ID: 912401649

View in Genome Browser
Species Human (GRCh38)
Location 1:109398073-109398095
Sequence GCCTCCGGCTTCGGGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 153}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401643_912401649 -6 Left 912401643 1:109398056-109398078 CCTCATTGGCTCGCGTCGCCTCC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401642_912401649 -1 Left 912401642 1:109398051-109398073 CCACTCCTCATTGGCTCGCGTCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401635_912401649 13 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401633_912401649 21 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401638_912401649 6 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401634_912401649 18 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401639_912401649 5 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401640_912401649 4 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401641_912401649 0 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153
912401636_912401649 12 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401649 Original CRISPR GCCTCCGGCTTCGGGGGTCC TGG Intergenic
900089867 1:915446-915468 CCCTCTGGCTTCGGGAGTGCTGG - Intergenic
900109196 1:998513-998535 GCCTCCGCCTTCCGCGGTCCGGG + Intergenic
900510049 1:3054538-3054560 CCCTCCTGCTGCGGGGCTCCCGG - Intergenic
901641484 1:10695082-10695104 GCCTGCGGGCTCGGGGCTCCTGG + Intronic
903016180 1:20363604-20363626 GGCTCCGGCTTGGGGGACCCAGG + Intergenic
903055528 1:20633630-20633652 GCCTACGGCTTGGGGCGGCCGGG + Exonic
904171093 1:28592611-28592633 GGCTCCGGCTCCGGGGCGCCAGG - Intronic
912401649 1:109398073-109398095 GCCTCCGGCTTCGGGGGTCCTGG + Intergenic
917981377 1:180271755-180271777 GCCGCCCGCCTAGGGGGTCCTGG + Intronic
923569859 1:235103676-235103698 GCCTCCGCCTCCTGGGTTCCAGG - Intergenic
1064088811 10:12365971-12365993 GCCTCCGGCTCCCAGGTTCCAGG - Intronic
1065099464 10:22320455-22320477 GACCCCTGCTTCGGGGCTCCGGG + Intronic
1066065314 10:31757392-31757414 GTCTCCGGCCTCGGGGGGCCTGG + Intergenic
1067002987 10:42635156-42635178 GCCTCTGCCTTCAGGGCTCCAGG - Intronic
1067471447 10:46541345-46541367 CCCTCAGGCTCCGAGGGTCCCGG + Intergenic
1070609985 10:77926559-77926581 CCCGCCGGCCTCGGGGGGCCCGG - Intergenic
1075207050 10:120457104-120457126 GCCTCGGGCTCCGGGGCTCCGGG - Exonic
1076395795 10:130136622-130136644 CCCTTCGGCCTCGGGGGACCGGG + Intronic
1076649662 10:131979098-131979120 GCCTCAGGCATCTGGGCTCCAGG + Intronic
1076747435 10:132521484-132521506 GCATCTGGCTTTGGGGGTCCCGG + Intergenic
