ID: 912401911

View in Genome Browser
Species Human (GRCh38)
Location 1:109400539-109400561
Sequence TATTAAGTATAGCATGTTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912401911_912401912 4 Left 912401911 1:109400539-109400561 CCATCAACATGCTATACTTAATA 0: 1
1: 0
2: 2
3: 14
4: 172
Right 912401912 1:109400566-109400588 TTAAAATCACTAGAAGTCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912401911 Original CRISPR TATTAAGTATAGCATGTTGA TGG (reversed) Exonic
901113538 1:6819121-6819143 TTTTAAATATAAAATGTTGAGGG + Intronic
904730277 1:32585554-32585576 AATGAAGTATACCATGTTCACGG + Intronic
905759882 1:40546499-40546521 TTTTCTCTATAGCATGTTGATGG + Intronic
908179917 1:61593442-61593464 TACTAAATAAAGCATATTGAAGG - Intergenic
908684272 1:66697844-66697866 TATTTAATAAAGCATGTTGAAGG - Intronic
908743932 1:67357054-67357076 TCTTAAATATAGCATGTTTTAGG + Intronic
909668982 1:78167001-78167023 TATCAAGTATAGCAATTTGTAGG - Intergenic
910236943 1:85046712-85046734 TATAAAGAATAGCATGGGGAAGG + Intronic
910774160 1:90858326-90858348 TTTTAAGTATAGAAAGATGAAGG + Intergenic
911955514 1:104229032-104229054 AATTAAGAATATCATGTTAAGGG - Intergenic
912033465 1:105280405-105280427 TATTAAGAATAGATTGTGGATGG + Intergenic
912372023 1:109181058-109181080 TATTACCTATAGCATAGTGAGGG + Intronic
912401911 1:109400539-109400561 TATTAAGTATAGCATGTTGATGG - Exonic
913712119 1:121495782-121495804 CATCTAGTAGAGCATGTTGAAGG + Intergenic
914833295 1:151186690-151186712 TAATGTGTATAGCATGTTTATGG + Intronic
915494399 1:156271138-156271160 TATTAAATTTAGCTTGTTGAGGG - Intronic
917864963 1:179185858-179185880 TATTAAGTATTTCAAGTTAATGG - Intronic
918285156 1:183046452-183046474 TATAAATTATACCATGTTCATGG - Intronic
919552444 1:199008020-199008042 GATTAAGAAAAGTATGTTGATGG - Intergenic
919667815 1:200309434-200309456 GATAAAATATTGCATGTTGATGG - Intergenic
921247630 1:213261293-213261315 TTTTAAGTAAAGCATCTTGAAGG + Intronic
921805837 1:219453985-219454007 CATTAAGTAGAGCATGTTGAGGG - Intergenic
922495002 1:226049764-226049786 TACTAAGGATAGCATTTTAATGG + Intergenic
923813274 1:237344443-237344465 AATTAAGTGTAGCATATTCAGGG - Intronic
923897596 1:238289808-238289830 CAATCAGTATAACATGTTGATGG + Intergenic
924404858 1:243731986-243732008 TATTAAGTAAATAATGTAGATGG - Intronic
1063329461 10:5142454-5142476 TATTGAGGAATGCATGTTGAAGG - Intergenic
1064549714 10:16487136-16487158 TAATAAGTATAGCATGTGTTGGG + Intronic
1065112899 10:22457362-22457384 TAATAAATAAAGCATGTGGAGGG + Intergenic
1066016800 10:31254094-31254116 AATAATGTATAGCATTTTGATGG + Intergenic
1069194652 10:65535422-65535444 TAGTAAGTATATCATGTCAAGGG + Intergenic
1079219085 11:18543404-18543426 AGTTAAGTATGGCATGTTCATGG - Intronic
