ID: 912401656

View in Genome Browser
Species Human (GRCh38)
Location 1:109398103-109398125
Sequence TGCTAAGATGCGGGACTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 51}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401642_912401656 29 Left 912401642 1:109398051-109398073 CCACTCCTCATTGGCTCGCGTCG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 912401656 1:109398103-109398125 TGCTAAGATGCGGGACTGATTGG 0: 1
1: 0
2: 1
3: 3
4: 51
912401650_912401656 6 Left 912401650 1:109398074-109398096 CCTCCGGCTTCGGGGGTCCTGGA 0: 1
1: 0
2: 0
3: 4
4: 103
Right 912401656 1:109398103-109398125 TGCTAAGATGCGGGACTGATTGG 0: 1
1: 0
2: 1
3: 3
4: 51
912401641_912401656 30 Left 912401641 1:109398050-109398072 CCCACTCCTCATTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 912401656 1:109398103-109398125 TGCTAAGATGCGGGACTGATTGG 0: 1
1: 0
2: 1
3: 3
4: 51
912401643_912401656 24 Left 912401643 1:109398056-109398078 CCTCATTGGCTCGCGTCGCCTCC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 912401656 1:109398103-109398125 TGCTAAGATGCGGGACTGATTGG 0: 1
1: 0
2: 1
3: 3
4: 51
912401651_912401656 3 Left 912401651 1:109398077-109398099 CCGGCTTCGGGGGTCCTGGATTC 0: 1
1: 0
2: 1
3: 8
4: 107
Right 912401656 1:109398103-109398125 TGCTAAGATGCGGGACTGATTGG 0: 1
1: 0
2: 1
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401656 Original CRISPR TGCTAAGATGCGGGACTGAT TGG Intergenic
911839556 1:102662614-102662636 TACTAAAATGCTGGACTGAAAGG - Intergenic
912401656 1:109398103-109398125 TGCTAAGATGCGGGACTGATTGG + Intergenic
922789200 1:228301010-228301032 GGCTAAGATTTGGGACTGTTAGG - Intronic
1065751633 10:28892927-28892949 TGTAAAGATGCAGGTCTGATAGG + Intergenic
1067709322 10:48635740-48635762 TGCCAGGAAGCAGGACTGATGGG - Intronic
1071768701 10:88700048-88700070 TGTAAAGATGCAGGATTGATGGG + Intergenic
1081400745 11:42639934-42639956 TGCTAAGATGTGGGACAGGAGGG - Intergenic
1081657239 11:44865612-44865634 TGCTAGGAAAAGGGACTGATGGG - Intronic
1082224963 11:49694117-49694139 TTCTAAGATGCGGCACTGGCCGG - Intergenic
1096467090 12:51852642-51852664 TGCTAGGATGCGGGACAGATAGG - Intergenic
1097164938 12:57078891-57078913 TGCTAAGGGGCGGGACTCATAGG - Intronic
1098994898 12:77107845-77107867 TGGTAAGATGCAGTACTGAAGGG - Intergenic
1100690453 12:97033728-97033750 TGCTTAGATGTTGGTCTGATAGG + Intergenic
1101128309 12:101662466-101662488 TGCAAAGATGCGGACCTCATAGG - Exonic
1108993333 13:56693295-56693317 TGCTAAGAAGAGGAACTGACTGG - Intergenic
1115601797 14:34962222-34962244 TGCTAAGGTGCTGGAATTATAGG + Intergenic
1138252239 16:55509805-55509827 TGGGAAGATGCGGGCCTGAGAGG + Intronic
1139335090 16:66225993-66226015 TGCTAAGGTGTGGCACTGAAGGG + Intergenic
1145254345 17:21314487-21314509 TGCTGAGATCCTGGACTGAGGGG + Exonic
1145322253 17:21773475-21773497 TGCTGAGATCCTGGACTGAGGGG - Intergenic
1149863222 17:60135845-60135867 TGCTAAGTTGGGTGACTGTTCGG + Intergenic
1156827069 18:41443758-41443780 TGCTAAGGTGAGTGATTGATTGG + Intergenic
1159322690 18:66874022-66874044 TGCAAAGATGTGGGAGTCATGGG - Intergenic
1167381954 19:49143300-49143322 TGCTGATATGCCGGAATGATGGG - Intronic
932122597 2:69115386-69115408 TACTAAGATGGGGCACTGTTGGG - Intronic
932164079 2:69490094-69490116 TTCTAAGAAGCAGCACTGATGGG + Intronic
941305489 2:163860150-163860172 TGTTAAGATGGTGCACTGATTGG - Intergenic
943526425 2:189022144-189022166 TGATAAAATGTGTGACTGATTGG + Intergenic
945513302 2:210729436-210729458 AGCTAAGAAGCGTGAATGATAGG - Intergenic
1168860415 20:1042413-1042435 GGCTAAGATACGAGACAGATTGG - Intergenic
1170176090 20:13471652-13471674 TTCTAAGATGTGGGATGGATTGG - Intronic
1178163119 21:29941159-29941181 AGATAAGAAGAGGGACTGATAGG + Intergenic
1180937219 22:19633628-19633650 TGCCAAGGTGCGGGCCTGGTGGG - Intergenic
1184347139 22:43920688-43920710 TGATATGATGTGGGACTGATTGG - Intergenic
950212988 3:11137473-11137495 TGATTAGATGCTGGAATGATGGG + Intronic
950788672 3:15455602-15455624 TGCTAAGATGTAGGACTGGGAGG + Intronic
965139795 3:164818286-164818308 TGCTTAGATGGGGGATTGAGAGG + Intergenic
967865889 3:194189361-194189383 TGCCCAGATGCAGGGCTGATAGG - Intergenic
971929231 4:33057862-33057884 TGCTAAGAAGCCAGACTGCTTGG - Intergenic
974411903 4:61552725-61552747 TCCCAAGATGCTGGACTTATAGG + Intronic
1001276566 5:170355549-170355571 TGCTGAGATGGGGGAATCATGGG + Intronic
1006698908 6:35955873-35955895 TGCTGAGACAAGGGACTGATGGG - Intronic
1019863210 7:3679884-3679906 TGCTAAGAAGTGTGACCGATAGG - Intronic
1021969174 7:25950765-25950787 TGCTAGGATGGGGGACAGAGTGG - Intergenic
1022205378 7:28158669-28158691 GGCTAAGATGCGGGTCTCATAGG + Intronic
1023879413 7:44309709-44309731 TGCTAGGGTGAGGGACTGACTGG - Intronic
1026141644 7:67711947-67711969 TGCTCAGATTCGGGAATTATGGG + Intergenic
1032845456 7:135748122-135748144 TGCTAAAATGATGGAGTGATGGG - Intronic
1034079507 7:148263095-148263117 TGGTAAGATCAGAGACTGATCGG + Intronic
1035074329 7:156168604-156168626 ATCTAAGACGAGGGACTGATGGG + Intergenic
1035194329 7:157203522-157203544 TGCTAAGCTGAGGCACTTATGGG - Intronic
1035285854 7:157806893-157806915 TGCTGAGGTGCAGGTCTGATGGG - Intronic
1037077107 8:14733704-14733726 TGCTAACATGAGGGAAAGATGGG + Intronic
1042646986 8:70997877-70997899 TTGTAGGATGCGGAACTGATTGG + Intergenic
1050758141 9:9033419-9033441 TTCTGAGATGTGGGAATGATTGG - Intronic
1199717476 X:150516736-150516758 TGCTGAGATGCTGGAGTGCTGGG - Intergenic