1077416017 11:2424654-2424676 TCTTCCAGCTTCGGGGCTCCAGG - Intergenic
1077453738 11:2665728-2665750 GCCTGGGGCTTTGGGGGTTCTGG - Intronic
1079459719 11:20669304-20669326 GACTCCGACTTCGGTGCTCCGGG + Intergenic
1081525394 11:43924532-43924554 GCCTCCGGCCTCCGGCCTCCAGG - Intergenic
1083888275 11:65583312-65583334 GGCTCAGACTTCGGGGGTCCAGG + Exonic
1089524028 11:119084966-119084988 GCCCCCGGCTTCCCGGGGCCGGG + Exonic
1089673039 11:120069657-120069679 GACTCCTGCTTCTGGTGTCCTGG - Intergenic
1094607260 12:31959519-31959541 CCCTCCGCCTTCCGGGGTCCGGG + Intronic
1094846139 12:34362227-34362249 GCCTCGGGCTCAGGGGGGCCAGG - Intergenic
1096409095 12:51364531-51364553 GCCTCCGCCTTTGGGGGTAGAGG - Intronic
1096474071 12:51897257-51897279 GCCTGTGGATTTGGGGGTCCTGG + Intergenic
1096604288 12:52753800-52753822 GCCTGGGGCTTTGGGGGTTCGGG - Intergenic
1100930770 12:99607205-99607227 GCCTCTGGATTCTGGGGTCTGGG - Intronic
1100978014 12:100142509-100142531 GCCTGCGGCTTCGGGGGCGGCGG - Intronic
1104589780 12:130075019-130075041 GCCTCCCGCCTCGGGGGTGGAGG - Intergenic
1108832845 13:54500377-54500399 GCCTCAGGCTTCTGGGGACATGG + Intergenic
1112782042 13:102911532-102911554 GCCGCAGGCCTCGGGGATCCAGG - Intergenic
1118316381 14:64728609-64728631 TCATCCAGCTTCTGGGGTCCTGG + Intronic
1119522200 14:75294449-75294471 GCCTCCGCCTGGGTGGGTCCCGG - Intergenic
1121310434 14:92932699-92932721 GCCTACGGCTTCAGGGGCCCTGG + Exonic
1122079107 14:99254569-99254591 GCCTCTGGCTTTGGCTGTCCAGG - Intronic
1122145083 14:99684193-99684215 GCCTCCGGCTCCGGCGCTCCGGG - Intergenic
1122298782 14:100720152-100720174 GCCTCTGGCTGCGGGGTGCCTGG + Intergenic
1123664867 15:22600045-22600067 GACTCCGCCTTCTGGGGTGCTGG + Intergenic
1125171142 15:36768077-36768099 GCCTCTGGATGCAGGGGTCCTGG - Intronic
1125554030 15:40569542-40569564 CCAGCCGGCTTCGGGGGCCCGGG - Exonic
1125674590 15:41495351-41495373 GCCCCCGGCCTCGGGCGTCTGGG + Intronic
1128497650 15:68207418-68207440 GCCTCCAGCTCCTGGGGGCCAGG + Exonic
1134508254 16:14824921-14824943 GGCACCGGGTTGGGGGGTCCCGG + Intronic
1134656212 16:15949902-15949924 GCTGCCGGCCTCGGGGGCCCGGG + Intronic
1134676231 16:16092392-16092414 GCCTAGGGCTTCGGAGGTGCTGG - Intronic
1134695953 16:16223686-16223708 GGCACCGGGTTGGGGGGTCCCGG + Intergenic
1134975873 16:18571002-18571024 GGCACCGGGTTGGGGGGTCCCGG - Intergenic
1135587788 16:23684046-23684068 GCTTCCGGTTGCTGGGGTCCAGG - Exonic
1136478293 16:30526542-30526564 ACGTCCGGCCTCGGGGGCCCGGG - Exonic
1138553326 16:57758802-57758824 GCCTCTACCTCCGGGGGTCCTGG + Exonic
1139319859 16:66105667-66105689 GCCTCCTGCTTCGGGAGACACGG - Intergenic