1084637352 11:70400591-70400613 TTTTAATTGTAGCATTTTGATGG + Intronic
1087171453 11:95053654-95053676 TATTAAGAAAAACATCTTGAAGG + Intergenic
1089097763 11:115933583-115933605 TTTTAAGCAAAGCATGTTGAGGG + Intergenic
1092464156 12:8713440-8713462 TATCAAGAACAGAATGTTGAGGG + Intronic
1092832683 12:12460140-12460162 AATGAAGTATATCATGTTCATGG - Intronic
1092902146 12:13069963-13069985 TAGTAGGTATAGTAGGTTGAAGG + Intronic
1093311594 12:17593747-17593769 TATTAAGTATACTCTTTTGAAGG - Intergenic
1095675482 12:44912668-44912690 TATTAGGCTTAGCATGTAGAAGG - Intronic
1097523208 12:60695455-60695477 TCTGAAGTAGAGCATTTTGAGGG - Intergenic
1097564986 12:61256391-61256413 TGTTAAGTCTAGCTTGTTTAGGG - Intergenic
1100511039 12:95274096-95274118 TATTTACTATAGCATAGTGAGGG + Intronic
1102597167 12:114001719-114001741 CATAAATTGTAGCATGTTGAGGG + Intergenic
1103101222 12:118177893-118177915 TGTTCAGTAAAGCATGTTTATGG - Intronic
1104106522 12:125665182-125665204 TGTTAAGTAAAGCATATTGGTGG - Intergenic
1109133706 13:58621520-58621542 AATCAAGTTTAGCATGTTGTTGG - Intergenic
1109331487 13:60936333-60936355 TATTATGTATAGCATATAGCAGG - Intergenic
1109440244 13:62361187-62361209 TATTAAGTATGGCATTTTGTGGG - Intergenic
1110194228 13:72767943-72767965 TATTAACTCAGGCATGTTGAAGG - Intronic
1111769600 13:92580108-92580130 TGTTAAGGACAGCATGTTCAAGG + Intronic
1114181375 14:20370909-20370931 TATGAATAATAGCATCTTGAGGG - Intronic
1131065871 15:89434807-89434829 TAGTAAGCAGAGTATGTTGAGGG - Intergenic
1137875024 16:51988043-51988065 TATGAAGTCTACCATGTGGAGGG - Intergenic
1138792242 16:59919400-59919422 GATTAAGAATACCATTTTGAGGG + Intergenic
1139296577 16:65906726-65906748 TTTTTAGTATAACAGGTTGAGGG - Intergenic
1140190921 16:72815439-72815461 CATCCAGCATAGCATGTTGATGG - Intronic
1143707962 17:8713009-8713031 AATTAAGTATAGAAAGTTTAAGG + Intergenic
1144263031 17:13541882-13541904 CATGTAGTAAAGCATGTTGAAGG + Intronic
1150922371 17:69496810-69496832 TATTAAGTATAAGATGCTGCAGG - Intronic
1152400563 17:80064106-80064128 AATTAAGTATACCACGATGAGGG - Intronic
1153408235 18:4764646-4764668 TATTAAGTAGAGCCTGTAAATGG - Intergenic
1156894172 18:42225726-42225748 TATAAAGCACAGCATGTTTACGG - Intergenic
1158186028 18:54772681-54772703 TATTAAATATAACATCTTAAGGG - Intronic
1158205042 18:54983752-54983774 TATTAAATATGGCACGTTGGGGG + Intergenic
1159353775 18:67309620-67309642 CATTAATCATAGCATATTGAGGG - Intergenic
1165684157 19:37803737-37803759 TATGATGTATAGTAAGTTGATGG - Intronic
1166611478 19:44202929-44202951 TACTTAGCATAACATGTTGAAGG - Intergenic
1167862320 19:52295479-52295501 TATTAAGCATAGCATCTGGCCGG - Exonic
925043656 2:753965-753987 ATTTAAGTTTAGCATGTTCATGG + Intergenic
928067700 2:28183084-28183106 TCTTAAGTATATCATATTAATGG + Intronic
