ID: 912401647

View in Genome Browser
Species Human (GRCh38)
Location 1:109398066-109398088
Sequence TCGCGTCGCCTCCGGCTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 23}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401640_912401647 -3 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401638_912401647 -1 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401629_912401647 27 Left 912401629 1:109398016-109398038 CCCCATAGGCTGGCCGCCTGTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401628_912401647 30 Left 912401628 1:109398013-109398035 CCGCCCCATAGGCTGGCCGCCTG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401642_912401647 -8 Left 912401642 1:109398051-109398073 CCACTCCTCATTGGCTCGCGTCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401630_912401647 26 Left 912401630 1:109398017-109398039 CCCATAGGCTGGCCGCCTGTCCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401635_912401647 6 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401633_912401647 14 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401641_912401647 -7 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401631_912401647 25 Left 912401631 1:109398018-109398040 CCATAGGCTGGCCGCCTGTCCCT 0: 1
1: 0
2: 0
3: 9
4: 141
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401634_912401647 11 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401636_912401647 5 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
912401639_912401647 -2 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401647 Original CRISPR TCGCGTCGCCTCCGGCTTCG GGG Intergenic
900271370 1:1790965-1790987 TCGCGTCCCCTCCGCCATCCAGG - Intronic
901242539 1:7703999-7704021 TGGCGGCGGCTCCGGCTTTGGGG - Intronic
907277608 1:53326052-53326074 ACGCGTGGCCTCGGGCTTCTCGG + Intronic
912401647 1:109398066-109398088 TCGCGTCGCCTCCGGCTTCGGGG + Intergenic
924090134 1:240493076-240493098 GCGCGTCACCTCCGTCCTCGTGG - Exonic
1081793432 11:45804616-45804638 CGGCGTGGCCTCCGGCCTCGGGG + Exonic
1084588644 11:70078032-70078054 GCGCGTCACCTCCGCCTCCGGGG - Intergenic
1086437976 11:86800456-86800478 CCGCCCCGCCTCCGGCCTCGGGG - Exonic
1098123813 12:67269601-67269623 TCGCGGCGGCTCCCGCTTCCAGG - Exonic
1099202465 12:79691334-79691356 TCCCGGCGCCTCCGACTCCGGGG + Intergenic
1103604819 12:122078807-122078829 TCGCGTTGCCCCGGGCTCCGGGG + Exonic
1121751644 14:96363014-96363036 TTGCGACGGCTCCGGCCTCGGGG + Exonic
1122422348 14:101585362-101585384 CCGCGGCTCCTCCGGCTTCCTGG + Intergenic
1126688389 15:51267609-51267631 TCGCGTCTCCTGCGTCTTCCTGG - Intronic
1167643635 19:50694872-50694894 GCGCGCCGCCTCCTGCTTTGCGG - Intronic
932441421 2:71738412-71738434 TCGCGTCCCCTCCTTCTTCTTGG + Intergenic
942681277 2:178480359-178480381 TCGCGCAGCCTCCGGCTAGGCGG + Intergenic
1173561740 20:44010971-44010993 TCGCTTCTCCTCCGGCTCCTGGG + Intronic
961827254 3:129605646-129605668 TGGCGTCGCCGCCGGCGCCGTGG + Exonic
962367620 3:134796501-134796523 TGGCGGTGCCTCCGGCTTGGTGG + Intronic
998406264 5:141876353-141876375 TCGCGCCGGCTCCGGCTTGCGGG - Intronic
1006058770 6:31404322-31404344 TCCCCTCGCCTCTGGCTCCGAGG + Intronic
1006071257 6:31499207-31499229 TCCCCTCGCCTCCGGCTCCGGGG + Intronic
1023937261 7:44748854-44748876 TCGCGCCGCCGCCCGCTCCGAGG - Intronic
1032505983 7:132435122-132435144 TTGCCTCGCCTCGGGCTTCCTGG + Intronic
1197198925 X:123732421-123732443 TCGCGGCGCCCCGGGCTTCGCGG + Intronic