1139602088 16:67993184-67993206 CCCTCCGGCCTCGAGGGTCCCGG - Exonic
1141860383 16:86712336-86712358 GCACCCAGCTGCGGGGGTCCAGG - Intergenic
1143139293 17:4731956-4731978 GCCTCAGGCTTGGGTGATCCAGG + Intronic
1147185317 17:38710263-38710285 GCCCCAGGCTTCAGGGGTCCAGG + Intronic
1147315406 17:39617919-39617941 GCCTCCCGCTTGGGGGAGCCGGG + Intergenic
1147429487 17:40362852-40362874 GCTTCCGGCTTCTGCGGTGCGGG + Intronic
1148855726 17:50578378-50578400 GCCGCCGGCTGTGGGGGTCCCGG - Exonic
1151133462 17:71922551-71922573 GCCTCCAGCTTCAGGGCTTCTGG - Intergenic
1151914464 17:77107227-77107249 GGCTCCGGGCTCCGGGGTCCAGG + Intronic
1151954079 17:77372116-77372138 GCCTGCTGCTTCGGGGGTGGGGG + Intronic
1152414116 17:80147706-80147728 GACGCCGGCTTCAGGGGCCCTGG - Intergenic
1152710720 17:81869512-81869534 CCCTGCGGCCGCGGGGGTCCGGG - Intronic
1153227001 18:2906975-2906997 GCCTGCGCCTGCGGGGGGCCCGG - Exonic
1154447746 18:14449226-14449248 GCCCCCGGCTTCCAGGGACCTGG - Intergenic
1160717363 19:582414-582436 GCTTCAGTATTCGGGGGTCCTGG + Intronic
1161018735 19:1997588-1997610 GCCTCTGCCATCGGGGGGCCTGG - Intronic
1161337655 19:3722885-3722907 GCCCCCGGGTACGGGGCTCCCGG - Intronic
1161850236 19:6734209-6734231 GCCTGTGGCTTCGGGAGCCCTGG + Exonic
1162433825 19:10644756-10644778 GCCTCTGCCTTCTGGAGTCCAGG - Intergenic
1163013525 19:14440279-14440301 GCCTCCGCCATCCTGGGTCCGGG - Exonic
1163729276 19:18940343-18940365 GCCGCCGGCCACGGGGCTCCCGG + Intronic
1163799696 19:19356959-19356981 CCCTCCAGCTTCTGGGGCCCAGG + Exonic
1165264249 19:34647033-34647055 GCCTCCAGCATCTGGAGTCCTGG - Intronic
1165333454 19:35154138-35154160 GCCTCCAGCTCCTGGGATCCGGG + Exonic
1166359896 19:42248709-42248731 GGCTCAGGCTTAGGGGGTGCAGG + Exonic
1166666337 19:44682665-44682687 CACCCCGGCTTCGGGGCTCCTGG - Intronic
1167019086 19:46861074-46861096 GGCTCCGGCGGCGGGGGGCCGGG - Intergenic
925316878 2:2933483-2933505 GGCTCAGGCCTCGGGGGTGCTGG - Intergenic
925928325 2:8685827-8685849 GGCTGCGGCTCCAGGGGTCCCGG - Intergenic
929491952 2:42404933-42404955 GGATCCGGCTTTGGGGGTCTGGG - Intronic
930785276 2:55266065-55266087 GCATGCGGCAGCGGGGGTCCTGG + Intronic
931868989 2:66439638-66439660 GCCTCCGACTTCAGGGCTCCAGG + Intronic
935653182 2:105399192-105399214 GCCCCGGGCTGCGGCGGTCCCGG + Intronic
946016032 2:216604783-216604805 GCCTCTAGCTCTGGGGGTCCTGG - Intergenic
947791973 2:232873709-232873731 GCCTCAGGCTTCTGGGGGCTGGG - Intronic
948436119 2:237955782-237955804 GGCTCCGCCTGCAGGGGTCCTGG - Intergenic
948481319 2:238252206-238252228 GGCTCCTGCTTCTGGAGTCCTGG - Intronic