928645544 2:33348362-33348384 TATTAAATATAGAAAGGTGAAGG + Intronic
929359471 2:41068195-41068217 TATTAACAATAGCATCTAGAAGG + Intergenic
930097943 2:47581260-47581282 TTTTAAGTATAACATAATGAGGG - Intergenic
931013984 2:57953691-57953713 TATGAAGAGTAACATGTTGATGG + Intronic
931412925 2:62051784-62051806 TGTTCAGTAAAGCATGTTAATGG + Intronic
931925477 2:67067665-67067687 TATTTAGGAAAGCATGTTAATGG - Intergenic
933561121 2:83887517-83887539 GAATAAGTGTAGCATTTTGATGG - Intergenic
936756552 2:115720627-115720649 AATAAAATATAGCATGTTGGAGG + Intronic
936760658 2:115776945-115776967 AATCAAGTATACCATGTTGATGG - Intronic
939236041 2:139494753-139494775 TATTTAGGAGAGCATATTGATGG + Intergenic
941208568 2:162606861-162606883 TAATAAAGATAGCATTTTGATGG - Intronic
942351814 2:175060697-175060719 TAATAATTATTGAATGTTGAAGG - Intergenic
942366760 2:175236264-175236286 TATTTAGTATAGTTTGATGATGG + Intergenic
944582380 2:201143166-201143188 TATTAAATATAGAAAGTTTAAGG - Intronic
945588587 2:211698389-211698411 TATTAAGTATAAGATATAGATGG + Intronic
947122170 2:226827835-226827857 TCTTGAGCATAGCATGTGGATGG + Intergenic
947671514 2:231939493-231939515 TATTAAATATAAAATGTGGAAGG - Intergenic
948509604 2:238454828-238454850 TGGAAAGTATGGCATGTTGAGGG + Intergenic
1169552296 20:6713598-6713620 AATTACATATAGCATGTTGCAGG + Intergenic
1175012304 20:55750890-55750912 TATTAAGTAAAGCAGGTAGTTGG + Intergenic
1179069236 21:38056114-38056136 CATTAAGCACATCATGTTGAAGG - Intronic
1181114500 22:20622729-20622751 TGTGAAGTACAGCATGGTGATGG - Intergenic
1184993955 22:48189285-48189307 TATTAGGTATAGCATGTGTTTGG + Intergenic
953519097 3:43624105-43624127 TGTTAAGTATAGCAAATTGTTGG + Intronic
953763387 3:45712548-45712570 GATTAAATATAGATTGTTGAGGG + Intronic
955014688 3:55058988-55059010 TGTTAAGTGTACCATGTTAATGG - Intronic
955666335 3:61353203-61353225 GATTACGTATAGTATGGTGAGGG + Intergenic
956053904 3:65278240-65278262 TATTAATGACAGCATGTTTAGGG - Intergenic
956938182 3:74127726-74127748 TATTGAGTATGCCATGGTGAAGG + Intergenic
957014920 3:75051946-75051968 TATTATCTATATCATGTGGAAGG + Intergenic
957822264 3:85392764-85392786 TATTAAGTATAGGATTTAAATGG - Intronic
960896247 3:122508746-122508768 TATTAAGTGTGGCTTGTTGAAGG - Intronic
965233188 3:166080218-166080240 TATTAATGATAGAATGTAGATGG - Intergenic
966651782 3:182309447-182309469 GATTAAAGAGAGCATGTTGATGG - Intergenic
969122557 4:4920700-4920722 TATTAAGAAAAGCTTGGTGAGGG - Intergenic
971125615 4:23750798-23750820 TATTAAATATATCATAGTGAGGG - Intergenic
974582727 4:63826541-63826563 TATTAAATTTAGCATGCTAAAGG - Intergenic
977158227 4:93601200-93601222 GATTAAATATAGCATGATTATGG + Intronic
978451911 4:108843476-108843498 TGTTAAGGTTAGAATGTTGAAGG - Intronic
980064018 4:128162834-128162856 GATTAAGTATAGCAGGTACATGG - Intronic
