ID: 912401652

View in Genome Browser
Species Human (GRCh38)
Location 1:109398079-109398101
Sequence GGCTTCGGGGGTCCTGGATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 172}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401638_912401652 12 Left 912401638 1:109398044-109398066 CCCCGGCCCACTCCTCATTGGCT 0: 1
1: 0
2: 0
3: 18
4: 172
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401641_912401652 6 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401640_912401652 10 Left 912401640 1:109398046-109398068 CCGGCCCACTCCTCATTGGCTCG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401639_912401652 11 Left 912401639 1:109398045-109398067 CCCGGCCCACTCCTCATTGGCTC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401642_912401652 5 Left 912401642 1:109398051-109398073 CCACTCCTCATTGGCTCGCGTCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401634_912401652 24 Left 912401634 1:109398032-109398054 CCTGTCCCTCTTCCCCGGCCCAC 0: 1
1: 1
2: 2
3: 66
4: 617
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401643_912401652 0 Left 912401643 1:109398056-109398078 CCTCATTGGCTCGCGTCGCCTCC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401633_912401652 27 Left 912401633 1:109398029-109398051 CCGCCTGTCCCTCTTCCCCGGCC 0: 1
1: 0
2: 1
3: 82
4: 811
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401636_912401652 18 Left 912401636 1:109398038-109398060 CCTCTTCCCCGGCCCACTCCTCA 0: 1
1: 0
2: 4
3: 63
4: 759
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172
912401635_912401652 19 Left 912401635 1:109398037-109398059 CCCTCTTCCCCGGCCCACTCCTC 0: 1
1: 0
2: 6
3: 68
4: 920
Right 912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG 0: 1
1: 0
2: 1
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401652 Original CRISPR GGCTTCGGGGGTCCTGGATT CGG Intergenic
901008376 1:6183033-6183055 GCCTTGGGGGTTCCTGGATGAGG - Intronic
901314053 1:8293419-8293441 TTCTTCATGGGTCCTGGATTTGG + Intergenic
901428527 1:9198588-9198610 GGCTTCGTGCGTCCTGGGATGGG - Intergenic
901904477 1:12395871-12395893 GGCTTTGGGGTTTCTGGAGTTGG - Intronic
904335505 1:29794784-29794806 GGCTTTGGGGTTTCTGGAGTTGG + Intergenic
904727232 1:32558659-32558681 TGGTTCCTGGGTCCTGGATTAGG + Intronic
904995835 1:34630743-34630765 GGATTGGGGGGTGGTGGATTGGG - Intergenic
907247109 1:53115431-53115453 GGCTGTGGGGGTCCTAGAATGGG - Intronic
907328414 1:53655980-53656002 GGCATCTGGTGTCCTGGGTTTGG - Intronic
909199514 1:72672208-72672230 GGCTTCTTGAGTCATGGATTTGG + Intergenic
909576500 1:77182686-77182708 GGTTTTGGGGTTTCTGGATTTGG + Intronic
911839269 1:102660303-102660325 GGCTTGGCGGGTCCTGCACTCGG - Intergenic
912401652 1:109398079-109398101 GGCTTCGGGGGTCCTGGATTCGG + Intergenic
915341270 1:155178136-155178158 GGCTCCGGTGCTCCTGGATCTGG - Exonic
917743339 1:177983271-177983293 GGAGTCAGGGGACCTGGATTCGG - Intronic
918511235 1:185316598-185316620 GGTTTTGGGGGGCCTGGGTTAGG - Intronic
922122484 1:222686278-222686300 GGCATCTGGGATCTTGGATTTGG + Intronic
1063137665 10:3231425-3231447 GGCCACGGGCCTCCTGGATTTGG + Intergenic
1063137680 10:3231485-3231507 GGTTTTGGGCCTCCTGGATTTGG + Intergenic
1063137703 10:3231604-3231626 GGATTCAGGGCTCCTGGATTTGG + Intergenic
1063137710 10:3231633-3231655 GGATTCAGGGCTCCTGGGTTTGG + Intergenic
1063137717 10:3231663-3231685 GGATTCAGGGTTCCTGGATTTGG + Intergenic
1063137724 10:3231693-3231715 GGATTCAGGGTTCCTGGATTTGG + Intergenic
1063137732 10:3231723-3231745 GGATTCAGGGCTCCTGGGTTTGG + Intergenic
1063137745 10:3231780-3231802 GGATTCAGGGCTCCTGGATTTGG + Intergenic
1063137752 10:3231810-3231832 GGATTCAGGGCTCCTGGATTTGG + Intergenic
1063137770 10:3231899-3231921 GGATTCAGGGCTCCTGGATTTGG + Intergenic
1063137778 10:3231929-3231951 GGATTCAGGGCTCCTGGGTTTGG + Intergenic
1064085179 10:12340420-12340442 GGCCTCGGGGGTCCTTCCTTTGG - Intergenic
1064443000 10:15370727-15370749 GGCTTCGGGGGCCGGGGATCGGG - Intronic
1066957541 10:42187270-42187292 GGTTTTGGGGTTTCTGGATTTGG + Intergenic
1067228192 10:44388908-44388930 GGCTTCCTGGTTCCTGGAATAGG - Intergenic
1069791275 10:71022911-71022933 GGTTTGGGGGCTCCTGGAGTTGG - Intergenic
1070812636 10:79306050-79306072 GGCTCCGGGGTGCCTGGCTTTGG - Intronic
1073094746 10:100972732-100972754 GCCATGGGGGGTCCTGGAATCGG - Intronic
1073557665 10:104468235-104468257 GGCTTTGGGGTTTCTGGAGTTGG - Intergenic
1076577440 10:131479023-131479045 AGCTTGGGGGAGCCTGGATTTGG - Intergenic
1077474939 11:2781937-2781959 GGTTTTGGGAGTCCTGGGTTGGG - Intronic
1078342517 11:10508948-10508970 GGTTTCGGGGGTCTTAGCTTTGG + Exonic
1081096344 11:38940656-38940678 GGCTTCCTGGGTTCCGGATTTGG - Intergenic
1083189884 11:61042208-61042230 GGCTCCAGGGGCCCTGGATAGGG + Intergenic
1083657464 11:64236366-64236388 GGCTTGGGGGGTGCTGGGTATGG + Intronic
1085780243 11:79401766-79401788 GGCTTCCAGGCTCCTGGACTTGG - Intronic
1090344939 11:126062499-126062521 GGCTTGGGGGGCCTTGGCTTAGG - Intronic
1090419707 11:126566069-126566091 GGCTTTGGGGGTGCTGTCTTTGG + Intronic
1090876377 11:130792085-130792107 GGCTTCTGGGGTCCTTGTTGGGG + Intergenic
1091597536 12:1888276-1888298 GACTTTGGAGGTCCTGGATGAGG + Intronic
1091727990 12:2858810-2858832 GGCTCCGGGGAGCCTGGCTTGGG + Exonic
1096552894 12:52385218-52385240 GGCTTTGGTGGCCCTGGCTTTGG - Exonic
1096593657 12:52679930-52679952 GGCTTTGGGGGTGGTGGATATGG - Exonic
1096597132 12:52703082-52703104 GGTTTTGGGGGTGCTGGATTTGG - Exonic
1101830919 12:108255899-108255921 GGCTTTGGGGGTCCAAGATGGGG - Intergenic
1103989745 12:124790883-124790905 GGCGTCTGGGAGCCTGGATTCGG + Intronic
1113618611 13:111698214-111698236 TGCATTGGGGGTCCTGCATTGGG - Intergenic
1113618683 13:111698486-111698508 GGCACTGGGGGTCCTGCATTTGG - Intergenic
1113624140 13:111783475-111783497 TGCATTGGGGGTCCTGCATTGGG - Intergenic
1113624212 13:111783747-111783769 GGCACTGGGGGTCCTGCATTTGG - Intergenic
1119060152 14:71465625-71465647 GGTTTCGGGGTTTCTGGAGTTGG - Intronic
1119098216 14:71854159-71854181 GGAAGCGGGGGTCCTGGATGAGG - Intergenic
1119483638 14:74974873-74974895 GGCTTCGGGAGGCCTGGCCTTGG - Intergenic
1119665603 14:76482846-76482868 GCCTTCTGGGGTCCAGGATCCGG - Intronic