948926601 2:241102518-241102540 GCCTCAGCCTTCGGGGGCCTCGG + Intergenic
949042918 2:241857759-241857781 GGCTCCTGCCCCGGGGGTCCTGG - Intronic
1169549389 20:6686717-6686739 GCCTGGGGCTTCTGGGCTCCTGG - Intergenic
1170969321 20:21103088-21103110 CCCTCCAGCTTCGCGGGTCTGGG - Intergenic
1171460794 20:25296882-25296904 GCCTCTGGATTCTGGGGTCTGGG + Exonic
1173070323 20:39758340-39758362 GCCTCCGCCTCCAGGGTTCCAGG + Intergenic
1173865218 20:46308623-46308645 TTCCCCGGCTGCGGGGGTCCGGG - Intergenic
1174827121 20:53778431-53778453 GCCTGGGGCTTGGGGGATCCGGG + Intergenic
1176429134 21:6565191-6565213 GCCTTCGGCCTCCGGGGTCGAGG - Intergenic
1179572219 21:42284484-42284506 GCCCCAGGTTCCGGGGGTCCAGG - Intronic
1179704624 21:43173507-43173529 GCCTTCGGCCTCCGGGGTCGAGG - Intergenic
1182903840 22:33920423-33920445 GCCCCCAGCTTCGGGCGCCCGGG + Intronic
1183576810 22:38695971-38695993 GCCTCCGCCTTCTGGGTTCAAGG - Intronic
1184086643 22:42269936-42269958 GCCGCCTGCTTCGGGGCCCCTGG - Intronic
1184092145 22:42298519-42298541 GCCTTCTGCTTCGGGGTTCTGGG - Intronic
1184146458 22:42614502-42614524 GCCCCCGCGTTCCGGGGTCCTGG - Intronic
1184147260 22:42619059-42619081 GCCTCAGGGTTTTGGGGTCCTGG - Exonic
1184866039 22:47202364-47202386 GGCTCCCGCTTTGGGGGACCTGG - Intergenic
950316396 3:12004942-12004964 GCCGCCGCCCTCGGGGGTCGGGG + Intronic
952240986 3:31531942-31531964 GCCTCCGGCTTCTGCGGCCGCGG - Intergenic
958432565 3:94059811-94059833 GCCTCGGCCTTCAGGGGTGCTGG - Exonic
958798908 3:98733662-98733684 GCCGCCGGCTCCGGAGATCCCGG + Intronic
968196660 3:196712514-196712536 GCGTCCGGCTTCCGGCGTCCTGG + Exonic
968466456 4:754017-754039 GCCTCCGTCTTTGGTGGTCCTGG + Intronic
968618557 4:1593188-1593210 GACACCGGCCTCGCGGGTCCAGG + Intergenic
968703132 4:2066085-2066107 GCCTCGGGCTCCTGGGGTGCAGG + Exonic
968778562 4:2561261-2561283 GCCTCTGCCTTCCGGGTTCCAGG + Intronic
969353937 4:6614235-6614257 GCCTCTTGCTGCTGGGGTCCTGG - Exonic
969682234 4:8649758-8649780 GCCCCCGGCCCCGGGGGCCCCGG - Intergenic
972581858 4:40402423-40402445 GCCTCCGCCTTAGGGGTTCAAGG + Intergenic
982202668 4:152975094-152975116 ACCTCAGGCCTCGGGGGGCCAGG + Exonic
984550116 4:181149633-181149655 GCCTCCGCCTCCTGGGGTCAGGG + Intergenic
985128249 4:186716540-186716562 GCCTCCGCCTCCGGGGTACCTGG + Intronic
985629036 5:1005316-1005338 GGCGCGGGCGTCGGGGGTCCAGG + Intergenic
986736711 5:10673747-10673769 GCTTCCGGGTTCTGCGGTCCAGG + Intergenic
988688551 5:33549305-33549327 GCCTCAGGTTCCGGTGGTCCCGG + Exonic
990213021 5:53500817-53500839 GCCTCCAGCTTCTGGGCTCAAGG - Intergenic
992106333 5:73451598-73451620 CCCACCGGCTGCGGGGGCCCGGG + Intergenic
