053481293 9:38418355-38418377 ACAGCCTTTGAGGAGTGGGCTGG - Intronic
1057599646 9:96446566-96446588 AGAGCCAAGGAGGAGAGGCCAGG - Intergenic
1058607112 9:106734653-106734675 CCAGCCAATGAGGTGTGAGCTGG + Intergenic
1059433560 9:114263798-114263820 AGAGCCCATGAGGTGGGGGCAGG - Intronic
1061262436 9:129487675-129487697 CCAGCCAGTGAGGGGTGGACTGG - Intergenic
1061318821 9:129815012-129815034 GGAGCCCAGGAGGAGTGGACGGG - Intronic
1187102897 X:16213071-16213093 AGAGACAAAGAGGAGTGGGGAGG - Intergenic
1200696410 Y:6364962-6364984 AGAGCCAAATAGGAGTGGGATGG - Intergenic
1200701676 Y:6407879-6407901 GGAGCCAAGGGGGAGTGGGATGG - Intergenic
1201032435 Y:9756819-9756841 GGAGCCAAGGGGGAGTGGGATGG + Intergenic
1201037704 Y:9799738-9799760 AGAGCCAAATAGGAGTGGGATGG + Intergenic