1119856896 14:77907793-77907815 GGATTCGGGGGACCTGGGATAGG - Exonic
1121907161 14:97757069-97757091 GGCTCCTGGTCTCCTGGATTGGG + Intronic
1122824423 14:104362683-104362705 GATTTCTGGGGTCCTGGCTTTGG + Intergenic
1202935559 14_KI270725v1_random:84496-84518 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
1125914573 15:43474169-43474191 GGCTTGGCGGGTCCTGCACTCGG - Intronic
1127647703 15:60974683-60974705 GGCTTTGGGGGGCCTTGTTTGGG - Intronic
1127884675 15:63189189-63189211 TGATTCTGAGGTCCTGGATTTGG + Intergenic
1128807048 15:70538872-70538894 GGCATCTGGGAACCTGGATTTGG + Intergenic
1131841781 15:96445098-96445120 AGCTTCGGAAGTCCTGGGTTGGG + Intergenic
1135241048 16:20807158-20807180 GCCGTCGGGGGCACTGGATTCGG + Intronic
1135735888 16:24931371-24931393 GGTTTCGGGGGTGCTGGAGCGGG + Exonic
1138522634 16:57579616-57579638 GGCTGAGGTGGTCCTGGGTTGGG + Intronic
1139374914 16:66491015-66491037 GGCTTCGGGGGGGCTGGATATGG - Intronic
1141322059 16:83020412-83020434 GGCTTTGGGGATCCTGGAGATGG - Intronic
1142000482 16:87661497-87661519 GACTTTGGGGGTCCAGGACTGGG + Intronic
1142709176 17:1714441-1714463 GAGTTCTGGGGGCCTGGATTGGG + Intergenic
1144086521 17:11813991-11814013 GGCTGCTGGGGTCCTTGATAGGG + Intronic
1144269013 17:13600477-13600499 GGATCCGGGGGTCCTGGGCTGGG - Intronic
1145399932 17:22523317-22523339 GGTTTCGGGGGTCTTGGCTTTGG - Exonic
1147978112 17:44259409-44259431 GGCTGCGGGGGTCCAGGCTGAGG + Intronic
1148393384 17:47289785-47289807 GCCTTCGGGCTTCCTGGAGTGGG + Intronic
1148725849 17:49789272-49789294 GGCTTAGGCGGACCTCGATTGGG + Intronic
1150481889 17:65517148-65517170 GACTTCGGGGGTCCTGGGGGTGG - Intergenic
1150491595 17:65577980-65578002 GGCTGCTGGTGTCCTGGTTTGGG - Intronic
1150492190 17:65582142-65582164 GGCTGCTGGTGTCCTGGTTTGGG - Intronic
1156846655 18:41673425-41673447 GGCTTGGGGTTTCCTGCATTTGG - Intergenic
1156871526 18:41951308-41951330 GCCTTGGGGGTTCCTGCATTAGG + Intergenic
1157272997 18:46290859-46290881 GGCTTCAGGAGTCCTGGGTCTGG - Intergenic
1160795708 19:944551-944573 GGGGTCGGGGGTCCTGGGTGGGG - Intronic
1161455245 19:4366666-4366688 GGGTTGGGGGGTCCTGGTATGGG - Intronic
1162964418 19:14149213-14149235 AGCTTCCGGGGTCTGGGATTTGG + Exonic
1163510971 19:17734655-17734677 GGCTTCGCTGGGCCTGGTTTGGG + Intergenic
1165115323 19:33524805-33524827 GGCTTCGAGGGTTCTGCTTTTGG + Intergenic
1165309521 19:35021899-35021921 AGGATCGGGGGTCCTGGACTGGG + Intronic
1166282402 19:41802930-41802952 GGGTTCTGTGGTCCTGGATGAGG - Intronic
1166574815 19:43827547-43827569 GGCATCGGGGGTGCTGGAGGTGG + Intronic
1167154387 19:47729469-47729491 GGCTTGGAGGTTCCTGGATCAGG + Intronic
1167482559 19:49742059-49742081 GGCATGGGGCGTCCTGGAGTTGG - Intronic
1168326143 19:55539445-55539467 GGGTGCTGGGGTCTTGGATTTGG + Intergenic
926218040 2:10917296-10917318 GGCTGCAGGGGACCTGGAATCGG - Intergenic
929561292 2:42958059-42958081 TCCTTCAGGGGTCCTGGATACGG + Intergenic
934305651 2:91819784-91819806 GGTTTTGGGGTTTCTGGATTTGG + Intergenic
934327605 2:92032958-92032980 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
