ID: 912401646

View in Genome Browser
Species Human (GRCh38)
Location 1:109398065-109398087
Sequence CTCGCGTCGCCTCCGGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401642_912401646 -9 Left 912401642 1:109398051-109398073 CCACTCCTCATTGGCTCGCGTCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401639_912401646 -3 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401640_912401646 -4 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401641_912401646 -8 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401638_912401646 -2 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401636_912401646 4 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401630_912401646 25 Left 912401630 1:109398017-109398039 CCCATAGGCTGGCCGCCTGTCCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401635_912401646 5 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401628_912401646 29 Left 912401628 1:109398013-109398035 CCGCCCCATAGGCTGGCCGCCTG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401633_912401646 13 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401629_912401646 26 Left 912401629 1:109398016-109398038 CCCCATAGGCTGGCCGCCTGTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401631_912401646 24 Left 912401631 1:109398018-109398040 CCATAGGCTGGCCGCCTGTCCCT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
912401634_912401646 10 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401646 Original CRISPR CTCGCGTCGCCTCCGGCTTC GGG Intergenic
900647268 1:3714604-3714626 CTGGCCTCTCCTCCGGCCTCTGG - Intronic
905308388 1:37034075-37034097 CTGGCGGCGCCTCCGGAGTCTGG - Exonic
907161458 1:52373264-52373286 CTCCTGTCGCCTCCTGCTTGTGG - Exonic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
917817562 1:178725693-178725715 GTCGCAGCGCCCCCGGCTTCAGG - Intronic
922543052 1:226433580-226433602 CCCCCTTCTCCTCCGGCTTCTGG + Intergenic
1068783234 10:60943971-60943993 CTCGCGTCTCGCTCGGCTTCAGG - Exonic
1071365989 10:84901119-84901141 CTCTCTTTGCCTCTGGCTTCTGG + Intergenic
1072553594 10:96497476-96497498 CTCGGGTTTCCTCCAGCTTCTGG + Intronic
1072825225 10:98599242-98599264 CTCCTGTGGCCTCAGGCTTCAGG - Intronic
1086437978 11:86800457-86800479 CCCGCCCCGCCTCCGGCCTCGGG - Exonic
1099202464 12:79691333-79691355 CTCCCGGCGCCTCCGACTCCGGG + Intergenic
1113271210 13:108676725-108676747 CACGCCTCTCCTCTGGCTTCTGG - Intronic
1122776046 14:104117331-104117353 CCCGCGTCGCCTGCGGATCCCGG - Intergenic
1122939248 14:104973879-104973901 CTCCCCTCCCCTCCGGCTGCGGG - Intronic
1133021588 16:2969303-2969325 CTGGCGTCCCCTCCCGCGTCCGG + Exonic
1136183836 16:28573303-28573325 CTCCCTTCTCCTCTGGCTTCAGG - Intronic
1151572001 17:74931086-74931108 CTGGCGTCTCCACTGGCTTCTGG - Exonic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG + Intronic
926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG + Intergenic
926308551 2:11657902-11657924 CTGGCGTCCCCTCCTGCCTCTGG - Intergenic
926593106 2:14760371-14760393 CTGGGGTCGCCTCAGGCTCCCGG - Intergenic
932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG + Intronic
948369035 2:237475625-237475647 CTCGGGGCCCCGCCGGCTTCGGG - Intergenic
1168965125 20:1894336-1894358 CTCCCCTCGCCTCCGGACTCCGG - Exonic
1170430952 20:16276065-16276087 CTCCTGTGGGCTCCGGCTTCAGG + Intronic
1172099236 20:32475489-32475511 CTCTCCTCGCTGCCGGCTTCGGG + Intronic
1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG + Intronic
1179054131 21:37916073-37916095 CTCGCGGCTGCTCCGGCTCCAGG + Exonic
1181100376 22:20534924-20534946 CTCGCCTCCCTTCAGGCTTCAGG + Intronic
1182469951 22:30542382-30542404 CTCCCCTCGCCTCCGGACTCCGG - Intronic
958996540 3:100912179-100912201 CTGCCGTCGGCTCAGGCTTCAGG + Intronic
976441911 4:85085596-85085618 CTCCCTTGCCCTCCGGCTTCTGG - Intergenic
998406265 5:141876354-141876376 CTCGCGCCGGCTCCGGCTTGCGG - Intronic
1003074571 6:2971697-2971719 CTCGCGGCCCCTCCGGCTGGCGG - Intronic
1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG + Intronic
1007569394 6:42878712-42878734 CTCACGCAGCCTCCGCCTTCTGG + Intergenic
1007708895 6:43808836-43808858 CTTGGGTTGCCTCCAGCTTCGGG + Intergenic
1014974047 6:127856493-127856515 CTCGCTTGTCCTCTGGCTTCTGG - Intronic
1036162967 8:6406451-6406473 CTCGCCGCGCCTCTGGCTGCTGG - Intergenic
1037865697 8:22440914-22440936 CTCTCGGCTCCTCCGGCTCCGGG - Intronic
1061992146 9:134165168-134165190 CTCGCGTGTCCTCCGGCTCCAGG + Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic