ID: 912401641

View in Genome Browser
Species Human (GRCh38)
Location 1:109398050-109398072
Sequence GACGCGAGCCAATGAGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401641_912401647 -7 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401641_912401649 0 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401641_912401645 -9 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401645 1:109398064-109398086 GCTCGCGTCGCCTCCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 34
912401641_912401654 20 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401654 1:109398093-109398115 TGGATTCGGATGCTAAGATGCGG 0: 1
1: 0
2: 0
3: 4
4: 70
912401641_912401648 -6 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401648 1:109398067-109398089 CGCGTCGCCTCCGGCTTCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 39
912401641_912401655 21 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401655 1:109398094-109398116 GGATTCGGATGCTAAGATGCGGG 0: 1
1: 0
2: 1
3: 2
4: 43
912401641_912401652 6 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401641_912401656 30 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401656 1:109398103-109398125 TGCTAAGATGCGGGACTGATTGG 0: 1
1: 0
2: 1
3: 3
4: 51
912401641_912401646 -8 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401641 Original CRISPR GACGCGAGCCAATGAGGAGT GGG (reversed) Intergenic
901288949 1:8106936-8106958 GACGAGTGCCAATGAGGAAGTGG + Intergenic
905626360 1:39492436-39492458 GACGCGAACCACAGGGGAGTGGG + Intronic
905670536 1:39788019-39788041 GACGCGAACCACAGGGGAGTGGG - Intronic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
916028863 1:160859285-160859307 GAGGAGAGACAAAGAGGAGTGGG + Intronic
920191874 1:204198994-204199016 GACAAGAGCCCATGAGGAGAGGG - Intronic
1067319657 10:45205738-45205760 GGCGCGAGCCAAGGAAGAGCAGG - Intergenic
1077000535 11:320053-320075 GGGGAGAGCCAATGAGGAGACGG - Intronic
1084972232 11:72778185-72778207 GATGCGAGCCCATGTGGAGAGGG + Intronic
1086453300 11:86938062-86938084 GACAGGAGCAAATTAGGAGTGGG - Intronic
1090049273 11:123362978-123363000 GAAGCAAGCCAAAGAGGAGGAGG + Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1102198809 12:111043478-111043500 GCCACCTGCCAATGAGGAGTAGG + Intronic
1114007721 14:18332655-18332677 GGCGCGAGCCAAGGAAGAGCAGG + Intergenic
1121396478 14:93628211-93628233 GTTGAGAGCCAATGAGGACTAGG - Intronic
1132779025 16:1612814-1612836 GACGCGAGCCGGTGCGGAGCGGG + Intronic
1138598216 16:58040741-58040763 GTCCCTGGCCAATGAGGAGTAGG + Intronic
1139434033 16:66925993-66926015 GACCTGAGCCTATGGGGAGTGGG - Intergenic
1142906783 17:3048980-3049002 GGCGACAGCCAATGAGGAGATGG - Intergenic
1147456839 17:40543157-40543179 TAGGCCAGCCAATCAGGAGTTGG + Intergenic
1152606778 17:81295363-81295385 GACGCGAGCCAATGAGAGGCGGG + Intronic
1154529741 18:15331308-15331330 GGCGCGAGCCAAGGAAGAGCAGG - Intergenic
1156411045 18:36828755-36828777 GTCGCGAGCCATGGAGGAGGAGG - Exonic
1162299236 19:9834998-9835020 GACGCGCGCCAAGAAGGGGTCGG + Intergenic
1163148944 19:15399950-15399972 GACACCAGCCACTGAGGACTTGG + Intronic
1163797315 19:19345116-19345138 GACCCAAGCCAATGTGGGGTGGG - Intronic
1166316873 19:41994247-41994269 GACGCGGGCATATGAGGAGGCGG - Intronic
1168333892 19:55586017-55586039 CAGGAGAGCCAATGAGGAGGGGG - Intergenic
935281952 2:101526030-101526052 GACCCCAGCCAATGGGGAGAGGG - Intergenic
938528835 2:132162748-132162770 GGCGCGAGCCAAGGAAGAGCAGG - Intronic
1169382374 20:5119482-5119504 CACGCCAGCCAATGAGGGCTAGG + Intronic
1176767671 21:13037164-13037186 GGCGCGAGCCAAGGAAGAGCAGG + Intergenic
1177418952 21:20830756-20830778 CACGAGAGTCAATGATGAGTTGG - Intergenic
1180432226 22:15263465-15263487 GGCGCGAGCCAAGGAAGAGCAGG + Intergenic
1184186948 22:42871349-42871371 GAGGCGATCCAGTGATGAGTCGG - Exonic
955103344 3:55873180-55873202 GATGGGAGCCAATGCAGAGTGGG + Intronic
962124432 3:132600827-132600849 GTCCCCAGCCAATCAGGAGTGGG + Exonic
963924818 3:150939943-150939965 GACATGAGCCAGTGAGGAGAGGG - Intronic
986828479 5:11548282-11548304 GAAGAGAGACAATGAGGAGGGGG + Intronic
997661369 5:135591673-135591695 GATCCCAGCCAATGGGGAGTGGG + Intergenic
1014599719 6:123395593-123395615 GACGCGGGACAATGAGGGGCAGG - Intronic
1014837325 6:126174145-126174167 GAGGATAGCCTATGAGGAGTGGG - Intergenic
1015979340 6:138823176-138823198 GTCCCCAGCCAATCAGGAGTGGG + Intronic
1019550589 7:1600247-1600269 GACGTGAGCCACGGAGGACTCGG - Intergenic
1024574948 7:50755694-50755716 GAGCCGAGCCAAGGAGGAGAGGG + Intronic
1032119208 7:129144638-129144660 GCCACGAGCCAATGGGAAGTCGG + Intergenic
1035264540 7:157684043-157684065 GACGGGAGGAAATGAAGAGTTGG - Intronic
1038455348 8:27669116-27669138 GAAGTGAGCCCAGGAGGAGTCGG + Intronic
1053707449 9:40769077-40769099 GGCGCGAGCCAAGGAAGAGCAGG - Intergenic
1054417361 9:64889845-64889867 GGCGCGAGCCAAGGAAGAGCAGG - Intergenic
1056083284 9:83119570-83119592 GAAGCAAGCCATGGAGGAGTTGG + Intergenic
1057310542 9:93940378-93940400 GACGGAAGCCAAGGGGGAGTGGG - Intergenic
1060431403 9:123554033-123554055 GGCGTGAGCCAATGAAGAGCAGG + Intronic
1186381155 X:9060815-9060837 GATGAGAGCACATGAGGAGTTGG + Intronic
1196869240 X:120097063-120097085 GAGGGGAGCCAATAGGGAGTAGG + Intergenic
1199718804 X:150527031-150527053 GATGCTAGCCAATGTGGAGAAGG - Intergenic