934465990 2:94263537-94263559 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
939293316 2:140222867-140222889 GGTTTCGGGGGACTTGGCTTTGG + Intergenic
939555993 2:143674114-143674136 GGATTTTGGGGTCATGGATTAGG - Intronic
942620002 2:177835743-177835765 GGCTCCGCGGGCCCTGCATTCGG + Intronic
947601760 2:231455481-231455503 GGCTTCGGGGGTCGTGGTGGAGG - Exonic
1171722594 20:28579276-28579298 GGCTTAGGAGGTCTAGGATTGGG - Intergenic
1171755491 20:29104170-29104192 GGCTTAGGAGGTCTAGGATTGGG + Intergenic
1171787194 20:29478714-29478736 GGCTTAGGAGGTCTAGGATTGGG - Intergenic
1173658434 20:44716750-44716772 GGCTCCGGGGCTCCTGGCTGTGG + Intronic
1175530840 20:59673515-59673537 GGCTTCTGGGGCCCTGAATGTGG + Intronic
1176030175 20:63007872-63007894 GGCTTCTCCGGTCCTGGCTTGGG + Intergenic
1176048850 20:63106028-63106050 GGCTCCGGGGCTCCTGGAGGAGG + Intergenic
1176115178 20:63429083-63429105 GGCTTCGGCGGGCCCGGACTTGG - Intronic
1179574179 21:42296737-42296759 GGCACCGTGGGTCCTGGATGGGG + Exonic
1180106555 21:45622661-45622683 GGCTTCGGGGACCCAGGATGTGG - Intergenic
1180279907 22:10684174-10684196 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
1180296150 22:10937961-10937983 GGCTTAGGAGGTCTAGGATTGGG - Intergenic
1180412525 22:12628050-12628072 GGCTTAGGAGGTCTAGGATTGGG + Intergenic
1183191338 22:36323741-36323763 GGGTTGGGGGGTCCTGGCCTAGG - Intronic
1184376540 22:44117170-44117192 TGCTTAGGGGGTCCTGGGTTAGG + Intronic
954549201 3:51466290-51466312 GGCTTTGGGGGTCCATGTTTTGG - Intronic
957371464 3:79300289-79300311 GGCTTGGCGGGTCCTGCACTTGG + Intronic
966794277 3:183698434-183698456 GGCTTTGGGGGTCCAGGGATGGG + Intronic
967071386 3:185965417-185965439 GGGTTGGGGGGTGCTGGAGTAGG - Intergenic
968478699 4:824762-824784 GTCCTCTGGGGTCCTGGTTTGGG - Intronic
973144274 4:46805082-46805104 GGCTTGGCGGGTCCTGCACTCGG - Intronic
977962587 4:103102897-103102919 GGTTTTGGGGTTCCTGGAATTGG + Intergenic
979018047 4:115459853-115459875 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
985439578 4:189970725-189970747 GGCTTAGGAGGTCTAGGATTGGG + Intergenic
986050081 5:4081783-4081805 GCCTTTGGGGGTCCTGGAGGAGG - Intergenic
992106337 5:73451604-73451626 GGCTGCGGGGGCCCGGGACTGGG + Intergenic
992836927 5:80650807-80650829 GGTTTCGGGGGTCTTAGCTTTGG + Intronic
994085170 5:95750604-95750626 GAATTCTGGGGTACTGGATTTGG - Intronic
1000389396 5:160707336-160707358 AGCTTAGGGGGTCCTAGATTTGG - Intronic
1002199970 5:177522232-177522254 GGCTTGGGGGCTTCTGGATTGGG + Intronic
1003222983 6:4178157-4178179 GGATTCTGGGGTCCTGGTTTGGG + Intergenic
1006030003 6:31171484-31171506 GGCTGCGGGGTGGCTGGATTTGG - Intronic
1006160644 6:32038958-32038980 AGCTTCCAGGGACCTGGATTGGG - Intronic
1006779256 6:36620982-36621004 GGCAGCGGGGGTCCTTGATAAGG + Intergenic
1018599456 6:165524314-165524336 GGTTTTGGGGTTCCTGGAGTTGG + Intronic
1018836072 6:167485187-167485209 TGATTCGGGAGTCCTGGAGTGGG - Intergenic
1021199236 7:17709616-17709638 GGCTTCTGGAGTACTGGATATGG - Intergenic
1023852660 7:44158909-44158931 GGCCTTGGGGGTCCTGGCTAGGG - Intronic