980419140 4:132537513-132537535 TATTAACTGTATTATGTTGAAGG + Intergenic
982081140 4:151791477-151791499 TAATAAGTAGGGCATCTTGAGGG + Intergenic
983092325 4:163518571-163518593 TCTTAACTAGACCATGTTGAGGG + Intronic
984300763 4:177914358-177914380 TATTAAGTATAACATATTAATGG - Intronic
985002346 4:185498061-185498083 TATGAAGTAAAAGATGTTGAAGG - Intergenic
986987885 5:13519895-13519917 TATTAGGAGTAGCCTGTTGAAGG - Intergenic
989294625 5:39809111-39809133 AATTATTAATAGCATGTTGAAGG - Intergenic
989965511 5:50461927-50461949 CATCTAGTAGAGCATGTTGAAGG - Intergenic
990125055 5:52505548-52505570 AATTAAGTTTATCATGTGGAAGG - Intergenic
990743238 5:58933580-58933602 TACTAAGTATAGAATGGGGAGGG + Intergenic
990848938 5:60178975-60178997 TATTAAATTCAGGATGTTGAGGG + Intronic
991351550 5:65724371-65724393 TATTTAGTATAGCGTTTTTAAGG + Intronic
992983460 5:82202290-82202312 TTTTGAGTAAAGCATATTGATGG + Intronic
993250582 5:85516087-85516109 TAATATGTTTAGCATTTTGAAGG - Intergenic
993817485 5:92569286-92569308 TATTAAGTATAGAAACATGAAGG + Intergenic
994894296 5:105682348-105682370 TAGTAAGAATAGCTTGTTGGTGG + Intergenic
995791701 5:115895388-115895410 TAGTATGTGTAGCATGTTAATGG + Intronic
995933922 5:117485565-117485587 ATTTAAGTGTAGCATGCTGAGGG + Intergenic
996193281 5:120571756-120571778 TATTATGTATCACATGTTAATGG + Intronic
998800300 5:145862412-145862434 GATTAAAAAGAGCATGTTGAGGG - Intronic
998827983 5:146124716-146124738 CATTAAGTATAACATGTTCTAGG - Intronic
1000678115 5:164148273-164148295 CATTAAGTATATAATGTAGATGG - Intergenic
1001136729 5:169108681-169108703 TCTGAAGTATGGCATGTGGAGGG - Intronic
1001139934 5:169136208-169136230 TCTTAAGTTTCCCATGTTGACGG - Intronic
1002879810 6:1241309-1241331 TGTTAAGTATAGTATGTAAATGG + Intergenic
1003894440 6:10593653-10593675 AATGAAGTATTGCATTTTGATGG + Intronic
1005188141 6:23185712-23185734 TTTTGAGTCTAGCATTTTGAGGG - Intergenic
1006892508 6:37441134-37441156 TATTAAGTAGTACAGGTTGAAGG + Intronic
1009751561 6:67883864-67883886 TTTTATGTCTAGCCTGTTGAAGG + Intergenic
1010087178 6:71934502-71934524 TGTTAAGTATAAAATATTGAGGG - Intronic
1011729975 6:90251711-90251733 TGTGAAGTATATCATGCTGAGGG - Intronic
1012619860 6:101330065-101330087 TATGTAGTATACCATGTTAATGG - Intergenic
1014463318 6:121725392-121725414 TATTAATTCTAACATTTTGAAGG - Intergenic
1014885545 6:126776443-126776465 GATTATGTTTAGCATGTTCAAGG + Intergenic
1015567542 6:134589001-134589023 TTTTAAGTAAAGCCTGATGAAGG - Intergenic
1015744241 6:136493025-136493047 TATTAAGTATAACAGTTTTATGG - Intronic
1017575473 6:155797627-155797649 TACTAAGTTGAGCATGTTGTGGG + Intergenic
1017646722 6:156546023-156546045 TATTGAGGATTGCATGGTGATGG - Intergenic
1020792816 7:12646959-12646981 TATAAAATATAGCAAGTTCAGGG - Intronic