995106218 5:108380951-108380973 GCAGCCGGCGTCGGGGGGCCGGG + Exonic
997983875 5:138488474-138488496 GTCTCCTGCTTCTGGAGTCCGGG + Intergenic
1003563712 6:7204611-7204633 GCCTCCAGCTTGGCAGGTCCTGG + Intronic
1006634496 6:35452364-35452386 GGCTGCGGCTTCGGGCGGCCGGG + Exonic
1013369182 6:109455324-109455346 GCCTCCCGCTGCGGGTGGCCCGG + Intronic
1014802360 6:125791033-125791055 GGCGCCGGCTCCTGGGGTCCGGG - Exonic
1019917649 7:4143984-4144006 GTCTGAGGCTTCGGGGCTCCTGG - Intronic
1022091073 7:27108422-27108444 GCCACCGGCTCCGGGGGGCACGG + Exonic
1022114929 7:27252917-27252939 GCCTCCAGCCCCGGGGGTCGTGG + Intergenic
1028173445 7:87627742-87627764 GACTCCGGAATCGGGAGTCCGGG - Intronic
1029226736 7:99034072-99034094 GCCCCTGGTTTCTGGGGTCCTGG + Intronic
1029291465 7:99505056-99505078 GCGAGCGGCTTCGGGGGCCCTGG + Exonic
1030614873 7:111728816-111728838 GCAGCCGGCTTTGGGGGTGCTGG - Intronic
1033339139 7:140478769-140478791 GCCTCCGGCTCCCGGGGCTCGGG - Intronic
1035224230 7:157424823-157424845 GCCTCTAGCCTCGGGGTTCCGGG - Intergenic
1035656854 8:1314710-1314732 GCCTCCTGCTCCGGAGGTCGAGG + Intergenic
1038132044 8:24743337-24743359 GCCTCCGCCTCCTGGGTTCCAGG - Intergenic
1038540362 8:28385894-28385916 GCCGGCGGCCTGGGGGGTCCGGG - Intronic
1039794731 8:40903195-40903217 ACCTCCGGCTTCTGGGTTCAAGG - Intergenic
1043602211 8:81954129-81954151 ACCTCCGCCTCCGGGGGTCAAGG - Intergenic
1045513749 8:102838014-102838036 GCCTCCGGCTCCTGGGTTCAAGG + Intronic
1053323005 9:37117168-37117190 GTCTCCAGCTTCTGGGCTCCAGG - Intergenic
1055266302 9:74498798-74498820 GCCTGCGACTGCGAGGGTCCTGG - Intronic
1058967142 9:110048766-110048788 GCCTCCCGCTCCGGGGGTCCAGG - Exonic
1061278727 9:129584907-129584929 GCCTCAAGAGTCGGGGGTCCTGG + Intergenic
1062341263 9:136094877-136094899 GACCCCGGCTCCGGGCGTCCCGG - Intronic
1062457496 9:136646475-136646497 GCCTCCGCCTCCGGGCTTCCAGG + Intergenic
1188009315 X:25040235-25040257 ACCTCCGGCTTCCGGGTTCAAGG + Intergenic
1190157140 X:48003544-48003566 GCCTTCGGGTGCGGGGGTGCAGG + Exonic
1195091883 X:101468371-101468393 GCCTCGGCCTTCCTGGGTCCAGG + Intronic
1196965126 X:121047463-121047485 ACCTCCGGGTCCGGAGGTCCGGG - Intergenic
1199649339 X:149938167-149938189 GGCTCCGGCATCAGGGGCCCTGG + Intronic
1200251621 X:154557189-154557211 GCCTCCCGCTTCTGGAGGCCTGG + Intronic
1200253828 X:154568873-154568895 GCCTCCCGCTTCTGGAGGCCTGG + Intergenic
1200263941 X:154635535-154635557 GCCTCCCGCTTCTGGAGGCCTGG - Intergenic
1200266146 X:154647227-154647249 GCCTCCCGCTTCTGGAGGCCTGG - Intergenic
1201948208 Y:19535448-19535470 GCCTCCGCCTCCGGAGGTGCCGG + Intergenic