1026127262 7:67589845-67589867 GGCTTGGGGGACCCTGAATTAGG + Intergenic
1029113816 7:98226710-98226732 GGCTTCGGGAGTTCAGGAGTTGG + Intronic
1031262388 7:119537590-119537612 GGCTTAGGGAGTCATGGCTTTGG - Intergenic
1031262498 7:119539023-119539045 GGCTTAGGGAGTCATGGCTTTGG + Intergenic
1032025589 7:128439353-128439375 GGAGTCGGGGGCACTGGATTAGG - Intergenic
1032840014 7:135706011-135706033 GGCTGAGGGGGTCCTGGGGTGGG + Intronic
1035621159 8:1036558-1036580 GCCTTTGGGGATCCTGGAATGGG + Intergenic
1036635348 8:10546744-10546766 GGCTTCAGTGGGCCTTGATTGGG - Intronic
1036761024 8:11508623-11508645 GCCTTCGGGTCTCCTGGAATTGG + Intronic
1041985793 8:63921265-63921287 GGCTTGGGGGTTTCTGGAGTTGG + Intergenic
1045933720 8:107655676-107655698 GGCTTGGCGGGCCCTGCATTCGG + Intergenic
1049319193 8:141986987-141987009 GACTTTGGGGGAGCTGGATTTGG - Intergenic
1049857049 8:144868895-144868917 GGTTTTGGGGTTTCTGGATTTGG + Intergenic
1053696045 9:40640314-40640336 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
1053747943 9:41219821-41219843 GGCTTAGGAGGTCTAGGATTGGG + Intergenic
1054307292 9:63439532-63439554 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
1054338440 9:63830694-63830716 GGCTTAGGAGGTCTAGGATTGGG - Intergenic
1054406023 9:64763524-64763546 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
1054439649 9:65249011-65249033 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
1054479344 9:65645550-65645572 GGCTTAGGAGGTCTAGGATTGGG - Intergenic
1054490758 9:65772928-65772950 GGTTTTGGGGTTTCTGGATTTGG + Intergenic
1055317330 9:75047269-75047291 GGATTCAGGGGTCCTCGAGTAGG + Intergenic
1057897310 9:98919654-98919676 GGCCTCAGGGGGCCTGGATTGGG - Intergenic
1059433677 9:114264345-114264367 GTCCTCGGGGGCCCTGGAATAGG - Exonic
1062148825 9:135007090-135007112 GGCTTAGGGGAGCCAGGATTGGG - Intergenic
1202778492 9_KI270717v1_random:13927-13949 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
1202784076 9_KI270718v1_random:30592-30614 GGCTTAGGAGGTCTAGGATTGGG + Intergenic
1202803001 9_KI270720v1_random:18988-19010 GGCTTAGGAGGTCTAGGATTGGG - Intergenic
1202629104 M:1889-1911 GGTTTCGGGGGTCTTAGCTTTGG - Intergenic
1203447795 Un_GL000219v1:76201-76223 GGCTTAGGAGGTCTAGGATTGGG - Intergenic
1203585570 Un_KI270747v1:326-348 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
1187670552 X:21662010-21662032 GGCATCTGGGGCCCTGCATTTGG - Intergenic
1191630485 X:63316426-63316448 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
1197097079 X:122609617-122609639 GGTTTTGGGGTTTCTGGATTTGG + Intergenic
1200211983 X:154350785-154350807 GGCTTAGGGGGCCCAGGAGTTGG + Intronic
1200909016 Y:8514640-8514662 GGCTTCATGGGTCCTGAAGTTGG + Intergenic
1200957982 Y:8970652-8970674 GGCTTAGGGGCTGCTGGGTTTGG - Intergenic
1201193805 Y:11472226-11472248 GGTTTTGGGGTTTCTGGATTTGG - Intergenic
1202107221 Y:21384177-21384199 GGCTTCAGGGGTCCTGAATTTGG - Intronic
1202195747 Y:22297245-22297267 GGCTTCACGGGTCCTGAAGTTGG - Intergenic
1202199597 Y:22332083-22332105 GGCTTCATGGGTCCTGAAGTTGG + Intronic