1023007096 7:35883265-35883287 TATTCAGTATACCATTTTTAGGG - Intronic
1023013889 7:35947079-35947101 TATTCAGTATACCATTTTCAGGG - Intergenic
1023302958 7:38793131-38793153 AAGTAAGTATAGCATGTTGAAGG - Intronic
1024067099 7:45747905-45747927 TATTCAGTATACCATTTTTAGGG + Intergenic
1024126080 7:46295967-46295989 TATTAACTATAGCCAGTTAATGG + Intergenic
1025712290 7:63924432-63924454 TTATAAGTATAGTATGTTCATGG + Intergenic
1027818914 7:83017812-83017834 TATTAACTATACAATTTTGATGG + Intronic
1028663379 7:93310792-93310814 AATTAAGTACAGAATATTGATGG - Intronic
1030175933 7:106653556-106653578 TATTAAGTAAAGCGTCTTGGAGG - Intergenic
1031145986 7:117997038-117997060 TATAAAGTATAATATGTTAAAGG - Intergenic
1036531596 8:9594198-9594220 TTTTAAGTATAGTATTTTGAAGG + Intronic
1040758929 8:50814192-50814214 TCTTAATTATAGCATCTTCATGG - Intergenic
1042981892 8:74539229-74539251 TCTTAAATATAGCATACTGATGG + Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1046362982 8:113186163-113186185 CATTAAGTAGAACATGTTGATGG - Intronic
1047832430 8:128649898-128649920 TATGAAGTATTGCATTTAGATGG + Intergenic
1048656402 8:136541990-136542012 TATGAAGTGGAGTATGTTGATGG + Intergenic
1051150116 9:14071037-14071059 TATTAAATATATCTTGATGAGGG - Intergenic
1052011184 9:23411397-23411419 TATTACGTTTAGCATTTTGCTGG - Intergenic
1054989716 9:71309841-71309863 TTTTAAAAATAGCATGCTGAGGG - Intronic
1055978993 9:81983013-81983035 GCTTTAGTATAGCATGTTCATGG - Intergenic
1058186574 9:101862337-101862359 GATTAACTATAGTATATTGAGGG + Intergenic
1059182286 9:112228660-112228682 TAATAAGTTTAGAGTGTTGATGG - Intronic
1059544393 9:115161596-115161618 AATTAATCATAGCATGATGAGGG - Intronic
1059982056 9:119784007-119784029 TACTAAGTATAACATGGTGTAGG - Intergenic
1060196514 9:121627462-121627484 TCTGAAGGATAGCATGTAGAAGG + Intronic
1186872078 X:13783183-13783205 TACTATCAATAGCATGTTGAAGG + Intronic
1186967017 X:14798460-14798482 TGTTAAGAAAAGCATTTTGAAGG - Intergenic
1187078600 X:15962176-15962198 TATTCAGAAATGCATGTTGATGG + Intergenic
1187840368 X:23480931-23480953 TATTCAGTATAGCATCTTCAGGG + Intergenic
1188070313 X:25710273-25710295 TATTAAGGAAAACATGTTGATGG - Intergenic
1188754488 X:33945397-33945419 TTTTAAGGATATCATGTTCATGG + Intergenic
1193676352 X:84457561-84457583 TATTTAATATTGCATGTAGATGG + Intronic
1193921085 X:87426878-87426900 TACTATGTATAGCATTTTTAAGG + Intergenic
1194573563 X:95582756-95582778 TAGAAAATATACCATGTTGATGG - Intergenic
1195372435 X:104191072-104191094 TATTGTGGATAGCATTTTGAAGG + Exonic
1197215946 X:123867048-123867070 TGTTAACTATAGAATGTTGAAGG - Intronic
1199370208 X:147038656-147038678 TATTAATCATTGCATGTTGAAGG + Intergenic
1201332442 Y:12839472-12839494 TATTAAGTATGCTATGTAGATGG - Intronic